Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAJ12059.5                          21 END     17         18       80                transcription factor 20 isoform 2; stromelysin-1 platelet-derived growthfactor-responsive element binding protein; stromelysin 1 PDGF-responsiveelement-binding protein; SPRE-binding protein; nuclear factor SPBP [Homosapiens]

 This cluster: approximate FL confidence score = 0%

 1012153661 Xt7.1-TEgg061b12.3.5 - 91 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg061b12.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCCACCAGGTCAGAGAAAGTCACAGAAGAATCTTCAACACTAGATAATGATGAAGTTGAAACGTCATCACAGCCAGAGGTGCCTGAAACAGTTAAAGATGATGATAATGTCAAGGAATGCCCCCCTGACCAGAATGGAGAACCTAGTGATGCCGATTCTCAGCCTGTTCCTATTACAAGTAGTACTTCTAGAACAGAGGCTAAATCTCCTGTGGGCTCTGGGTTTAGTTTTAAAGAAGGAGCAACAAGCTCTAGAAATGCCAGCAACTTGCCTCAGCATCTTAAAACTCCTGATTCAGCAGGGTGTGGAGGACAGGGTGATAAGAAATCAGGAACAGGAAGAAATGATAAGTATCCTAGCCTCCTTCAGGAAGTCCTGCAAGGACATCATCAGCAGGAACGAAGGTATGCTAGAAACACCCAAGACCCTCCACCAGTTACTGGAAGTTCTGAAGCAAGTTTGAGACCAAATATACTCATGAGCCAGGCAAGTGAGTTACCTAACCGTAACATCCTTGGCAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAGGCAGCTTGTTCGAGATCCTACTGCTTCTCATCATGTTGGACAAGAAAGATCAGCTGATGGAAGATCTGGACAGTCTGTAATCTTACCTAGTGGAATGATATCTTTAGATGCAAAGTCAAGTAACCAGGGAGGAACGCCTAAAGAACAAGACACTGAAGCAACAAAGATGCATAGAAAAAGAACTACAGATCACTGCATACCATACAGCACCAAAGAATCTGCTAGGGGCAATGGCAGCCCAAGATCCATGACCTTTGACCCAACCCAGGATTATAGTCCACATAATAGTAGAGGACCTCATCCCAGAAGGGGAACTGCCAGAGTGGGGGCCCGTGGTAGATCACCTGTACAGGATCTTGGTGACAAAATGAAGATGTCTCCAGGGAGAAGCAGAGGACCAGCAGAAACTCATCATATGAATCCAACAATGAGCCTCTCAGAAAGAGCAAGCAGAGAAGCTTTTTACTCTGCTTTTTTTCAAAATGCTGATAATGCTGCTTTGAGTTATCATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGCTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCTATATAAATATAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAATCTTTTTATGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCGAAATAGTCTGGTCAGAAGCTCATTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATATGGTCAAGAAACATTTTCTTTGTTTTTAAAGCAAAAATAAACCTCTTATGGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGTTCATTT
                                                  Xt7.1-CHK-1008264915                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAGGTCAGAGAAAGTCACAGAAGAATCTTCAACACTAGATAATGATGAAGTTGAAACGTCATCACAGCCAGAGGTGCCTGAAACAGTTAAAGATGATGATAATGTCAAGGAATGCCCCCCTGACCAGAATGGAGAACCTAGTGATGCCGATTCTCAGCCTGTTCCTATTACAAGTAGTACTTCTAGAACAGAGGCTAAATCTCCTGTGGGCTCTGGGTTTAGTTTTAAAGAAGGAGCAACAAGCTCTAGAAATGCCAGCAACTTGCCTCAGCATCTTAAAACTCCTGATTCAGCAGGGTGTGGAGGACAGGGTGATAAGAAATCAGGAACAGGAAGAAATGATAAGTATCCTAGCCTCCTTCAGGAAGTCCTGCAAGGACATCATCAGCAGGAACGAAGGTATGCTAGAAACACCCAAGACCCTCCACCAGTTACTGGAAGTTCTGAAGCAAGTTTGAGACCAAATATACTCATGAGCCAGGCAAGTGAGTTACCTAACCGTAACATCCTTGGCAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAGGCAGCTTGTTCGAGATCCTACTGCTTCTCATCATGTTGGACAAGAAAGATCAGCTGATGGAAGATCTGGACAGTCTGTAATCTTACCTAGTGGAATGATATCTTTAGATGCAAAGTCAAGTAACCAGGGAGGAACGCCTAAAGAACAAGACACTGAAGCAACAAAGATGCATAGAAAAAGAACTACAGATCACTGCATACCATACAGCACCAAAGAATCTGCTAGGGGCAATGGCAGCCCAAGATCCATGACCTTTGACCCAACCCAGGATTATAGTCCACATAATAGTAGAGGACCTCATCCCAGAAGGGGAACTGCCAGAGTGGGGGCCCGTGGTAGATCACCTGTACAGGATCTTGGTGACAAAATGAAGATGTCTCCAGGGAGAAGCAGAGGACCAGCAGAAACTCATCATATGAATCCAACAATGAGCCTCTCAGAAAGAGCAAGCAGAGAAGCTTTTTACTCTGCTTTTTTTCAAAATGCTGATAATGCTGCTTTGAGTTATCATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGCTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACxTCxCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCxxxxTxAATATAxAxAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAxxxxxxxxxGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAAxAxAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCxxxxTxGTCTGGTCAGAAxxxCxTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAxAAAAxATATGGTCAAGAxAxxxTTTxxTTxxTTTTAAAGCAAAAxxAAACCTCTTATGGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     4     4     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     7     7     7     7     7     7     7     7     6     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     5     5     5     5     5     5     5     5     5     4     5     3     4     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     7     5     6     5     6     5     6     5     6     5     7     4     6     4     6     4     6     5     6     5     6     5     7     5     7     5     7     5     7     6     8     6     7     7     8     7     8     7     9     7     9     7     9     7     9     6     8     6     8     6     8     6     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     6     7     6     8     6     8     6     8     6     8     7     9     7    10     7    10     8    10     8    10     9    11    11    13    10    12    14    15    15    16    16    16    16    16    17    17    22    22    22    22    23    23    23    23    27    27    28    28    28    28    28    28    27    28    28    29    28    29    30    31    31    32    31    32    33    34    33    34    33    34    33    34    34    35    34    35    34    35    36    37    37    38    37    38    37    38    37    38    36    38    36    37    36    38    35    37    37    38    37    38    37    39    37    39    37    39    37    39    37    39    37    39    39    40    40    40    40    40    40    40    22    40    23    41    23    41    25    44    25    44    25    44    25    45    26    48    26    48    26    48    26    48    26    48    24    47    25    48    20    34    20    35    20    35    20    35    20    35    20    34    19    33    19    35    11    25    10    26    10    26    10    26    10    27    10    28    10    29    10    29    10    26     8    21    10    20    10    20    10    20    10    20    10    20    10    19    10    14    10    14    10    15    10    15    10    15    10    15     9    16     9    16    10    16    10    16    10    16    10    16    10    16    10    16    10    16    10    16     9    16     9    15     2     9     2    10     7    10     3    10     3    11     3    11     3    11     3    11     2    11     3    10     3    10     2    10     4    11     5    11     6    11     7    11     7    11     7    10     7    10     7    10     7    10     7    10     7    10     6     9     5     9     6     9     4     7     4     6     3     5     3     5     2     5     2     5
  5   1   2  SIG                                    Xt7.1-TEgg061b12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAGGCAGCTTGTTCGAGATCCTACTGCTTCTCATCATGTTGGACAAGAAAGATCAGCTGATGGAAGATCTGGACAGTCTGTAATCTTACCTAGTGGAATGATATCTTTAGATGCAAAGTCAAGTAACCAGGGAGGAACGCCTAAAGAACAAGACACTGAAGCAACAAAGATGCATAGAAAAAGAACTACAGATCACTGCATACCATACAGCACCAAAGAATCTGCTAGGGGCAATGGCAGCCCAAGATCCATGACCTTTGACCCAACCCAGGATTATAGTCCACATAATAGTAGAGGACCTCATCCCAGAAGGGGAACTGCCAGAGTGGGGGCCCGTGGTAGATCACCTGTACAGGATCTTGGTGACAAAATGAAGATGTCTCCAGGGAGAAGCAGAGGACCAGCAGAAACTCATCATATGAATCCAACAATGAGCCTCTCAGAAAGAGCAAGCAGAGAAGCTTTTTACTCTGCTTTTTTTCAAAATGCTGATAATGCTGCTTTGAGTTATCATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGTTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCAAATATGTAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAAT------------GGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAG
  5   1   2  SIG                                      Xt7.1-XZG22336.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCCTTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACC
  5   1   2                                          Xt7.1-CAAJ13239.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTTTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGTTCATTTTAACCTTAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAM7035.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGTCAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGGCGGGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGAGCTGAAATTTCATTTTAATAACCCCAAATATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----A-T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T-T
                                               BLH MIN      71     106                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 2e-009     BAE06306.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 1e-009     XP_001194485.1 PREDICTED: similar to mKIAA1506 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-010     NP_001020984.1 UNCoordinated family member (unc-89) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 5e-020     NP_611291.1 CG5098-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Dr ---- 6e-045     XP_689373.1 PREDICTED: similar to transcription factor 20 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_416218.2 PREDICTED: similar to transcription factor 20 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_038864.2 transcription factor 20; stromelysin PDGF responsive element binding proteintranscription factor; stromelysin 1 PDGF responsive element binding protein [Musmusculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_852469.1 transcription factor 20 isoform 2; stromelysin-1 platelet-derived growthfactor-responsive element binding protein; stromelysin 1 PDGF-responsiveelement-binding protein; SPRE-binding protein; nuclear factor SPBP [Homosapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg061b12.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAA---------------------TGA---------------------------------------------------------------------------------ATG------------------------TGA---------------------------------------------------------------TGA---ATG------------------------------TGA------------------------------------TGA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------TAA---ATG---------------------ATG------------------------TAA------------------ATG---------------------------------------------------TGA---------------------------------------------------------TGA------TAA------------------------------ATG---------------------------------------TAA------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2  SIG                                    Xt7.1-TEgg061b12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAGGCAGCTTGTTCGAGATCCTACTGCTTCTCATCATGTTGGACAAGAAAGATCAGCTGATGGAAGATCTGGACAGTCTGTAATCTTACCTAGTGGAATGATATCTTTAGATGCAAAGTCAAGTAACCAGGGAGGAACGCCTAAAGAACAAGACACTGAAGCAACAAAGATGCATAGAAAAAGAACTACAGATCACTGCATACCATACAGCACCAAAGAATCTGCTAGGGGCAATGGCAGCCCAAGATCCATGACCTTTGACCCAACCCAGGATTATAGTCCACATAATAGTAGAGGACCTCATCCCAGAAGGGGAACTGCCAGAGTGGGGGCCCGTGGTAGATCACCTGTACAGGATCTTGGTGACAAAATGAAGATGTCTCCAGGGAGAAGCAGAGGACCAGCAGAAACTCATCATATGAATCCAACAATGAGCCTCTCAGAAAGAGCAAGCAGAGAAGCTTTTTACTCTGCTTTTTTTCAAAATGCTGATAATGCTGCTTTGAGTTATCATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGTTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCAAATATGTAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAAT------------GGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAG
                                                  Xt7.1-CHK-1008280492                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAGGCAGCTTGTTCGAGATCCTACTGCTTCTCATCATGTTGGACAAGAAAGATCAGCTGATGGAAGATCTGGACAGTCTGTAATCTTACCTAGTGGAATGATATCTTTAGATGCAAAGTCAAGTAACCAGGGAGGAACGCCTAAAGAACAAGACACTGAAGCAACAAAGATGCATAGAAAAAGAACTACAGATCACTGCATACCATACAGCACCAAAGAATCTGCTAGGGGCAATGGCAGCCCAAGATCCATGACCTTTGACCCAACCCAGGATTATAGTCCACATAATAGTAGAGGACCTCATCCCAGAAGGGGAACTGCCAGAGTGGGGGCCCGTGGTAGATCACCTGTACAGGATCTTGGTGACAAAATGAAGATGTCTCCAGGGAGAAGCAGAGGACCAGCAGAAACTCATCATATGAATCCAACAATGAGCCTCTCAGAAAGAGCAAGCAGAGAAGCTTTTTACTCTGCTTTTTTTCAAAATGCTGATAATGCTGCTTTGAGTTATCATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGTTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCxAAxxxGTAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGxxAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAG------------TCTTATGGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAA
  5   1   1       add Egg       in                   TEgg074h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCCACCAGGTCAGAGAAAGTCACAGAAGAATCTTCAACACTAGATAATGATGAAGTTGAAACGTCATCACAGCCAGAGGTGCCTGAAACAGTTAAAGATGATGATAATGTCAAGGAATGCCCCCCTGACCAGAATGGAGAACCTAGTGATGCCGATTCTCAGCCTGTTCCTATTACAAGTAGTACTTCTAGAACAGAGGCTAAATCTCCTGTGGGCTCTGGGTTTAGTTTTAAAGAAGGAGCAACAAGCTCTAGAAATGCCAGCAACTTGCCTCAGCATCTTAAAACTCCTGATTCAGCAGGGTGTGGAGGACAGGGTGATAAGAAATCAGGAACAGGAAGAAATGATAAGTATCCTAGCCTCCTTCAGGAAGTCCTGCAAGGACATCATCAGCAGGAACGAAGGTATGCTAGAAACACCCAAGACCCTCCACCAGTTACTGGAAGTTCTGAAGCAAGTTTGAGACCAAATATACTCATGAGCCAGGCAAGTGAGTTACCTAACCGTAACATCCTTGGCAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCT
  5   1   2       ext Egg                            TEgg098o15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGGAATGCCCCCCTGACCAGAATGGAGAACCTAGTGATGCCGATTCTCAGCCTGTTCCTATTACAAGTAGTACTTCTAGAACAGAGGCTAAATCTCCTGTGGGCTCTGGGTTTAGTTTTAAAGAAGGAGCAACAAGCTCTAGAAATGCCAGCAACTTGCCTCAGCATCTTAAAACTCCTGATTCAGCAGGGTGTGGAGGACAGGGTGATAAGAAATCAGGAACAGGAAGAAATGATAAGTATCCTAGCCTCCTTCAGGAAGTCCTGCAAGGACATCATCAGCAGGAACGAAGGTATGCTAGAAACACCCAAGACCCTCCACCAGTTACTGGAAGTTCTGAAGCAAGTTTGAGACCAAATATACTCATGAGCCAGGCAAGTGAGTTACCTAACCGTAACATCCTTGGCAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAGGCAGCTTGTTCGAGATCCTA
  5   1   2       ext Te3       in                         CAAM9321.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAGGCAGCTTGTTCGAGATCCTACTGCTTCTCATCATGTTGGACAAGAAAGATCAGCTGATGGAAGATCTGGACAGTCTGTAATCTTACCTAGTGGAATGATATCTTTAGATGCAAAGTCAAGTAACCAGGGAGGAACGCCTAAAGAACAAGACACTGAAGCAACAAAGATGCATAGAAAAAGAACTACAGATCACTGCATACCATACAGCACCAAAGAATCTGCTAGGGGCAATGGCAGCCCAAGATCCATGACCTTTGACCCAACCCAGGATTATAGTCCACATAATAGTAGAGGACCTCATCCCAGAAGGGGAACTGCCAGAGTGGGGGCCCGTGGTAGATCACCTGTACAGGATCTTGGTGACAAAATGAAGATGTCTCCAGGGAGAAGCAGAGGACCAGCAGAAACTCATCATATGAATCCAACAATGAGCCTCTCAGAAAGAGCAAGCAGAGAAGCTTTTTACTCTGCTTTTTTTCAAAATGCTGATAATGCTGCTTTGAGTTATCATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTC
  5   1   2       ext Egg                            TEgg121k14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATAATGCTGCTTTGAGTTATCATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGC
  5   1   2       ext Liv1      in                         CAAR4088.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGAGGATTCAAACTCTAGAGCAAGCTCCTATGGAGAGCCTCACCCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCTCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCA
  5   1   4      seed Spl1      in                         CABK1500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGAGGCAACGTTTACATCTCCTCTTCATTATAAGAGACCAGTGTACCAGCAGGAGGAATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCA
  5   1   3        nb Gas7      in                         XZG15562.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTAAAGAATGGCTGGGAAGCTCTATACTTTCTGCATCACAGCATCGTCAAGAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAA
  5   1   3        nb Egg       in                   TEgg061b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAA
  5   1   2       ext Gas7      in                         XZG49043.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATNGTACTCCAAAACAAGAAGTCATACCTC
  5   1   2       ext Egg                            TEgg133e04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCT
  3  -1   3        nb Egg       ?                     TEgg006j02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCGGCCGCGTCGGGTTGTTGGCACAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCACACCTTAAATATGC
  5   1   2       add Egg       out                  TEgg030i07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCAGTCTATTGTGAAACTAGGACACTTTTCAATGTCTGGGCTTCCAGCACGATCGTACTAACCATTATATGGACTGGCAAACACGTACAACTACCGTCCTTGGAACCAAAATGAGTTTTACCCCAGGTGCACCACCATGAAAATGTACAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTG
  5   1   2       ext Gas                            TGas044d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGCTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAA
  3  -1   2       ext Spl2      in                       CBSS10742.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGCGATCTAGAACTAGCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGCTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCC
  5   1   2       add In66                            IMAGE:8964976.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTTTCCCATGAACAGGCCGACCCAAAATAAAAAATTCGTCCCGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGCTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGAACCCGTTCAGAGATTGTACCTCCTCCAGACTTACTGTACCTTTCCACAGGAGACCACTGACCCTTCTGACTAACTCCCATGGACTCTAGTGGGCCATCACAGCTGAGCAGCCCTGAGCAGGGGTTCGATCCCCACTACCTCTCGACAGCATGATTTGATGCCAGGGTGTGTCTATGGCATTGTGTCTACTTGTTCTGTGACGATTATGACTCGGGAGGCCTGTTTGACAC
  5   1   2       ext Ova1      in                         CABE1612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGTTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGC
  5   1   2       add Gas7      in                         XZG40309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGCTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCA
  5   1   3        nb Egg  NOT                       TEgg089i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCATCTAGCTTTATGGTACAAGGGCCAGTTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTG
  5   1   3        nb Egg                            TEgg093j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAGACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATCTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCCAGCACAGACAGTAAAGCACTTCCTTCGTCTAGCTTTATGGTACAAGGGCCAGTTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAGCCAAGAATATGCATCTACGCTTTCTAAGAAT
  3   1   3        nb Egg       in                    TEgg061b12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGTACAAGGGCCAGTTGTCACAGAGTCTGCTACCATGGGCCACCTTGTCTGTTGCCTTTGTGGTAAGTGGGCTAATTACAGGAATTTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACA
  3   1   4      seed Spl1      in                         CABK1500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGCCTTTGTGGTAAGTGGGCTAATTACAGAAATTTGGGAGATTTGTNTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3       out                        CAAM4143.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTGGGGCTAATTACAGGAATTGGGAGATTTGTTTGGCCCATTCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3  5g3  out                        CAAM6276.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTACAACCAAGAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3  5g3  out                        CAAM4186.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATATGCATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   2       ext Liv1      in                         CAAR4088.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCTACGCTTTCTAAGAATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  5   1   3        nb Gas7      in                          XZG4852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAA
  3   1   0       chi Gas7      in                         XZG40309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGGTGAGTGCTTCCTTTATGACAAGTTTACAACATAGTCTTGAATTGCTCATTTTTTTTGCTTAATTGGGAATACCAGCAGACAAGTTGACCATGTAGGTTTATAGCAACACGCTGTTTTCTGCTATATTATGATGATTTTTCTAGGGGGGCAATTCTCTTTGAAATGCTTTATTGGTATCTTGTGGTATTTTTAGATTATTTTCTAATCCTTTTTGTTTTTTACATTTTTTTTACTTGTTTGATCTGCTCAGGGGTTTTTAGACTTTATAGGGGAACTATTGGCAAAGTGAACATTTAATATAAGCTTCATTGCACTGAAATAAACAAAACTTTTAAAATAT
  3   1   0       chi Brn2      out                       CAAJ12657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   cacgtggaattccagtggagttgattcgtgtttgtggctgtggtgtggcaaagtgtggaagagttcaatacttttgcaagccactgTATATATAATATATATTTGGGGCAAGCTACATGTGAGCATGGGTGACCACCTGGCAATTGACTGACTGTTTGGTGTACCCCTAGATACCTGAGTTTTGATTTATGTATCTTGGCTACATCGCATACCTCCTATAGTATTTTTATTATTTCTTTGTTAGTGTTGCTGTATAGACCTTTGTAGAGATTTATCTCTTGTAACATCACCTTTTCCCCCGAACCTCAGAGCTATATCTTTATAATGTTTTTCCATTACATAGCTATTTGTAAATAGCTGTATTTACCAGTATAGTAATACCTTTGTCTAGCGTTAACCTTGCTTCTGTATATCTCCCCCATAGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCATAATTGTGACATCAGGAAGTGACCTCACAGTC
  5  -1   2       ext Spl2      in                       CBSS10742.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGGACATCAGGAAGTGACC
  3   1   3        nb Te3       out                        CAAM4776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCCCGGTC
  3   1   2       add Egg       in                    TEgg074h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTATAACCCCAAATATGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                         CABE1612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAGCACGAGAACAACGTAGTCTACNTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  3   1   3        nb Gas7      in                         XZG15562.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGCCCGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAAAAAAAAAAGG
  5  -1   3        nb Gas                            TGas012k09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGAC
  3   1   2       ext Te3       in                         CAAM9321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGG
  3   1   3        nb Te3  5g3  out                        CAAM7388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  3   1   2       ext Gas7      in                         XZG49043.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAAAAAAAAAGG
  3   1   0       chi Te3  CHI  out                        CAAM6143.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCAGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  5   1   3        nb Gas                            TGas047p04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCGATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTGAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTNTTCAANAANATAAATATATAAATATATATAAATATATTTTTANTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCC
  3  -1   2       add Gas5                                  XZF2157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATGGCCGTGTTCTGTGTGCAACAGATCAGAAAGACCTGAGGGAGCCGAGGCATCGCAGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAAAAAAAAAAA
  5  -1   2       add Egg                            TEgg107k07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCACCAGCCTCCCGAAGACCATATAATCGGCCACAGACAAAGTAGACCCCATTGGCCCATAAGACACACCCCTCGTGCATCCAAAATTCATTGCTGTCGAGAGGTAGTTGGGGGATCTGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGCCCTCCCAGTCAAAAAAAAAAAAAAAAAAGCGGCCGCGGCCAGATTGGCCTGTCGACGAATG
  5  -1   2       add Egg                            TEgg116j14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCCCCCCATTGGCCCATAAGACACACCCCTCGTGCATCCAAAATTCATTGCTGTCGAGAGGTAGTTGGGGGATTTGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGCCCTCCCAGTCAAAAAAAAAAAAAAAAAAGCGGCCGCGGCCAGATGCGCCTGTCGACGAAT
  3   1   3        nb Te3  5g3  out                       CAAM16399.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGAATGTTTACTAAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  5   1   2       ext Neu       in                   TNeu085o16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGGGTGGTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTGGAGCTGAAATTTCATTTTAATAACCCCAAATATGTGAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCATCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTC
  3   1   3        nb Gas7      in                          XZG4852.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTGGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAAT
  5   1   3        nb Egg                            TEgg098e24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCAGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCC
  5   1   3        nb Egg                            TEgg116i17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCAGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTTGTTTATTCCCCCCCCCCC
  5   1   3        nb Egg                            TEgg098e23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCAGGGGGGAAGTATTCATGAAGATAAATATATAAATATATATAAATATATTTATACTCTGGAAAGACTTTGAAATGAAAGGCGCAAAATCTTTTTATGGATGAGCTAAAATTTCATTTTACTAACCCCTGATATGTAAATACAAGACTGAAACTGACTTTTGAAACTGGATTTAG
  3   1   2       ext Neu       in                    TNeu085o16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTTTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCNCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGTTCATTTTAACCTTAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Egg                            TEgg092l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAGATTCAAGAAGATAAATATATAAATATATATAAATATATTGTTTAGTCCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAAAATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGGATATATATATATATTTTTTTTACAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAG
  5   1   3        nb Tad5      in                         XZT10792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCCC
  5   1   2       ext TbA       in                   TTbA055f19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTTTGATAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTACAGAAGTTAGGGCATGCTGTGTATAGTCATACGCATCAGTCTTACATAGTGATGAGATAGTCTGGTCAGACGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCC
  5   1   2       add Tad5      in                          XZT4662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCCCCCC
  5   1   3        nb Gas7                                 XZG38065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCCC
  3   1   3        nb Egg0                                 dad78a05.x3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAAGGCTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGTCCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTGGGTAAGACAACAATAGCAGTGACCGAATATGCCCAGGAGAANCCTAGAGAAAAAAGGACAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAGATGAAAGCTTATTGTAAAAGAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAGAAAAAAC
  3   1   2       add Tad5      in                          XZT4662.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCCCCGGGAAAACCCCCCCTCCCGGGGCCCGAATATCCCCGGGGAAACCCTAAAAAATTTTGGCCCGGCTTTTTAAATTCAAAGCCCCCCTTTTTCCATAGGGAAAAAAAAGTTGGGTCAAAAGCCCAAAAACAATTTTTTTTTTTCCCGCCACCCCCCCCCCTTTTTTTTTTTTTCCCCCCCCCCCCCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGCCAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCCCATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCCCAAGGGAAAATGAAACTGTTTTTTTCTTGAAAAAGGAAAACTCCAAAAAAATAAAAAAGTTAAAAAAACAAACAACCAATAAAGTTCATTTTAAC
  5   1   3        nb Gas                            TGas100i23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTCTAG
  3   1   3        nb Tad5      in                         XZT10792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTT
  5  -1   1       add Gas                            TGas010l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTTTTTCTACTTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATAATGGGTCCAAGAGAACTTTTCTTTTTTTTAAAGCAAAATAAACCCTTTATGGAAAAAAAAA
  3   1   2       ext TbA       in                    TTbA055f19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTTTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAACAAACAAACAATAAAGTTCATTTTAACCTTAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   3        nb Gas7      in                         XZG51362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGCTTATGGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGTAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACT
  5   1   3        nb Gas7      in                         XZG51362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTATGGACAGTATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGTAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAAAAAAAAAAAGG
  5   1   3        nb Egg                            TEgg030c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAGTATATATATATATATTCTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCACCGCCTTTCCTGTGCGTTTTACTTCAGCCACGAAACCTTTAATTTTTGG
  5   1   2  SIG                                      Xt7.1-XZG22336.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCCTTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACC
                                                  Xt7.1-CHK-1008280482                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCCTTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAAT
  5   1   4      seed Tbd0      in                     NISC_nl11a04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATGCAGCGTAAAAGCCCAAGGCAGGAGCAGTTTCATGTCCGTAGTCCAGGAAGGGTTGAGAATGAGGTAATGGTTTACAACCAGCCAGGTGCATATCATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCCTTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCC
  5   1   2       ext Brn2      in                        CAAJ16537.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGTGGAAAAGGTTCCATGCAAGAAGCAGAATTGCCTGGGGTTGTTGGACCAGATATCTCCTGTAGTGAAGAGACAACTGCAAAAAGCCTGCCTCCCAAGTCACTTGATGTATGGGCACATGATGAAAAGAAAATCAAAACTGAAATGGAGGAGCAGTCTATGGAAACTAAAGACTTTTCAATGTCTGGGCTTCCAGCACAAGCGTCTAACCATTATATGGATGGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAAGCAG
  5   1   2       ext Gas7      in                         XZG22336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAAAGGTACATCTACGGCCTTGGAACCAAAATGTGTTTTACCCCAGGTGCAGCAGCATGAAAATGTAGAAAAGGAGAAACTTGCAGGAACACCTTGTAATGTTACTCCAAAACAAGAAGTCATACCTCAGAAGGGATATTTCCCCTCTGGAAAGAAGAAAGGACGTCCTGTTGGTAGTGTCAACAAACAAAAGAAACAGCAGCAACAGCCATTGATGCAAGAGCAAGGGCATCAGCAGCCACCACCACCTGTTTCACCAGCCTCAGTCTCTGCTCTCCCACCACAGCATTTGGATGAGCATTTGGATATCTCTGAGGCAGAGCCTAAACCTAAAAGGAGGAGGACAGAAAGAAGAAAGCCTACTGGAGCACCAAGAAGAAGAAGGGGAAAACAAGCTGCTCCTATAGTTGCCCCTATAGAGCCAGAAATCAAACTTAAATATGCCAGCCAAAATTTAGACAAGCCTGAGACCAAAACCAAGTCTTTTATTCCTTATATACATGTGGAAAATAAAGAGGAGCTGGGATTGTCTTGTGTCATCATCAATGCTGAAGAGGAGGAACAACATTGGAAGAAATTAACATCAGTTCGCAAAGGTCAGCGATCTGCTTCTCCACAACCC
  3   1   2       ext Brn2      in                        CAAJ16537.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   2       ext Gas7      in                         XZG22336.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGCCCTGAGCAAGGGTTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  3   1   4      seed Tbd0      in                     NISC_nl11a04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAAAAAAAAAAAAG
  5   1   2                                          Xt7.1-CAAJ13239.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTTTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGTTCATTTTAACCTTAAAAAAAAAA
                                                  Xt7.1-CHK-1008280486                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTTTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGTTCATTTTAACCTTAAAAAAAAAAAAAAAA
  5   1   4      seed Brn2      in                        CAAJ13239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGATTCTAGCAGTCTAGAATATGGACGCCAGCTGCGTGTTGGTGAGGGAGGACCCACCAATTTGACAGCATTGGAGCTTAAAAGAAATGCTCAAAAAACACCTCCAGTGGACTCTACTAACTGGAATTTGGGCCGTCAGACTTCTCCTGTCAAAAAACTTGGGTCCCCTGTAGGGACAAACCAAAAACCCTTTAGTTCTGGTAGGGAAACAGATACTCTTGTCCATAGATCAGGAGAAGGAACTGAGATCTCCAAGCCCGGGTGCAATGCCCATAGACCTCAAGGCACAGAAGAACAATCACACCATAACCCTCTAATCATGAGAAGAAGAGTACGTTCTTTTATCTCTCCAATTCCCAGCAAAAGGCAGCCTGGTGATGACAAAGGGCGCCTGCCTGTTTCTAATGTAAAGGAAACTTCAGACAGGACATCTGTGTCACAGGTATTAACTTCTAGGAGCAAAGAAAGTGGCTTTTCCCCTGTGGCAGATGAACCCCACAAAGGTGGCCCAGAACAGACAAGCCCATCAGCTGTATCCCTTTCTAGTCCAGCCAAGACAAAAATCCTTCCTCCCCGCAAAGGGAGGGGTCTAAAACTGGAGGCAATTGTACAGAAAATCACTTCACCTAATGTTCGTCGTATTTCAGCCCCAAGTAGCTCAGAAAGCGCAGCTGAAGCTGTAACACTAGATGATATTCTCTCTCTAAAAATCAAGGGCCCAGAGAGT
  3   1   4      seed Brn2      in                        CAAJ13239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  5   1   2       ext Egg  5g3  in                   TEgg065p07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCT
  3   1   2       ext Egg  5g3  in                    TEgg065p07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTTTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGTTCATTTTAACCTTAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAM7035.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAA
                                                  Xt7.1-CHK-1008280490                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  5   1   4      seed Brn2      in                        CAAJ16003.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGAGCTTTCTGAAAAAACACAAGCGGAAGAAGTGGAAACTGTTCCAGAAGCCACAGAGACTTTTCAGGAAGTGTCCAAGGTCAGTGAGAAATCTGTGGGTGTCATAGTAGCAATGGAGACTGTAGCCACCAGGTCAGAGAAAGTCACAGAAGAATCTTCAACACTAGATAATGATGAAGTTGAAACGTCATCACAGCCAGAGGTGCCTGAAACAGTTAAAGATGATGATAATGTCAAGGAATGCCCCCCTGACCAGAATGGAGAACCTAGTGATGCCGATTCTCAGCCTGTTCCTATTACAAGTAGTACTTCTAGAACAGAGGCTAAATCTCCTGTGGGCTCTGGGTTTAGTTTTAAAGAAGGAGCAACAAGCTCTAGAAATGCCAGCAACTTGCCTCAGCATCTTAAAACTCCTGATTCAGCAGGGTGTGGAGGACAGGGTGATAAGAAATCAGGAACAGGAAGAAATGATAAGTATCCTAGCCTCCTTCAGGAAGTCCTGCAAGGACATCATCAGCAGGAACGAAGGTATGCTAGAAACACCCAAGACCCTCCACCAGTTACTGGAAGTTCTGAAGCAAGTTTGAGACCAAATATACTCATGAGCCAGGCAAGTGAGTTACCTAACCGTAACATCCTTGGCAAGACACTTGCTCCACATTTAGAAACGCCTAACTGGGGCCCATGGGATAGAAAGTCAGCTCCTGATGTTAAACCATTGAATGTAACAGATTATTCTGCAAGAAAATTTGAGGTGGACCCTCCAGCCTCCTCTCAGGAATCTAGTGGCATCCCTTCAGAAAGACGGTCTGTAATATGTGATATCTCTCCACTGAAGCAGCTTGTTCGAGATCCTACTGCTTCTCATCATG
  5   1   2       ext Te3       in                         CAAM7035.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGNCAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACAT
  3   1   2       ext Te3       in                         CAAM7035.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCCCCACCAAAAAAATCATCAGAGACTCCTCGAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   4      seed Brn2      in                        CAAJ16003.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATCATCAGAGACTCCTCGAAAAGTTAAAGTTCGTCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   0       chi Brn2      in                        CAAJ22743.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AaagggctgtgattggttatttgtagcccagtgtggactggcagactacaggaggctctttttggcagtacacgttatgtgcctccaagccagaaattaaaaatggtcatctgctgggagtagcatccaaggggggttggtgagcaacatgttgcttgctagccactggttggggatcactggtttagGGTAACTGTACTTTGTTGCTTTAGAGCTAAGGGTTTCTGTCCTACTTTCAGCTTGTAGATTGGTTAACACACACTAGACTTCCAGGTACCTCCCAGTATCCGAGTTATCCAATAAAACAGATCATGGAGGATAAAAAGGCTCTTTCCCCACAGGCTTATACCAACTAGGCAAATCCTTCTCCAGGTGGTGCTTATGTTTCCCTATACTGGGTGCCTGTTTTTCCTGTTGGACAGCTATTAGTAAGGTCTGGCTTCTTCTCCTTGTCTAACTTTGCTTTTTCTGTTCACCTGTGGCATTTGCTTCTCTTTCTCTTTTACCTCCTCTCTTTCCTCCTTTCAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3       out                       CAAM15298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCACAAAGACACCTCTGATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Brn3 5g3  out                       CAAK11802.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3  5g3  out                        CAAM3809.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3  5g3  out                        CAAM4958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGGTTCTAAGTCTGACTCTGATGAGGAAGAGGAAGAAGAACCACAGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Brn2 5g3  out                       CAAJ16698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3  5g3  out                        CAAM3867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAGCACGAGAACAACGTAGTCTAACTGCTCATCCTCGCTACAAACGTCGGAACCGTTCAGGAGATTGTACCTCCTCCAGACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTC
  3   1   3        nb Te3  5g3  out                        CAAM2536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGG
  5   1   0       chi Brn2      in                        CAAJ22743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTACTGTACCTTCCCACAGGAAGACCACTGACCCTTCTGAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGGTAAGGCATGCTGAGTTCTCTATATTATAATCAAATGTATTGCTAGTGGGGCACAGTTCTGGTTGCACTGAAACCACTTCCATGCATGAAATGGGTCACCCAGCCAGCCCCTTTTATTAATGTATTCAGTACATTTGGTTACTTACTGCTTCACTACATGCACACATTTTTGATTATCGGATGCAGGCGCCTGGTAAACTTTCATCTCTTCATTTATCATTGTTAGAATGCTTGTCTCTATCTTCTGCATAACCATTTCACCCACCCAGTAACACCTCTTTAAATCCTTTTGGCAGCTAGTACCGCAACTTGATGGACAAAATGTTGGGCAATCAGCATCATTTGTTCTCCTACANCACACTACCAGTTTACTATAGTAGGGATGCACTGACTCCCCACTCTNNGTCACATTTGGCCAAACCCAAGCCTGTGTGTGCTGGGCTTGGATTAGTCAAATCCTTTGTCA
  3   1   2       ext Brn2 5g3  out                       CAAJ12059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACTAACTCCCATGGACTCTAGTGGGCCATCCACAGCTGAGGCAGGCCCTGAGCAAGGGGTTCAGATCCCCCAACTACCTCTCGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCAGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  3   1   3        nb Tad5      out                        XZT40620.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTCTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATG
  3   1   3        nb Tad5 PIPE out                        XZT67373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAGCAATGAATTTTGGATGCACGAGGGGTGTGTCTTATGGGCCAATGGTGTCTACTTTGTCTGTGGCCGATTATATGGTCTTCGGGAGGCTGTTGACATTGCACGAGAGATGAAATGTAGTCACTGCCAGGAGACTGGAGCCACATTGGGCTGCTACAACAAGGGTTGTGCCTGCTGCTATCACTTCCCATGTGCCATGGACTCAGAATGTTTACTAAATGAGGAGAACTTCTCTGTACGCTGCCCCAAGCACAAGACCAAGACAGTAAAGGGTGTTTCATCAGAGCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGT
  5   1   2       ext Gas7      in                         XZG64228.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGCCTGAGCAGGGCTGAGGGGGGAAATATGTCCTAGAGTTGGAAATAATATTCAAGCACAGGTAAAGCTTTTTAGATAAAGTGGAATCATCACACAGGAGTGAAGCGAAGCTCTCTTCTCCCTTCATTGGGTGGACATCGCCTTCTCTTGGGATTCTTCCTACTTGGCTGCAAGCATTTCCTCCATGACTCATGACATCACCTCAGAATTGTGACATCAGGAAGTGACCTCACAGTCAAAAAAGAAAAAAAAAATTGACATCCTGAAATGGAGGGTGGGGGTTGTTTAACAAAAGGCGGGGGGGAAGTATTCAAGAAGATAAATATATAAATATATATAAATATATTTTTAGTCTGGAAAGACTTTGAAAGGAAAGGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTCTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTT
  3   1   2       ext Gas7      in                         XZG64228.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAGGAAAGGCAAAATCTTTTTATGGTTGAGCTGAAATTTCATTTTAATAACCCCAAATATGTAAAAAAAGAAAAAAAAAGACTTTTGAAACTGGTTTTAGAAAAACATAAATTTGTTCGCTCTTTGACCTTTTTTCCCTATACTGTGCTGCTGTGTTCTCTGTCTGTATGCGCTGCACTCGGTAATACAGCCATCGCAGTGACCGAATATGCCCAGGAGAAACCTAGAGAAGTTAGGGCAGGCTGTGTAGAGTCAGAGGCATCAGTCTTACATAGTGATGAAATAGTCTGGTCAGAAGCTCATAAGCAGATCTGTTTAGTACAGTCAACACACATGCATTTTTGTTTATTCCCCCCCCCCCCTTCGTTTATCAGCTGTACCTTTTTTTTTTTTTTTTCTACGTTGGAAAATGCTCATCAGTTTTCTTTAAAAAATGAAAGCTTATTGTAAAAAATATGGTCAAGAGAACATTTTCTTTGTTTTTAAAGCAAAATAAACCTCTTATGGACAGTATATATATATATATATTTTTTTTATAAATCTTGTATGTTGGCCCACATGATCAAATAAGGAGGGAGGGGACGGGGCAGCGCCTTTCCTGTGCGTTTCACTTCAACCATGAAACCTTTAATTTTTGGAGTTAGGTGTTTCACAAGGGAAAATGAAACTGTTTTTTTCTAGAAAAAGGAAAACTACAAAAAAATAAAAAAGTTAAAAAAACAAACAAACAATAAAGTTCATTTTAACCTTAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)