Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK12894.5                           9 END     5           9       62                contactin A [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012153676 Xt7.1-CABD7128.5.5 - 55 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABD7128.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAATATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAAGCAAAGTCACCATCCATAGGTGATTTCAAGAAATAAAAAATGTGATATATAATAGAGATACAAATGTTGTATATGGTAAGTGTAAGAAAAACGCCATCTGTCTATACTGTTTTGTGTGCTACATACTTTTAAGTGGCCCATGTCTATTGTTTGCAAGGTTCAGGCTTCTAGACAAATAGTCAGAACAAAAACAGTCATTATATGACAAAAAACTAATGTTTTCTCTATAATAAATGAATGTACTTTCTTTATATATGATAGGGTGGGGGGAGGGCAGAGGGTGACTGTTTGACCAGGTTTCCATATGGATCCATTGAGTGCATGAGATGAATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACA
                                                  Xt7.1-CHK-1008265374                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAAGCAAAGTCACCATCCATAGGTGATTTCAAGAAATAAAAAATGTGATATATAATAGAGATACAAATGTTGTATATGGTAAGTGTAAGAAAAACGCCATCTGTCTATACTGTTTTGTGTGCTACATACTTTTAAGTGGCCCATGTCTATTGTTTGCAAGGTTCAGGCTTCTAGACAAATAGTCAGAACAAAAACAGTCATTATATGACAAAAAACTAATGTTTTCTCTATAATAAATGAATGTACTTTCTTTATATATGATAGGGTGGGGGGAGGGCAGAGGGTGACTGTTTGACCAGGTTTCCATATGGATCCATTGAGTGCATGAGATGAATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     2     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     4     3     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     7     7     7     7     7     7     7     7     7     8     7     9     9    10     9    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    12    11    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    12    12    12    11    11    11    11    11    11    12    12    12    12    12    12    12    12    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    14    14    14    14    13    14    13    14    15    16    15    16    15    18    16    19    18    21    19    20    21    23    20    22    20    21    21    22    19    20    19    22    22    24    27    28    27    28    27    28    30    31    29    30    29    30    29    30    29    30    30    30    30    30    30    30    30    30    30    30    29    30    30    30    33    33    32    32    32    32    32    33    33    33    33    33    33    33    32    33    32    32    32    32    32    32    32    32    31    31    31    31    30    31    31    31    31    31    31    31    30    31    31    31    30    30    30    30    30    30    29    30    29    30    29    30    29    30    26    30    22    27    22    27    21    26    21    26    21    26    20    26    20    26    20    26    19    25    19    25    19    25    19    25    16    23    17    21    15    20    13    19     9    16
  5   1   2      ests                                 Xt7.1-CAAN8523.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAATATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAAGCAAAGTCACCATCCATAGGT
  5   1   2      ests                                 Xt7.1-CABD7128.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTCTTTATATATGATAGGGTGGGGGGAGGGCAGAGGGTGACTGTTTGACCAGGTTTCCATATGGATCCATTGAGTGCATGAGATGAATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTGTATTTGACAACAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                                                       ...PROTEIN --- Xt ---- 2e-024     AAI35443.1 Unknown (protein for MGC:121400) [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-030     NP_501339.2 neuRonal IGCAM family member (rig-4) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-038     XP_785256.2 PREDICTED: similar to axonin-1 [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-044     NP_649461.2 CG1084-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 8e-106     NP_851300.1 contactin 1 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 7e-141     NP_031753.1 contactin 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-142     NP_778203.1 contactin 1 isoform 2 precursor; glycoprotein gP135 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 7e-148     NP_001004381.2 contactin 1 [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          BAA28780.1 contactin A [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001081205.1 contactin A [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABD7128.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TGAATGTAG---------------------------------------------------ATG---------------------------------------------------------------------------------------TGA---------------------------------TGA---------------------------------------------------TGA------------------TGA---------------------------------TAA------------TAG---------TGA------------------TAG------------------------------TAATAG---------------------TAA---TAA------------------------------------------------------ATG------------------------------------------------------------TGA------------------------------------------------------------------------------------TGA------------ATG---------------TGA---------------------------TAG------TGA---------------------------TAG---------------------------------------------TAG------------ATG------------------------------TGA---------------------------------------------TAG---------------ATG------TAA---------------TAA---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TAG---TAA------------------------------------ATG------------------------------ATG---------------------------------------------------TAA---------ATG---------------------------------------------TGA------ATG------------------------------------------------------------------------ATGTGA------------------------------------------------------ATG------------------------------------------------------------TAATGAATG---------------------------------------------ATG------------------------TAA---------TGA---------------------------------------------------ATG------------------------------------------TAA---TAG------------------TAA---------------------------------------------------------------------------------------------------------TAG---------TGA------------ATG------------------------ATG---TGA---------------------------------------------ATG---------------------TGA---------------------------------------------------ATGTAG------------------ATG------------TAA------------ATG------------------------------ATG---------------------------------------------------------------ATG------------TGA---------------------------------------------------------------------------ATG------------------------------------------ATG---------------------TAG---------------------------------------------------------------TAG------------------------------------------ATGTAATAA------------------ATGTAA------------------------ATG---------------------TAA---------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2      ests                                 Xt7.1-CAAN8523.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGAAATATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAAGCAAAGTCACCATCCATAGGT
                                                  Xt7.1-CHK-1008238688                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAAGCAAAGTCACCATCCATAGGTGATTTC
  5   1   2       bld Spl2      in                        CBSS5613.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAATCCAAACATTGAAGGAAATATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACAACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTA
  5   1   2       bld Brn3                                CAAK12982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCAACATTGAAGGAAATATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCA
  5   1   2      seed Brn4      in                        CAAL11153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAAACATTGAAGGAAATATGGAAATGGCAAGAGCTATAGATTTGATTCCTTGGATGGACTATGAATTTCGGGTTACAGCAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGA
  5   1   2       bld Te4       in                         CAAN8523.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACAAACACATTAGGAGTTGGAGAACCTAGTTTGCCATCACCAAAAATAAGAACAGAGGGAGCTGCACCTATTGTAGCTCCTGCTGAAGTTGGGGGTGGTGGTGGAAGCAATCGTGAGTTAACAGTAACTTGGCAGCCTTTATCACGTGAATATCATTATGGGGATGGCTTTGGCTATGTTGTCGCCTTCAAGCTTTTCAATTACAGGGAATGGAGAAAAGTTATTGTTACAAACCCTGAAAGTGGTCACTATGTGCACAAAGATGACACCATAACGCCAGCAACACAGTTTCAAGTAAAAGTAAAGGCCTTTAATAAAGTTGGTGAAGGTCCATACAGCAGCACTGTTGTTATATACTCAGCCGAGGATGTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGNGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGT
  3   1   2       bld Spl2      in                        CBSS5613.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTACCTATAGAAGCCCCAACAGCAATAGTATACAATATACTGTCATCTTCTGAAGTATCTGTTGCCTGGCACCCAGTTTATGAGAAATCTATTGAAGGTTACCAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACAACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCC
  5   1   2       bld Brn3                                 CAAK9243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGTTCGCTACTGGCGAACTCAAGACAAAGAAGCAGCAGCACATCGAGTACAGGTGAAAGCTTCAGATATTACTACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTTATGAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGT
  5   1   2       bld Brn3      in                         CAAK9290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAAGCTTCAGATATTACAACCAGGCTTGAAGGATTGTTGCCAGATACCCATTACAACTTAGAAGTTCGGGCCTTTAATAGCGCAGGGGATGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCCTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAANGCAAGTCACCATCCATAGGTGATTTTCAAGAAATAAAAATGTGATATATAATAGAGATACCAATGTTGTATA
  5   1   2       bld Brn4      in                        CAAL10070.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGAGGGCCGCCAAGCAGAGTGATAACTTTCTTGACAAAGAAAGCTCCTCCAAGTCAAAAACCACGGATTACTAGTGCTGTGAGATATGGTTCACAGTATATTATCACCTGGGAACATGTAGTACCTCTATCCAATGAGTCTGCTGTGAATGGTTACAAGGTTCTTTACAGACAGGATGGGCAGCGAGATGGAAAGCTCTATTCAACTGGTAAACATTCAGTAGAATTACCTGTCCCAGAAGAAGGAGAGTATGTTGTTGAGGTTCGAGCTCACAGTGAAGGAGGTGATGGAGCAGTTGCTTACATTAAAATTTCTGGTGATGCGACAGGAATTCTCCCCTCTTTCCTCGGAATCCTTCTGCCAATCCTAAGCCTGCTGATGTATTGGGAATTTTGAATGTAGCTACGTTTACAATGTCCTGAGTGCAGTGTACTCTCTTCACAGCTGAAGGCAATGATTTTTTTTTCTCTTCTTTTTTGTTGGAGATTACTCCGGTACCATCTTAAGCCAAAAAGAAAAAGATATTACCCTACTGTTTTATTATGAACTGAAAAAAAAGGCATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAAGCAAAGTCACCATCCATAGGTGATTTCAAGAAATAAAAAATGTGATATATAATAGAGATACTAATGTTGTATATGGTAAGTGTA
  5   1   2      ests                                 Xt7.1-CABD7128.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTCTTTATATATGATAGGGTGGGGGGAGGGCAGAGGGTGACTGTTTGACCAGGTTTCCATATGGATCCATTGAGTGCATGAGATGAATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTGTATTTGACAACAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225987                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTATATATGATAGGGTGGGGGGAGGGCAGAGGGTGACTGTTTGACCAGGTTTCCATATGGATCCATTGAGTGCATGAGATGAATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTxTxTxx
  3   1   2       bld Brn4      in                        CAAL11153.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCAGGAACTCCACACATGAAGGGATTATTTTCAAGGAAGAAAAGTTTTTAACTTGTTCCACTATGCCTTATGAAACACGTACGCCAATATTTGACAGTTGCATGATCAAACGGGCAAGTTACAGTGTTAAATTGCAATACCTTAGACTGTACAGTGAAAGCAAAGTCACCATCCATAGGTGATTTCAAGAAATAAAAAATGTGATATATAATAGAGATACAAATGTTGTATATGGTAAGTGTAAGAAAAACGCCATCTGTCTATACTGTTTTGTGTGCTACATACTTTTAAGTGGCCCATGTCTATTGTTTGCAAGGTTCAGGCTTCTAGACAAATAGTCAGAACAAAAACAGTCATTATATGACAAAAAACTAATGTTTTCTCTATAATAAATGAATGTACTTTCTTTATATATGATAGGGTGGGGGGAGGGCAGAGGGTGACTGTTTGACCAGGTTTCCATATGGATCCATTGAGTGCATGAGATGAATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTC
  5   1   2       bld Sto1      in                        CABG11619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTCTTTATATATGATAGGGTGGGGGGAGGGCAGAGGGTGACTGTTTGACCAGGTTTCCATATGGATCCATTGAGTGCATGAGATGAATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCTAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCCTATAGATTGCTTTTTGTTCC
  5   1   2       bld Brn1      in                          CABL616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTAGATTTCCTTGGCATTACTAGGACTTATGACATAAGCATTTTTTCTTTTACAGTATATAGGACAACACTCACTGTAAAACAAATAAATGGGCCTCAGAGACATGTTAGAAACATTCCAAAATGTGCAAATTGAGCTCTGGAGTGAATCAACATTGAGTTGAATACAATTTGGTTTTACTAATAATATCTCTGCTGTGGGGTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTG
  5   1   2       bld Brn4      in                        CAAL22387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTAGCTTTATTCTACAGTAATGCAATGGTAATCCTACCATGGGAAATAATGTATACCTTTTGTCTGGTGGCTTATAGGCGAGAAGGAGAACATTGTCGTCTTCAAAAAAATAAAATGTTCTTATAGCACAGTTGTCTACCCTCAGCATAAAAGCAGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGTTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATAGTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATC
  3  -1   2       bld Kid1      in                         CABA6495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACTCCTATAGGGCGAGAGGCGAGAATTTAGGCATTTGCAATCCTTCAAGGGTATAATGTTTATAATAGGACAGGCTGGTAAGACCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGNATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTA
  5   1   2       bld Brn4      in                        CAAL10814.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAGCTCTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCANATTTTANAGTTCTGTGTGAGTGGTATTGNGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCA
  5   1   2       bld Tad5      in                         XZT64357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGATATTGCCCAGGTTAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCANATTTTAAAGTTCTGTGTGAGTGGTATTGNGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACANACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAATCTNCATTTACTGTGTACTTGTCATAC
  5   1   2       bld Lun1      in                         CABD8341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGTATTTGTATTTTCAGCACCAAGAATTTTTATTAATCTTTGCTGTAAAATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGA
  5   1   2       bld HdA       in                  THdA001a05.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATGGAAAGGCTTTGGTGCACCAGTAAGCGAGTTATTACTATTTGTTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGNGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATAGTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAANATAGAAGAACCCACTGAATGATATAGAAATGTTNCATACCTTGGAGGAAAAGCATATGCACTGA
  5   1   2       bld AbdN      in                       IMAGE:6998162                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTTGGTGCCCAGTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACNAACTTGTTATATGATTNAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTNATAGAAGAAAAGAAAATCTNCATTTACG
  3   1   2       bld Brn4      in                        CAAL10070.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAGCGAGTTATTACTATTTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAAC
  3   1   2       bld Te4       in                         CAAN8523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAGCGAGTTATTACTATTGCTTGTTGCTGCATTGTCTTGTCCTTTGTGTAACGGTTTCTAACCAAGCATCCTGGCATTTAATTAGGTTATTTTTATTTGACTGCTTTGTGTAGCAATAAGCCAGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTG
  3   1   2       bld Brn3 5g3  out                         CAAK536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTTTGTGTAGCAATAAGCCAGGTTGTTCTGTATGTGACTATATCAGCTCAGAAATGCAATGGATCCTACTTTTTAGTTACATCAAAATGATCTTTCCTATTAGATTGCTTTTTGTTCCAAGAAATTCGGGAGGAGGTTTATAATTCTGTATTATGAAAACTGGTATTTTTGATCTCTACTTTGTTGCTGTTTACACTACGTGATCACAAATGGTTGATACAGTGTGGCATGGTGTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATATTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAAC
  5   1   2       bld Spl2      in                        CBSS5281.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGTAACTTTTACTGTGACTTTGTTCAGAGTTTATTGTGTATAGTTGAAGATGTGAAGACTGTTGTCTGTGTGGTACAGTAATAAAAGTTGGTGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAANAAGAAAAGTTGTTTAATGCAG
  5   1   2       bld Bone      in                       CBTC10834.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCAGTATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGA
  5   1   2       bld Brn4      in                        CAAL20082.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATTTTCAGAGATGGTAAATAACAAAGGCATCATCAACAAAAGGCATCTGGGAAAAGGCGTGTTAACAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTTCTAACTACTTACACATG
  3  -1   2       bld Kid1      in                         CABA3700.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCCCCTTAATGAATGTATTTGCTCTGGCTTTGTCTGTATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTT
  5   1   2       bld Tad5      in                         XZT15025.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCTTTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTTATGGTTTATATGTTATACTTTTTTTTA
  3  -1   2       bld Lun1      in                         CABD7128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTATGTTTAGCCATAAAAATGATTTCCAAGGTGCGCTTCAAATTTTAAAGTTCTGTGTGAGTGGTATTGGGAAAAAAACACTTTTTTCAAGATGGTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTTTATTCTTAGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTT
  5  -1   2       bld Kid1      in                         CABA3700.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTCAGATGGTTTCCAGTAATGGTGCAATGTTTTCTTTTCTTTNTATTCTANGCACAAACTTGTTATATGATTAAATATAGCTATTTACTTNTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAA
  5  -1   2      seed Lun1      in                         CABD7128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAAACTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAG
  3   1   2       bld HdA       in                    THdA001a05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTGTTATATGATTAAATATAGCTATTTACTTTTTATATATAAATTACCCTACCAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGGAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTTTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAACAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld AbdN      in                       IMAGE:6998162                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAAGCTATTACTTTTATAATAATACCCTACAGATTTATATAGAGAANAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATGTACCAAAATGTTACGTTTGCTAAAACAATTAAGAAGTGATAGCTGACTCACACCACACCGCCNN
  3   1   2       bld Brn3      in                         CAAK9290.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTACTTTTTATATATAAATACCCTACAGATTTTTTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  5  -1   2       bld Int1      out                        CAAP9854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATATAAATTACCCTACAGATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGT
  3   1   2       bld Sto1      in                        CABG11619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGATTTTATTATAGAGNNAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATTCTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  3   1   2       bld Brn3      out                        CAAK3052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTTTATTAATAGAAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  5   1   2       bld Tad0      in                     NISC_no22h03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTG
  3   1   2       bld Lun1      in                         CABD8341.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAAAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTCTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  3   1   2       bld Brn1      in                          CABL616.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGAAAATCTCAATTTACTGTGTACTTGTCATACTGTATAGAGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTGACAAAC
  5   1   2       bld BrSp      in                     EC2BBA14BF10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGACTGCATTCTGAAAACAAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGGAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAA
  5   1   2       bld BrSp      in                     EC2BBA18AF11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTCTGAAAACAAAAAGTGTACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTACAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCATATTCACAATGCTCCTCGAAGTACTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATC
  3   1   2       bld BrSp      in                     EC2BBA18AF11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAGAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGATCAATGTGCTTGGATATGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCATATTCTCAATGCTCCTCAAAGTAGTATTCAATGCACTTACCATGTGTCGCTATCTGGCGCTTTACCTG
  3   1   2       bld BrSp      in                     EC2BBA14BF10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATACTAAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGGAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAA
  3   1   2       bld Te3       out                       CAAM15993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTAAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  3   1   2       bld Bone      in                       CBTC10834.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAATAGAAGAACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGCTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAACAAT
  3   1   2       bld Brn4      in                        CAAL20082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACCACTGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCCAAATAAAGGGTATTTGACAACC
  3   1   2       bld Brn4      in                        CAAL10814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACC
  3   1   2       bld Tad5      in                         XZT64357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACNCAAATAAAGGGTATTTGCCAACC
  3   1   2       bld Spl2      in                        CBSS5281.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAATGATATAGAAATGTTCAATACCTTGGAGGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  3   1   2       bld Brn4      in                        CAAL22387.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  3   1   2       bld Fat1      out                       CABC11007.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACCCCCAACATGTTTTTTTTATTTTCAAATGCAGGATGTCCTTTTACCTTTTTAACATACACATTGAACAATGTGCTTGGTTTTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACGGGCGCTTTACCTGTGCTCAAAACTGCCTTCCCCCAATCCCGGGACAAGTGCCAATGCCCATTTGGGATTGAAAATGGAAACTTGTTTTTCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTTTTAACTACTTACCCATGTTTAATTTGCTTATATTTAGAGGGGTTTGGGTTTCTTTAATAATGGGATTGTCCAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTCCAGGGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTTTTACTCCCAAGGTAACTGTTGGCCTATCCATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCCCCAAATAAAGGGTTTTTGCCAACC
  3   1   2       bld Tad5      in                         XZT15025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAAAGCATATGCACTGATACACAGTTGTGTTTGTGTGTAAATGCATAATCCTTACACACAACATGTTTTTTTTATTTTCAAATGCATGATGTCCTTTTACCTTTCTAACATACACATTGAACAATGTGCTTGGATCTGAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGAC
  3   1   2       bld Tad0      in                     NISC_no22h03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGCCAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Limb      in                         CBSU617.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGGAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  3   1   2       bld Limb      in                         CBSU617.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGATGTAGAAAAAGAAAAGTTGTTTAATGCAGATTTGGTTTTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGGAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTTTGTTAAAAAAAAATAAAGTAAAAGAAAACTTCCACCAAATAAAGGTATTTGACAAAC
  5  -1   2       bld Kid1      in                         CABA6495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAAAGCAAATTCACAATGCTCCTCGAAGTAGTATTCAATGCACTTACCATGTGTCGCTACTGGCGCTTTACCTGTGCTCAAAACTGCCATCACCCAATCACAGGACAAGTGACAATGACCATTTGGGATTGAAAATGGAAACTTGTTTATCAGAATAGAGCAATACCCAATCTGGTTCCATTTAACCCATTTCTTAACTACTTACACATGTTTAATTTGCTTATATTTAGATGTGTTTGGGTTTCTTTAATAATGCGATTGTACAAGATAATTTGTTAGTTGAATTTTGCACTTTTTTTTTACTTTATTGGTTTATATGTTATACTTTTTTTTACAGTGGAATAGGTAGAAGTGAGATATTTTTTTTATGAAGGAACCCAAGTTAAAATGTAATAAATATCAGTATTACTCACAATGTAACTGTTGGCCTATACATTTACCAAAATGTTATGTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)