Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ17442.5                          10 END     6          10       60                ankyrin 1 isoform 4 [Homo sapiens]
     2   2.0    0Xt7.1-CABK961.5                             4 END     4           7      100                ankyrin 1 isoform 1 [Homo sapiens]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     3 120.0    0(repeat)                                    0 REP     84       1271     1529                (no blast hit)

 This cluster: approximate FL confidence score = 90%

 1012153681 Xt7.1-CAAQ5039.3.5 - 55 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ5039.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGCCCAGCCTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGTCCTTCACAAGCATGAAAAAGGTTCCTGGGGGTGCCAATAAGAGCTATAATTGGCTATTTAATAGCCCCTATGTGGACTGGCAGCCTACAGGAGACTCTGTTTGGCATTATACTGGGTTTGTATTCAACCAAAACTTGCCCCCGAGCCAGGAATTCAAAAATGAGCACTTGTTTTGTGGCGACTGGGAGCAACATCCAAGGGGTTGGGGGGCAACATGTTGCTCACGAACCGCTGGTTGGGGATCACTGGTCTACACCCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008264922                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCCTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGxxxxxCAxxxxxxxGAxxxxxxTxxxxxGGxxTGCxxATxxxxxCxxxxxxTxxCxxTxxxxTxxCCCxxAxxxxGAxxxxxxxxCxxCxGxxxxxTxTGxxxxxCxTxATxCxxxxTTxxxxxxxAxxxxAAxxxTxxxxxxxAxxCAGxAxxxxAxAAxxxAxxxCxxxxxxxGxxxxGxxxxxGAxxxxCxxxxxAxxxxTxGGGxxxxxxxxxxxxxxxxAxxxxxCxCxGxTxxGGGATCACTGGTCTACACCxTACxxGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAxxxxxxTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     3     5     3     5     5     7     5     7     5     7     5     7     5     7     5     7     5     7     6     8     6     8     6     8     6     8     6     8     6     8     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6     9     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     6    10     7     9     8     9     8     9     8     9     7     9     7     9     7     9     6     8     6     8     5     7     5     7     5     6     5     7     5     7     5     7     5     7     5     6     5     6     5     6     5     6     4     6     4     6     4     6     4     6     3     5     3     5     3     5     3     5     3     5     3     5     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     7     5     9     5     9     6     9     6     9     7    10     7    10     7    10     7    10     8    11     8    11     8    12     8    12     8    12     8    12     8    12    10    15    10    15    10    15    11    17    11    16    11    16    13    20    17    25    17    26    17    26    17    26    17    26    17    26    17    26    17    27    18    28    18    28    18    28    18    28    20    30    20    31    21    32    21    31    21    31    21    32    20    31    21    32    29    31    29    31    29    31    30    32    30    31    31    32    31    32    33    34    30    32    32    33    32    32    33    33    33    33    33    33    32    33    33    33    34    34    33    34    34    34    32    32    30    30    30    30    30    30    30    30    29    29    29    29    29    29    29    29    29    29    29    29    29    29    30    30    30    30    30    30    29    30    30    30    25    26    25    26    24    24    24    24    23    23    13    13     5     5
  5   1   2  SIG                                      Xt7.1-CABK5084.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTATCTGAACTGTGATATTTTAATCTTAATTTAACACTGTCCATCACCATTCCTGAAATTATCAGGCAGAATCCTAATTCTAACATTATTTTTTACACACCTTTATAAATATGCCCCTACAGATTCAGCTGAATTCAAATCCTGCAAAAAAAGGGCAGGCATTCTGAACTAAAGCTTGAATTCAGAGCGTCCATAACCAATGATTTGCCCAAACCACTAAGAAACAAACATTAGATTAATAAAAAAAAAATATTTTAGCTAAAATCACAAAATGATTTAATTCTATCAGAAAGGAATGTGGGGGGAATGATTGCAAGTTTCTTAAATTTTGAGTGAGTGTGTGTGACAGCCCTTCCCCACCCTCCCCCCAACAGGTCACCCCTTGACGCAGGATGAACTACTATCCCCAGCATCTCTCAACTACTCCCTTCCCTCCCCATTACGACTGGAGCAATACTGGAATGAAGCGTCAATTTTGGATGGCGTCCCAATGGCAACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATA
  5   1   2  SIG                                       Xt7.1-CBXT564.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATATCAGTTTATAGGGGGGATCCCCAGTGAATATCCAATTTATACAGAAGGACTTTTCTCTGGCCTGTATCTCAGTTTACAGGCTAGTTCACATGTATATAAATTCCTTTCATGCAACAGTGTGAAATCCTTTCTTTATTTAAAGTTATATTTTTCAGGCAAGGTCTCAAATGCTTATTATACTCAACTCACATATTTTAACTTATTTATAGCATCAATTTAATATAGTAATTTTGCCACATAGAGTGCTTTACAGCCAACTAAAAATCATCGAATATCAAGAAACATTGATTCAAAAGAAGTTTTGTACAAGTAGTAACTAATTTATAACTGTTTTTCATGTATGTACTGTAAATGTATAACTGTGTGAATATATTTTTGCATGTGGATATAAATATATATATATACACCCGCCTAGAGCTGATCAGTTTATGCAGCTGTTTCGGCTGTGTTATTCTTGGCTCTAGTGCAGAACTTAAATGGGCCAATTTTTTTTTTTTTTACAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGTCCTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAQ5039.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCCCCTGTGCCCAGCCTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAAGTTCTACGCAGAGTGGGTCCACCAGGGAACACAGATTTAGGGGATAATGAGGACCTTTTGATTAGAGGGGACACTGCAGGGACCCGAAAGACCTGGAAAGTGAAACCCCCAAATTACCTGAAGTATTGCTGTACTTGCACCCGAAAGGCCAAAGGAACCAAAATGACACCTGGGAAGATCCGAAGGTTCGCCAAAACGGGAAAAAAAGGGGCCACAAAATTGTGGAAACACAAACCCGGGCACCCAAAAGGGGTGTCAACAAGGTGGAAACCCACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGGGATCACTGGTCTACACCATACTAAAAGTTAACTACAAAGTGAACAGCCCATTTAAATCCATGATTCTACCACATTTCACTTCTTACTTGTCTTTTACCCTATTGTCTCCCTTTGCTCATTTTCCCTCACCTTATTATACTCATTGTCTAACCCCCTTTTCTCTTGCTTTTTCTAAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAA
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                               BLH ATG     438     132                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     438      38                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     438     223                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -38       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     438       9                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PREDICTED - Gg ---- 7e-010     XP_420641.2 PREDICTED: similar to ankyrin B (440 kDa) [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-013     NP_112435.1 ankyrin 1, erythroid; normoblastic anemia [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 9e-036     NP_001005969.1 zgc:101835 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 3e-039     NP_065211.2 ankyrin 1 isoform 5 [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 3e-082     AAI29673.1 Unknown (protein for MGC:160354) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = ?? ==== 3e-082     NP_001091166.1 hypothetical protein LOC100036926 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Xt ==== 2e-087     AAH96387.1 Hypothetical protein mgc107745 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAQ5039.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAG------TGA---------------------TGA------TGA---------------------------------------------TAG------------ATG---TAA---------------------------------------ATG------------------TAG---------ATG---------------TAG---------------------------------TGA------------------------------------------------------TAA------------------------------------------------------------------------TAG---TGA------------------------TGA------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG---------------------------ATG------------ATG------------TAG------TGA---------------------TGA---------------TGA---TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTGAATG------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG---------------------------ATG------------ATG------------TAG------TGA---------------------TGA------TAA---------TAG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TGATGA------------------------------------------------------------------------------------------------------------------------TAGATG------------------------TGA------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2  SIG                                      Xt7.1-CABK5084.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTATCTGAACTGTGATATTTTAATCTTAATTTAACACTGTCCATCACCATTCCTGAAATTATCAGGCAGAATCCTAATTCTAACATTATTTTTTACACACCTTTATAAATATGCCCCTACAGATTCAGCTGAATTCAAATCCTGCAAAAAAAGGGCAGGCATTCTGAACTAAAGCTTGAATTCAGAGCGTCCATAACCAATGATTTGCCCAAACCACTAAGAAACAAACATTAGATTAATAAAAAAAAAATATTTTAGCTAAAATCACAAAATGATTTAATTCTATCAGAAAGGAATGTGGGGGGAATGATTGCAAGTTTCTTAAATTTTGAGTGAGTGTGTGTGACAGCCCTTCCCCACCCTCCCCCCAACAGGTCACCCCTTGACGCAGGATGAACTACTATCCCCAGCATCTCTCAACTACTCCCTTCCCTCCCCATTACGACTGGAGCAATACTGGAATGAAGCGTCAATTTTGGATGGCGTCCCAATGGCAACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGTCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATA
                                                  Xt7.1-CHK-1008287418                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGAACTGTGATATTTTAATCTTAATTTAACACTGTCCATCACCATTCCTGAAATTATCAGGCAGAATCCTAATTCTAACATTATTTTTTACACACCTTTATAAATATGCCCCTACAGATTCAGCTGAATTCAAATCCTGCAAAAAAAGGGCAGGCATTCTGAACTAAAGCTTGAATTCAGAGCGTCCATAACCAATGATTTGCCCAAACCACTAAGAAACAAACATTAGATTAATAAAAAAAAAATATTTTAGCTAAAATCACAAAATGATTTAATTCTATCAGAAAGGAATGTGGGGGGAATGATTGCAAGTTTCTTAAATTTTGAGTGAGTGTGTGTGACAGCCCTTCCCCACCCTCCCCCCAACAGGTCACCCCTTGACGCAGGATGAACTACTATCCCCAGCATCTCTCAACTACTCCCTTCCCTCCCCATTACGACTGGAGCAATACTGGAATGAAGCGTCAATTTTGGATGGCGTCCCAATGGCAACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCT
  5   1   2       ext Tad5      out                        XZT45309.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTATCTGAACTGTGATATTTTAATCTTAATTTAACACTGTCCATCACCATTCCTGAAATTATCAGGCAGAATCCTAATTCTAACATTATTTTTTACACACCTTTATAAATATGCCCCTACAGATTCAGCTGAATTCAAATCCTGCAAAAAAAGGGCAGGCATTCTGAACTAAAGCTTGAATTCAGAGCGTCCATAACCAATGATTTGCCCAAACCACTAAGAAACAAACATTAGATTAATAAAAAAAAAATATTTTAGCTAAAATCACAAAATGATTTAATTCTATCAGAAAGGAATGTGGGGGGAATGATTGCAAGTTTCTTAAATTTTGAGTGAGTGTGTGTGACAGCCCTTCCCCACCCTCCCCCCAACAGGTCACCCCTTGACGCAGGATGAACTACTATCCCCAGCATCTCTCAACTACTCCCTTCCCTCCCCATTACGACTGGAGCAATACTGGAATGAAGCGTCAATTTTGGATGGCGTCCCAATGGCAACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGANACACCCACTACATGCTGGGTATC
  5   1   4      seed Spl1      in                         CABK5084.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTNCACCCATTTGTCCTTCCT
  3   1   2       ext Te5       out                         CAAO488.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATAAGGAGGACCTTTTGGATAGAGGGGACACTGCAGGATCCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGTCCTTCT
  3   1   4      seed Spl1      in                         CABK5084.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCTC
  5   1   2  SIG                                       Xt7.1-CBXT564.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATATCAGTTTATAGGGGGGATCCCCAGTGAATATCCAATTTATACAGAAGGACTTTTCTCTGGCCTGTATCTCAGTTTACAGGCTAGTTCACATGTATATAAATTCCTTTCATGCAACAGTGTGAAATCCTTTCTTTATTTAAAGTTATATTTTTCAGGCAAGGTCTCAAATGCTTATTATACTCAACTCACATATTTTAACTTATTTATAGCATCAATTTAATATAGTAATTTTGCCACATAGAGTGCTTTACAGCCAACTAAAAATCATCGAATATCAAGAAACATTGATTCAAAAGAAGTTTTGTACAAGTAGTAACTAATTTATAACTGTTTTTCATGTATGTACTGTAAATGTATAACTGTGTGAATATATTTTTGCATGTGGATATAAATATATATATATACACCCGCCTAGAGCTGATCAGTTTATGCAGCTGTTTCGGCTGTGTTATTCTTGGCTCTAGTGCAGAACTTAAATGGGCCAATTTTTTTTTTTTTTACAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGTCCTTC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008287420                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATATCAGTTTATAGGGGGGATCCCCAGTGAATATCCAATTTATACAGAAGGACTTTTCTCTGGCCTGTATCTCAGTTTACAGGCTAGTTCACATGTATATAAATTCCTTTCATGCAACAGTGTGAAATCCTTTCTTTATTTAAAGTTATATTTTTCAGGCAAGGTCTCAAATGCTTATTATACTCAACTCACATATTTTAACTTATTTATAGCATCAATTTAATATAGTAATTTTGCCACATAGAGTGCTTTACAGCCAACTAAAAATCATCGAATATCAAGAAACATTGATTCAAAAGAAGTTTTGTACAAGTAGTAACTAATTTATAACTGTTTTTCATGTATGTACTGTAAATGTATAACTGTGTGAATATATTTTTGCATGTGGATATAAATATATATATATACACCCGCCTAGAGCTGATCAGTTTATGCAGCTGTTTCGGCTGTGTTATTCTTGGCTCTAGTGCAGAACTTAAATGGGCCAATTTTTTTTTTTTTTACAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAA
  5   1   2   10  ext Ski1 5g3  in                         CABJ7075.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCCCATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATCTCAGTTTATAGGGGGATCCCCAGTGTATATCGAATTTATACAATAGGGCTTTTCTCTGCTCTGTATATCAGTTTATAGGGGGGATCCCCAGTGAATATCCAATTTATACAGAAGGACTTTTCTCTGGCCTGTATCTCAGTTTACAGGCTAGTTCACATGTATATAAATTCCTTTCATGCAACAGTGTGAAATCCTTTCTTTATTTAAAGTTATATTTTTCAGGCAAGGTCTCAAATGCTTATTATACTCAACTCACATATTTTAACTTATTTATAGCATCAATTTAATATAGTAATTTTGCCACATAGAGTGCTTTACAGCCAACTAAAAATCATCGAATATCAAGAAACATTGATTCAAAAGAAGTTTTGTACAAGTAGTAACTAATTTATAACTGTTTTTCATGTATGTACTGTAAATGTATAACTGTGTGAATATATTTTTGCATGTGGATATAAATATATATATATACACCCGCCTAGAGCTGATCAGTTTATGCAGCTGTTTCGGCTGTGTTATTCTTGGCTCTAGTGCAGAACTTAAATGGGCCAATTTTTTTTTTTTA
  5   1   4   10 seed Tbd1 5g3  in                          CBXT564.b1 .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCAATTTATACAGAAGGACTTTTCTCTGGCCTGTATCTCAGTTTACAGGCTAGTTCACATGTATATAAATTCCTTTCATGCAACAGTGTGAAATCCTTTCTTTATTTAAAGTTATATTTTTCAGGCAAGGTCTCAAATGCTTATTATACTCAACTCACATATTTTAACTTATTTATAGCATCAATTTAATATAGTAATTTTGCCACATAGAGTGCTTTACAGCCAACTAAAAATCATCGAATATCAAGAAACATTGATTCAAAAGAAGTTTTGTACAAGTAGTAACTAATTTATAACTGTTTTTCATGTATGTACTGTAAATGTATAACTGTGTGAATATATTTTTGCATGTGGATATAAATATATATATATACACCCGCCTAGAGCTGATCAGTTTATGCAGCTGTTTCGGCTGTGTTATTCTTGGCTCTAGTGCAGAACTTAAATGGGCCAATTTTTTTTTTTTTTACAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTC
  3   1   2       ext Ski1 5g3  in                         CABJ7075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCATCAATTTAATATAGTAATTTTGCCACATAGAGTGCTTTACAGCCACTAAAAAATCATCGAATATCAAGAAACATTGATTCAAAAGAAGTTTTGTACAAGTAGTAACTAATTTATAACTGTTTTTCATGTATGTACTGTAAATGTATAACTGTGTGAATATATTTTTGCATGTGGATATAAATATATATATATACACCCGCCTAGAGCTGATCAGTTTATGCAGCTGTTTCGGCTGTGTTATTCTTGGCTCTAGTGCAGAACTTAAATGGGCCAATTTTTTTTTTTTTACAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGNGGAATAAACCCTTTCCATTGTCCTTCTC
  3   1   4      seed Tbd1 5g3  in                          CBXT564.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CAAQ5039.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCCCCTGTGCCCAGCCTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAAGTTCTACGCAGAGTGGGTCCACCAGGGAACACAGATTTAGGGGATAATGAGGACCTTTTGATTAGAGGGGACACTGCAGGGACCCGAAAGACCTGGAAAGTGAAACCCCCAAATTACCTGAAGTATTGCTGTACTTGCACCCGAAAGGCCAAAGGAACCAAAATGACACCTGGGAAGATCCGAAGGTTCGCCAAAACGGGAAAAAAAGGGGCCACAAAATTGTGGAAACACAAACCCGGGCACCCAAAAGGGGTGTCAACAAGGTGGAAACCCACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGGGATCACTGGTCTACACCATACTAAAAGTTAACTACAAAGTGAACAGCCCATTTAAATCCATGATTCTACCACATTTCACTTCTTACTTGTCTTTTACCCTATTGTCTCCCTTTGCTCATTTTCCCTCACCTTATTATACTCATTGTCTAACCCCCTTTTCTCTTGCTTTTTCTAAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAA
                                                  Xt7.1-CHK-1008287414                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGTGCCCAGCCTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGGAACACAGATTTAGGGGATAATGAGGACCTTTTGATTAGAGGGGACACTGCAGGGACCCGAAAGACCTGGAAAGTGAAACCCCCAAATTACCTGAAGTATTGCTGTACTTGCACCCGAAAGGCCAAAGGAACCAAAATGACACCTGGGAAGATCCGAAGGTTCGCCAAAACGGGAAAAAAAGGGGCCACAAAATTGTGGAAACACAAACCCGGGCACCCAAAAGGGGTGTCAACAAGGTGGAAxxCxACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACxGxTxxGGGATCACTGGTCTACACCATACTAAAAGTTAACTACAAAGTGAACAGCCCATTTAAATCCATGATTCTACCACATTTCACTTCTTACTTGTCTTTTACCCTATTGTCTCCCTTTGCTCATTTTCCCTCACCTTATTATACTCATTGTCTAACCCCCTTTTCTCTTGCTTTTTCTAAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAA
  5   1   1           Abd0 FL                     IMAGE:7002607.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Hrt1 5g3  in                         CAAQ5982.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATAGAGAGAGAAAAATATCCCTCCTGGTACAACCCCCTGTGCCCAGCCTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAA
  5   1   3   22   nb Tad5 5g                              XZT69317.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGACGCGTGGGCGGACGCGTGGGAACCCCCTGTGCCCAGCCTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTA
  5   1   2       add AbdN 5g                            IMAGE:7004212                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTACAGACTAGCAAAAGTGAAACTGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAAACGAAGTCCCCGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGGAAAGTTCTACGCAGAGTGGGGTCCACCAGGGAACACCAGATTTTAGGGGGATAATGGAGGACCCTTTTGAATANAGGGGGACACTTCCAGGAAACCA
  5   1   2       add Tad0 5g3  in                       IMAGE:6982279                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGCAGGAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTNCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGGACATTGTGACAAAGAAGATAGTCCGGAAAGTTCTACGCAGAGTGGGTCCACCAGGGAACACAGATTTAGGGGATAATGAGGACCTTTTGATTAGAGGGGACACTGCAGGGACCCGAAAGACCTGGAAAGTGAAACCCCCAAATTACCTGAAGTATTGCTGTACTTGCACCCGAAAGGCCAAAGGAACCAAAATGACACCTGGGAAGATCCGAAGGTTCGCCAAAACGGGAAAAAAAGGGGCCACAAAATTGTGGAAACACAAACCCGGGCACCCAAAAGGGGTGTCAACAAGGTGGAAACCCAC
  5   1   3        nb Abd0 FL                            IMAGE:7002607                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGCTTTAACTTTGTCTGAAGGGGGTGAAGCTACCGGTGGATTTACAGTAGGAAAACTCCCATTTGGAGTTGGTAGGAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTCACAGATGAGCAGGGGAACTTGTGACAAAGAGATAGTCCGGAAGGTCTACCCAAATGGGTCCCCAGAACCAATATTAGGGATATT
  5   1   2   10  ext Hrt1 5g3  in                        CAAQ10543.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAGCTGAAGTTATGGATTAAGCCTTGTACCTGTTATACCTGACAAAACATCGACAAATAATGTTTATTCTTGGGGAGGGGTAGCCCAAATGGATGCAAAGGGCTCAGCATTAGAATAAGGGACATTTCACGGTATGCTATGCCAGTTGATGTTTTAGTTTAACAGACTGTGAAAGAACCCAAATACCGGTATTAGAAGAATACTAAAATGGCTTTCATTCAGCTGTAGGTATTATACAAAGGACTGCAGTGAAGGTTTGTCACTGGTATATAACAAAATAGAATTGACTGAACAAGTGTTATCCCCTCAGTTGAGAGCAGGACAGGATGTGGGGGTTCCTAACAGAGCTGGGGGTGTGCATAGTACTGATAGGATTCTTTGTGGTAAGCTGTCAGAATGTAGTCCATATTGTTCGGGGAGCTGGTAAATTTGTTCTTCGCCGACTCCACACTGAGCTCGACAAAGAACTTGGGGAAGGAGGTGGAGAAGATGATGAGGAAACACTGACCACCAAGGTTGTGAGGAGGAGGGTCATCGTCAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGGCAGAGGACGAAAATGACACTGTGAGATCAGAGGTCGCAGACGGGAGAAAGGGGCACAGATTGTGAAACGAGCCGGCACCAAACGGGTGCAACAGTGAAACCCAAAACTGGGACACC
  5   1   0       add Eye       in                         CCAX4878.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGCAACAGCTGAGCCTGATGGGCTTTTGGACCTACCTGACCTTCCGCTCTGGGCCTCAGGCCTGTCTCCTTCCCTTGTGGCCCCAGAGGACTCATCCCTAGATTGCAGCAAGGCTGAGGACGAATGGGATCCTCCACCACGCCCTTCCTCAGGTTCCCCTGACTTGGAGGAGGAGGAGGCAGAAGCTGGAGGTCCAGAGAGGGTGCAGGCCAGAATTACTGAAACACCCACTACATGCTGGGTATCGGGGAGCAGTGTTGAGAGGGTTCTGGACTGGACTGCAGATGCTCCCGTGTCATCTCCTTCGCTTTCCCCTCACCATGATAATGGTGCCCCTGTGACGTATGAAGAACTTCATCCAACCTTCAAGGGTAGTTCAAGAATCAGAGTTACACAGCAGAGTACAATATACACCGGAAGAGGAAAGGGGAACGAAGTCCCAGATATTCCTGGGGAACAGGTGACAGAGGAAGAGTTCACAGATGAGCAAGGGAACATTGTGACAAAGAAGATAGTCCGGAAGGTTCTACGCAGAGTGGGTCCACCAGGAACCACAGATTTAGGGGATAATGAGGACCTTTTGATAGAGGGGACACTGCAGGAACCAGAAGACCTGGAAAGTGAAACCCCAAATTACCTGAAGTATGCTGTACTGCACCGAGAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATG
  5   1   2       ext Tbd1      in                        CBXT22822.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAAAAAGTGTTGGGGAGCAACACAAGCATGAAAAAGGTTCCTGGGGGTGCCAATAAGAGCTATAATTGGCTATTTAATAGCCCCTATGTGGACTGGCAGCCTACAGGAGACTCTGTTTGGCATTATACTGGGTTTGTATTCAACCAAAACTTGCCCCCGAGCCAGGAATTCAAAAATGAGCACTTGTTTTGTGGCGACTGGGAGCAACATCCAAGGGGTTGGGGGGCAACATGTTGCTCACGAACCGCTGGTTGGGGATCACTGGTCTACACCATACTAAAAGTTAACTACAAAGTGAACAGCCCATTTAAATCCATGATTCTACCACATTTCACTTCTTACTTGTCTTTTACCCTATTGTCTCCCTTTGCTCATTTTCCCTCACCTTATTATACTCATTGTCTAACCCCCTTTTCTCTTGCTTTTTCTAAGAATTACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATA
  5   1   2       ext Tbd1      in                         CBXT7966.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACACTTCAAGTACAAGCTACTGATGCTGACCCAACTGCCGTCTACTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATA
  3   1   0       chi Tad0 5g3  in                       IMAGE:6982279                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACATATGATGTACACATGTTTTTGTAAATTCGTTGAAAACAACCCGCTTGCGGAAGAGTGCTAATTATGTACTTTTTATATATACACTGGAATGGTCACCCACACACAATAGTATGACTATAATTATCGAAATTTGAATGTTACCTCTCATGTAGATATGGATTAGATCTCATATTTTCTCAAGCCCTACATACCTATATTAGTGGTATATTTTTCCTTTAGTAGACTGTTTCATAAGTGCAGCAAAACCATCCCAGTATATAGAACGACAAAGGGTTACCCCTCACAGTGAGCCACATATGCGAATAGGAGAAATAATTTTATGCCCCCGAGAGAGGTAGCCTCCAACAGAGTGTTACATCACGAGGTAAACAAAAAAGAGATAGATAGAAAGAGGATAAAAAAGTNAATCTTTAGAGGATCATAAAAGGGAATTTTTAGTCAGTGAGATTATTAATTACCATCTAAGGGAAGGCCAGTAAATTATAGAGGACATTAAAGGATTATAGAACTCTACGGGGAAACGAGTGAAAAAGGTGGTGTTATAAACATTATTACCAAGTGGTGTTAACCAACAGAGCCAATTTATTTTGTAGGCAAGGAGAAAAATAAACTTCTTCAGATTTTCACAGGAGGGCTGAAACAAAAAGGCGCTATAGGTAGTGATAATTACAGTTAACCATTGTAATCCATATTGGCAGGCATGTTATTTTGTTTTAAGAATGAGCTAGGCAATTTTATAGAAGGCACTTGAGCACCCAATTATACAGTGCACGCTGAATTATTTATAAAGCTAGTGGTAGGGCATACAATTATTATGCATTATTATACAGTGCAGGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGCGAGCATGCTCATTTTTTAGAGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATGTATGATATGCATAAGAAAATGATTTGCAGTAATGCTTAACGGGTAAATAGAGCACCACAGGNNNNNNNNAAAANNAAA
  3  -1   2       ext Hrt1      in                         CAAQ6797.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCACCTCACAGAATATGAATCGGTACAAAATTTAAGCTGTTTTCGCTCATCTATAAACAGACGACACTCCCAAAGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTAT
  5   1   3        nb Tad5      in                         XZT14972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAACCCGAGGGACCCCTCCCAAGTGCGAATCTGATGCTCGCCCCGTATGCTCACGGCATGAAGACTTGCACCCTGCCTGTTACAATGTAATATGCATGTGATGACATTTGGGAAGTGGAGAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATC
  5   1   3        nb Tad5      in                         XZT46704.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAGCTGCCCCCTTCCCCTGACCATCATTCAACCCATTTGTCCTTCCTTTCCACCTCATATTTTTTTAACCCAAGCCAAGAGGGTAATTTATGAAAAAGTTTTAGAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCATTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACANGTAAGAGTGTTCTTTATG
  5   1   3        nb Te3       in                         CAAM1451.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAAGGGAATAAACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTA
  5   1   3        nb Brn4      in                        CAAL23207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCCTTTCCATTGTCCTTCTCATCTCGTCTCAAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCATTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAA
  5   1   3        nb Tad5      in                          XZT9897.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACCTTTCATTGTCCTTCTCATCTCGTCTCAGAGCTTTCCATCTTTGGTACTATATGTGAATGAGTACTGAGTATATCTATACATTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGG
  5   1   3        nb Tad5      in                         XZT11092.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATATGTGAATGAGTACTGAGTATATCTATACACTCTTCAGGCCCTCCTGAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCATTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGNGGTAGG
  3   1   3        nb Spl1      out                         CABK961.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGCTATTACATTGGCTGCCTATCGACAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTG
  5   1   3        nb Brn2      in                        CAAJ14570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAACAGCAATAGCAGTTACCCTATGCCTTTGTAGGAGCTTTCCCAGAGGCCACAGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTTCAATGCTCTTTTTAGATGCAATTTCTGATATG
  3   1   3        nb Hrt1      out                        CAAQ5039.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCTCAAAAAA
  5  -1   2       ext Hrt1      in                         CAAQ6797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGCACAGCACAATGTCGGTAGGGTAGACTCGGCAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAA
  3   1   4      seed Hrt1 5g3  in                         CAAQ5982.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAGCACAATGTCGGTAGGGTAGACTCGGCAAGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCTCAAA
  3   1   3        nb Brn2      in                        CAAJ14570.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCTC
  3   1   3        nb Brn4      in                        CAAL23207.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGTTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCATTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCTC
  3   1   3        nb Te3       in                         CAAM1451.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCTGCTTATCGTAGGGCATTTCTGCTTAGTTTTCTCTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  3   1   2       ext Hrt1 5g3  in                        CAAQ10543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGAAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  3   1   3        nb Brn2      out                       CAAJ14884.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  3   1   3        nb Te3  5g3  out                        CAAM9923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  3   1   3        nb Te4       out                        CAAN7547.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  3   1   3        nb Brn2 5g3  out                       CAAJ17442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTGCAGGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCTC
  3   1   3        nb Brn2 5g3  out                       CAAJ18361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  3   1   3        nb Fat1      out                        CABC1242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAACCTCAAAAAAA
  3   1   3        nb Tad5      in                         XZT46704.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCGAAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCATTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAAT
  3   1   3        nb Te3  PIPE out                        CAAM4262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGGGCTACATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCATTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  3   1   3        nb Brn2 5g3  out                       CAAJ15806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGTCAGGTATACACAGCATCATTTTGCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATCCAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATCCAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATACCCTC
  3   1   2       ext Tbd1      in                        CBXT22822.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGGGATATACTCTCATTTACAGAGGGCGACAAAGTGTATGTAGATACTCAGTACCATTATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAAA
  3   1   2       add Eye       in                         CCAX4878.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTACCATTATACAATGCAGCATTTTTCTTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTTTTAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTTTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATA
  3   1   2       ext Tbd1      in                         CBXT7966.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATACAATGCAGCATGTTCTTTTTTCAGATGGCTAGGCATTTATAGAGGCACTGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                          XZT9897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTCCTTGAGCACCGTTATGCAGAACAGCATGATTATTATAAAGCTACTGGTAGGGCATACAATTCTTCTGCATTGTGAGACAGTGCAGCGAATTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATCCGGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGATCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCCGGATGTGTATAGAGATAATCTGTAT
  3   1   3        nb Tad5      in                         XZT11092.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGCACCATTATACAGTGCAGCATGATTATTATAAAGCTACTGGTAGTGCATACAATTATTCTGCATTATTATACAGTGCAGTGATTTCATTAAGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCAGGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTN
  3   1   3        nb Tad5      in                         XZT14972.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTTTACAGTGCGGCATGGTTTTTATAAAGCTACGGGTGGGGCATACAATTTTTCTGCATTTTTATCCAGTGCAGGGATTTCTTTAAGGGGGGGGGGGATCAAAGTGTACAGAGATATTTAGTATTGATACAGAGAGCAGCATGTTTTTTTTTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGGGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGGGGCATGGTCATTTTCAGGGGCGGGATGGGTATAGAGATAATCTGTATAATTATCCAGTAAAGAGTGTTCTTTTTGGGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATTTTAAGGGGATTAGCCTACCCCCTCCCCCCTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGGGAGAAAGCATTCACCCACACAACCTTTCCAATGCTTTTTTTGGAGGCAATTTTTGATATGCATAAGAAAAGGATTGTCCAATAATTGCTCATAGGGGAATAAATA
  5   1   0       chi Tbd1                                CBXT12179.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCGTTTTTATCCACAATCCCCCGCTCAGGTATGGCGCTCTGATCTTTGGGCTCCCGTCCAAGGCATTAGAGAATTTTCCCCCTGCTTAAGATTAGCGCCACCGCGAATTCTAACGTGTTTTGTAATTAATCAATTGAGCGTTTGGTCAAGTGAAGAAGAAAGGAGGGTGGTTTTTTTTTTCTTCTCTTTCTTTTGGACTCGTCTTAACTTCTCTACCTCTCGTTGCTAATTAGGGAGGCTCAGTAAAGTCAATTAGTGAATGTTTTCCGGTGACCAGAGCAGGGCAAGGCCACCGATGTAACAGTAACAAGTGCAAAATAAACCGTCTCTGACCTGCCTACATCTCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Limb      out                       CBSU8297.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATTGATACAGAGAGCAGCATGTTTATTATTGGGCTGGGAGTGTATAGAGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAAATGCACTCACCTTGGTTGTGTGCCCATTGCCAATGCTGGGGAATTTGGTGGTTATTATTGCCCTTGTCATGGGTCCCATTATGATGCATCTGGTAGGATTCGCAAGGGTCCTGCTCCATTGAATCTTGAAGTTCCAGAGTATGAGTTTCCTTCTGATGATTTAGTAATTGTCGGATAGACACTTGACTCCTAAAACAAGTAATCACTTTCTGGAACTGTTAAGCATAAGTGTCATTACCTTAACTTTNCAGCAAGGTGCATTCAGTTTAATATGCTTTTAACATCACTTATG
  3   1   3        nb Mus1      in                          CABH983.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATGCCTCTCGCCCTAT
  5   1   3        nb Mus1      in                          CABH983.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGATACTCAAAATCATTATGCAGGTGAGCATGCTCATTTTTTAGTGTACAGAGATGCTCAGCATCGTCATACACTGTGGCATGGTCATTATCAGGGGCTGGATGTGTATAGAGATAATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGTCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGAT
  3   1   3        nb Brn2      in                        CAAJ22871.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATAT
  5   1   3        nb Brn2      in                        CAAJ22871.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATCTGTATAATTATACAGTAAAGAGTGTTCTTTATGAGGGGGTAGGGGAAAATGGGGATTAAACTGCCCCCCTGACTCAGGAATTTGGATCCAGCTTTAGGGGGGAATGATGAGCATTCTGTATATTAAGGGGATTAGCCTACCCCCTCCCCACTAAAATATCCCCAGAGCCTCCAGCCCTACTCCAGAAAGAGAGAAAGCACTCACCCACACAACCTCTCCAATGCTCTTTTTAGATGCAATTTCTGATATGCATAAGAAAATGATTGTACAATAATTGCTCATATGGGAATAAATACTATGCAATATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)