Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA049f05.5                         65 END     1           1        1                Hypothetical LOC496524 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012153747 Xt7.1-CAAN11350.3.5 - 78 ESTs
                                                                       ..-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAN11350.3.5                                                                                             CGTCAATACGGCGCCCAGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTAGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAGACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATATTTTACAAAACACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAA
                                                  Xt7.1-CHK-1008264939                                                                                                   TACGGCGCCCAGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTAGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAGACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATxxxTTxxAxAAxACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACA
                                                      consensus depths                                                                                                  2     2     2     2     4     4     4     4     4     4     5     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     4     6     4     6     4     6     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     2     3     2     3     2     3     1     3     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     4     4     5     5     6     6     6     6     6     6     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     8     7     8     7     8     8     9     8     9     8     9     8     9     6     8     6     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     5     6     5     6     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     7     8     6     8     7     8     7     7     7     7     8     9     8     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    10    11    10    11    11    11    11    11    10    11    11    11    10    10    10    10    10    10    10    11    11    11    10    12    10    12    12    12    11    11    11    11     9    10     9    11    12    15    13    16    13    18    16    18    16    18    16    18    16    18    16    18    20    20    21    21    22    22    22    24    21    23    22    24    22    25    22    26    23    27    26    30    26    31    29    34    29    34    33    35    35    36    37    38    35    38    37    37    36    37    37    37    39    39    39    39    39    39    39    39    41    41    42    42    42    42    43    43    43    44    44    44    44    44    44    44    44    44    43    43    43    43    43    43    43    43    43    43    38    43    42    43    43    43    45    45    44    44    43    43    43    43    41    43    42    43    41    43    42    43    39    42    37    42    37    41    23    40    24    41    24    41    23    39    22    38    22    37    22    37    20    37    16    37    13    32    10    20    10    20    16    19     9    19     9    19     9    19     9    19     9    19     9    19     9    17     9    17     9    17     9    16     9    15     9    15     8    13     6    11     3     6
  5   1   2  SIG                                     Xt7.1-CAAN11350.3                                                                                             CGTCAATACGGCGCCCAGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTAGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAGACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAA
  5   1   2                                         Xt7.1-TGas132b02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACCGGGCATGATGGGAACAGCAGCAGGCTGCGGTGCAGGGGTTGCAACTCCATATGCTGGGGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTNCAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGCTGGATCAGAACAAGTGCGCCCTAGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCTGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGGTTTCAGAGTGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATGNATAAAGAATGNAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACCAGGGTTTTGAAAAAAAGGATTATAAATTAATTAAAGACCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-CABC1047.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCAGCTTATATGACAGGCCAACCTCATTTTCTGGTTGGTAATTTGCGACGACCCCTAAGCTCAGCTTCTCAACAGCTCCTCGAAGCACACTGAGCACGTAAGTGTCAGACACTTTTCAAGATGGGGAGCTCCTGTGACAAGTGAAGGCCTTTGATCATTGCTGCTATTGAGATGCTGAAACTTTAGGCTGGCACAGTAAGAAAAAGTATATAAAATATAGCATTTTTAGCCATATTCTTTTTTTAGGCTTCAGTTCTCACTTAAAAAAAGCTATTGAGTTCCTTGGACAGAAACTGAATGTCTGTGTTCTTACACACAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCCACAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATGATTTCTTGCCAGAGTGTCTGCACCAATATAGGATCTGAATGTCCAGCACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------GG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------T-----
                                               BLH ATG     121     873                                                                                             
                                               BLH MIN      73     235                                                                                             
                                               BLH OVR     121      26                                                                                             
                                               EST CLI      16      27                                                                                             
                                               ORF LNG     121      21                                                                                             
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 5e-045     XP_001185873.1 PREDICTED: similar to Nucleoporin 155 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Sc ---- 7e-049     NP_011031.1 Abundant subunit of the nuclear pore complex (NPC), present on both sides of the NPC, has similarity to Nup170p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ce ==== 2e-070     NP_500102.3 Nuclear Pore complex Protein family member (npp-8) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 0          NP_477287.1 CG4579-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 0          NP_956450.1 nucleoporin 155 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 0          NP_573490.2 nucleoporin 155 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                 PROTEIN --- Hs ==== 0          NP_705618.1 nucleoporin 155kDa isoform 1; nuclear pore complex protein Nup155 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PREDICTED = Gg ==== 0          XP_425016.2 PREDICTED: similar to nucleoporin 155 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PREDICTED = Xl ==== 0          AAH47162.1 Similar to nucleoporin 155kDa [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 0          NP_001080800.1 nucleoporin 155kDa [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAN11350.3.5                                                                                                                                                                                                                      ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------ATGATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TAG------------------TGA---------ATG---------------------ATG------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------TAAATG---------------------------------TAA---------------------------------------TAA---------------------TAA------------------------------------------------------------------------------------ATG------------------------------------------TGA---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2  SIG                                     Xt7.1-CAAN11350.3                                                                                             CGTCAATACGGCGCCCAGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTAGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAGACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAA
                                                  Xt7.1-CHK-1008282752                                                                                                   TACGGCGCCCAGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTAGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAGACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACA
  0   1   1           Gas  FL                     TGas122g21.FL-Sanger                                                                                                               CGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTAGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAGACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACGTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACTACTTCAGTGTTTTTTCTTGAAAGCATTTAAAGGAGAACTAAGCCTGAAAGAAAGAATAGATTAATTAGAAAAAAAAAAAAAAAATTCAAAAAAAAAAAAAAAAAA
  0   1   1           Gas1 FLt3                   IMAGE:6988278.FL-MGC                                                                                                                                                                                 TTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTACTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTCCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACCTCAACTGACAATGGGCGCATATTCCTATCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGAAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGCGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAAATGTCCGAGTCTGTGAATTGTCACTTGCTGGCTGTCACGCATGCAGGTGTTCGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTGGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAAACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTGACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCCCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTTTGTCTGCACAGGGAAGCCATATTTTTTACAAACTTAGACCAGTGGATCAGCTACGACACCTTCTCGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTGTCTGCCTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGCGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTGGCTTCACCAATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAATGTTTCTACTCCAGCATATGGGGTTGCAACCCCTGCACCACAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCCTTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTACAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAAAAAAAAAAA
  5   1   2   24  ext Te3  5g                              CAAM1559.5p ................................................................................TTTGGAGAATGCCGTCAATACGGCGCCCAGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCT
  5   1   2   14  ext Te3  5g3  in                        CAAM15748.5p ............................................................................................CGTCAATACGGCGCCCAGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATAATCCTTCTCTGGAAAAGGATGGTTGGTCTGTATGAAAGTT
  5   1   3        nb Neu  5g                        TNeu120h15.p1cSP6                                                                                                             AGCGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTACTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTCCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGGAATTTTCAGCCTCACATACGCTTTCTG
  5   1   2       ext Gas  FL   in                   TGas122g21.p1kSP6                                                                                                               CGTGCTTGCTGTGCTCAGTTTGCGCGGGTCCCGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCT
  5   1   3   14   nb Te4  PIPE in                         CAAN1600.5p .............................................................................................................................................CGTGTGTGTTTGAACAGAGTTGTGCGCTCCGTACATTCGGGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCATGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGGAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCT
  5   1   2       add Gas1 FLt3                          IMAGE:6988278                                                                                                                                                                                      GGGTTCGGTTCCGCTGCTGAGTTGGAGGCAGCCTGCCCAGTGTAACACCTGGGGCCCCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTACTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTCCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCCAGTAATCTTTAATGACAGCATTTCTGGTTGAAATGCAAGCTACCTCCCAGAACCCGGCTATATTTCCTTGCCCGAACAGACCAACAACCTAATCTTTTTAATCCCATAAACCCTCCAACTGGGACAAATGGGGGCCGCCATATTTTCCCTAATCCCGGGGAAAAAGGGAAGGGGTTTGTGTCCCTGGGTTATGAAAAAGTTTTGTAAAATTTTTCCCACAAGCCCCTTGAGAAAAAT
  5   1   4      seed Te4       in                        CAAN11350.5p                                                                                                                                                                                                                                              CCGGCAGCCTCTGCCGCCATGCAGGAGGCTTTGGAAGGAGCGGGAAGGATCATAGACAGGCTGCTGCAGGAGGACCGAGCCTACCCGGACCTGTCCGAGCTGCTCAACGTGCCCGTGCATACTTGTCCTACAATATCTGGTGTATCTGAAATGGACTATCCTCTGCAAAGCCCTGGCCTGTTGACAATTCCCAGCCTTCCTGAGATCAGCGCTATCCGCCGCGTTCCTCTTCCTCCAGAACTGGTAGAGCAATTTGGACATATGCAGTGTAACTGTATGATGGGAGTGTTCCCGGAAATCAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGANCAACTCAGGGACATCTTGTATACCCGCTCTG
  5   1   2       ext Ovi1      in                         CABI9245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCCCATGTAGCTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCCACGTGNAAAAACCCATCA
  5   1   2       add Tbd0      in                       IMAGE:6976889                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAGGGCATGGCTGACCATCGACAGTGACATATTCATGTGGAACTATGAGGATGGCGGTGACCTTGCCTACTATGACGGGCTCAGTGAAACCATCCTTTCTGTGGGGCTAGTAAAACCTAAGGCAGGAATTTTTCAGCCTCACATACGCTTTCTGCTTGTTCTTGCTACTCCTGTTGATATTGTGATCCTGGGACTAAGTTTTGCCAATTTACAGCCAGGTAATCTTAATGACAGCATTTCTGGTGGAATGCAGCTACTCCCAGACCCGCTATATTCCTTGCCGACAGACAACACCTATCTTTTATCCATAACATCAACTGACAATGGGCGCATATTCCTCTCTGGAAAGGATGGTTGTCTGTATGAAGTTGAATATCAAGCTGAAGCGGGCTGGTTTAGCCAGAGATGCCGGAAAATCAACCACTCCAAAAGTTCCCTTTCCTTCCTCGTGCCTTCCGTTCTGCAGTTTGCTTTCTCAGAGGATGATCCCATTGTACAAATTGCAATTGACAACTCAAGGAACATCTTGTATACCCGCTCTGAGAAAGGCGTCATACAGGTGTATGACTTGGGTGTTGATGGTCATGGTATGAGCAGAGTGGCATCAGTATCTCAGAACTCTCTTGTCTCCGCTGCTGGAAACATTGCCAGGACAATAGATCGCAATGTTTTCAAACCCATCATTCACATCTCAATCATCGAAATGTCAGAGTCTGTGAAATTGTCCTTTGCTGGGTGTCACGCCTGCAGGTGGTAAGGCTATACTTTAACCACTGGGGCCATTTTAAACAGGCAAAAAGCCCCGGCCCCTCCATGGTTAGCTTTTGGGTGCATGGTTTCGCCCTACCCCCCAGGGTTTTTCTGCTTTCCTCCCAACGGTGGGAAA
  5   1   2       ext Gas7      in                         XZG34631.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCACATCTCAGTCATCGAGATGTCAGAGTCTGTGAATTGTCATTTGCTGGCTGTCACGCATGCAGGTGTTAGGCTATACTTTAGCACTGTGCCATTTAAACAGCCAACAGCCCGGCCCTCCATGTTAGCTTTGGTGCATGTTCGCCTACCCCCAGGGTTTTCTGCTTCCTCCAACGTGGAAAAACCATCAAAGGTGCACAGAGCACTATACAACAGTGGTGTATTGCTGATGGCTGCATCTGAAAATGAAGACAATGATATATTGTGGTGCATCAATCGTGATTCTTTTCCATTTCAAAGACCAATGATGGAAACACAGGTGACTACCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGAT
  5   1   3        nb Te4       in                         CAAN4111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCAGGTGGATGGGCATTCCTGGGCTCTGTCTGCAGTAGATGAACAGAAAGCTGATAAAATTGTAACCCTCTTTAAACAAAGATCTCATCCCTCTCACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCCCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACC
  5   1   3        nb Gas1                               IMAGE:6989414                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGGACTCTCCGGTTATTATTCAGCAACATATGATCCCTCTCAAACGCTTTGTGCTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTNCAGAGCTCAAAGGGTTACTGGGAGTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTANGTAACCCCAGCNTTGGTACACCCTGCAATCGTCAGCAGCGACTTGTGGGCCCTGGGCGGNCTGACTCTGGCAGTTCACN
  5   1   3        nb Eye                                  CCAX6511.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTCTGTCTGCACAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCA
  5   1   0       chi Gas                            TGas019o04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGAGGGAAGCCATATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTTGTGTTGGGGTCCCCAGGATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTC
  5   1   2       ext TpA       in                   TTpA014e06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGCCTATTTTCTACAAACTTAGACCAGTGGATCAACTACGACACCTTCTTGTTAGCAATTCAGGAGGAGATGGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACT
  5   1   3        nb HdA                            THdA035m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACACCTTCTTGTTAGCAATTCAGGAGGAGATGTGGGAAGAAATAGAGCGTTTTTTCAAGTTACATCAGGAGAACCAGGCTTGTGCAACCTGCTTGATTCTTGCATGTTCCACTGCTGCATCTGACAGAGAAGTCTCTGCTTGGGCTGCTCGGGCATTTTTCAGGTACGGTGGGGAGGCTCAGTTGCGTGTACAGTCAGCACTACACCAACCCGGTAATGTTGGGCCTATCTTCGGTTCTCCTCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTG
  3  -1   2       ext Fat1      in                         CABC4833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGAGAGGCTGCCAGTAGCTTCACCTATGCCTGTAGGCAGTCCGATGCCAAATCCTAGCTTCCTGGGGACCCCAACACAAGGAGCCTGCCCTCCTAACGTTTCTACCCCAGCATATGGAGTTGCAACCCCTGCACCGCAGCCTGCTGCTGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGC
  5   1   2       ext Te3       in                         CAAM5369.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGTGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATT
  5   1   3        nb Te3       in                         CAAM6229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTG
  5   1   2       ext Te4       in                         CAAN7507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTNCACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACNAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATC
  5   1   3        nb Gas                            TGas050n22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAANATCCCGCCATGTTCNCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGTTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAGTGCGATACATGGATTTGCTGTGGCGA
  5   1   3        nb TpA       in                   TTpA008i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGACCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATGCATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGANCATATGCTGATCCATTTANGCTTTCAGAAATGCAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTG
  5   1   3        nb Tad5      in                         XZT17439.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCACAAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTTCCACCATTCGGCTGTGGGGGATGCAGTGT
  5   1   3        nb Gas7      in                         XZG36979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGGTGAACCAAAGTAAAGCTGCACCCCAATCACCCAGTGTTCCCAAAAAACCAGGCCCTCCTGTCCTGTCGTCGGACCCCAACATGCTCAGCAACGAAGAGGCAGGAATACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTT
  5   1   2       ext Te1       in                        CBWN14589.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACATTTTGAGCAAATGCTGAAGTTGGCACAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACTATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAACCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCACTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGGAACAACA
  5   1   2       ext Ova1      in                         CABE9560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCGTTCTACAGATGAGCTCTTCAACATAGCACTTTTCAACTGGCTTATACAAGCGGATCTCACTGACAAACTGCTGGAGTTGAATTCTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCC
  5   1   3        nb AbdN                               IMAGE:7005497                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCTTCACATAGCACTTTTCAACTGGCTTATACAGGCGGATCTCACTGACAAACTGCTGGAGTTGAATTTTCCGTTTCTGGAGCCACATTTGGTGCGTATGGCGAAGCTGGATCAGAACAAAGTGCGATACATGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGGAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTTGGTGAAATACCTGGAAACACAAGTGTGTAACTTTCGCTGGGACGCTGGGCTTTGTTACCTACCCAATGCAAGGAGATCAATGTGCCCTGTTNCCCAGTTACTTGGAAGGTATATGAATCCCCTTGTTTAAAAGCCAGGGGATCCCCTGGTTGGAAGTAGGATGAAAGAAACCCCCC
  3   1   0       chi Tbd0      in                       IMAGE:6976889                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCCGTTAAAAGAAGGCTGTTTCAAGAGAAATACGGGGCCATGCGATCTATGGAGACAAATGTTTAGGGAAACCGGAGGGGGTGCGGGATGAGAAACAACCATTTTGGCCAAGAAAAAGCCGCCGAAAATATAATTGGGGGGGTGGTGAAACAGGGACCCATATTGTTTCTAGGGGGCCCACAGGGGGGACAAATTCTTCCCCGTGGGGGGGGTTTAAATACGGGGGAAAGTGTGTTGGGGAAGGGCACGAGGTCCCCCCAAGACTCCTATGGGGTGGGGAAAAAAGGTTTTACCGGGCGCCTCGGGGGGGGGTAAGGGGGGAATTGTGGGCGAGAAAATTAGGCCCCGAAGGTTTTTTCCCCCCTCTATATTCCCGACTTGTGCCCAAAAAAAAAAAAAATATATATTGGGGGGAGCGGTGTAATAACATTTTCAAGTGGAGGGGGGGGAGAAAATAAAATAAAAAATTTTTTTTCATTTAAAATAAAGGGGCCCAACCACGGGTGGTTTTAAAAAACCACACGCCCCCTCGTTTTGGGGAAACACGCGAAAAGTTGGATTTATTACCCCCGCCTTTCATTTCGGGGGGAAAAAACATTCTTTATTTATTGAGGGAGGGTGGAAAAAGAATTTAGCCCCCTATGGGAAAAAACACAAAAACAAGAGGAGTATAATGGTAAAAACCTGTGCAAAGGCGTTGGGGGAACGGGACTTGGGCTTTGTTGTTAAAGCACTAACCACCAAATTGGCAAAGAAGATTCAAATGGTGCCCTGGTTTCCACAAGGTTAACTTGAAAGTATTATGATCAGCTGGTTTAAAGCAAAGGGATCCCGTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGGGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCCGTCGTTAGAATATTTCCAAGCTGCGCCAAAGCAGGGTGTGGTGAGGGACGGAGTCGGGGCGGGGGCGGTCGGGGTGGGGGGGGGGTTGGGGGGGGGGGGGGGGGTGGTGGCGTGTGGCGGGGGGGGTGGCGGGGGTGCGGCGGGGGGGGCGGGGGCGGGGGGCGCGGGGTGGGGGGCGGGGGGGG
  5   1   3        nb Neu                            TNeu128g05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAATTTCAGCAATGCTGCTCGTGTCGTGGCGCAAAGGGGCGGGGATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTGCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATGGGAGGGGGGGATACAAAGACCCTAAGCAGACAATATTCCCACCATTCAACTGTGGGGGAGGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTGTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCGAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCGAGAAATCATTGATAAAGAATTGAGCGACAGCCTGTGAAATAGCTCGGTGGATCGAATGCGGGCCCTTCATCTAAAAATGACTTCTCTTGGGAAAATCTATGCCAGGACCCCTCGCTATTTTCCTTTGGAATTTTTG
  5   1   3        nb Neu                            TNeu031c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAATTTCAGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCAGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTNTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGT
  5   1   2       ext Ova1      in                         CABE2418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATT
  5   1   2       ext Gas7      in                         XZG65900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACGCGTCCGCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTNCACATAATGGACAGCTGTACACACACTTGGATGGGGTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACTTT
  5   1   3        nb TpA       out                  TTpA036k03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGATCCATTTAGGCTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGAGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTACGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCAGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAAAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACAAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACT
  5   1   2       ext Gas       in                   TGas114i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGACACTCTGGCAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGG
  3   1   2       ext Ovi1      in                         CABI9245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAAC
  3   1   2       ext Gas7      in                         XZG34631.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAGAAATCATGGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTGAAAAAAAGATTATAAATTAATTTTAC
  3   1   2       ext Ova1      in                         CABE2418.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTGGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGGTTTTGAAAAAANAGATTATAAATTAATTTTACAAAAC
  3   1   4      seed Te4       in                        CAAN11350.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATCATTGATAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAAC
  3   1   3        nb Tad5                                 XZT71279.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAAGAATTGAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTAC
  3   1   2       ext Te1       in                        CBWN14589.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACGTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTCTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAGCTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACATTTGGACGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGATTACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTCCCACACACGGCGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCTGACTGCCAAACAGGGTTTTGAAAAAGATTATAAATTAATTTTACAAAACAAAAAAAAAAAAAAA
  5   1   3        nb HeRe      in                     EC2CAA42CE10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACGTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAAATTCGTGATTCAACATAATGGACAGCTGTACACGCACTTGGACGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCACCACACTGCATTCTGGTCTGTTTTCCAC
  3   1   2       ext Te3  5g3  in                        CAAM15748.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACGTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTAC
  3   1   2       ext Te4       in                         CAAN7507.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACGTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTCCAAACC
  3   1   3        nb Te4  PIPE in                         CAAN1600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACGTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAAC
  5   1   3        nb TbA                            TTbA039f22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGAATACCTGGAACAACAGGTGTGTAACTTTCAGCTGGGACGCTTGGCTTTGTAACCTACACAATGCAAGAGATCAACGTGCCCGTTCCCAAGTTACTCGAAGTATATGATCACTTCGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTCGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTT
  3   1   2       ext Te3       in                         CAAM5369.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACNAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCNCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTGAAAAAAAGATTATAAATTAATTTTACAAAAC
  5   1   2       ext Ova1      in                        CABE13674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGAGGCTGGGACGCTCGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGC
  3   1   2       add Ski1      out                        CABJ8573.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTTCAACNCAGCTTCCCAAAAGTCCCACTAGGATGTGGGGAGTCTTAATTCACCATGTTTGCTAATAATCCGTTTCTTCACAGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACT
  5   1   3        nb Tad0                               IMAGE:6984916                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATTCCGGGATGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACACAAAATGGGAACTTGTTAATTTTCTGATTTTTCTATCTCGG
  3   1   2       ext Ova1      in                        CABE13674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTGTTNAAAGCAAGGGATCCCTGTGGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACT
  3   1   3        nb Gas7      in                         XZG36979.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTCCCTAAAATATT
  3   1   3        nb Tad5      in                         XZT17439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTCCACTTGCTAGAAAGCATTTATTTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCCCCCTCTGCCTGGATGCAATATCCTGCTACCTAGGGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACCCCCACTTGGATGGGTTGGGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGGGGGTCCTGATTTAGATCTCCCAATACGAATGTTTTATTCCTGGAATACTGCCTGACCCATCGCCCCACTGCATTTTGGTTTGTTTTCCCCCCCCGGGGACATTTTTCCTCCTGCATTAAATGGGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTCCCAACCC
  5   1   3        nb Tbd1      in                        CBXT18975.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTGCCTGTGTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAGCTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGTTGTACACACACTTGGACGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAAATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAAAAAAAAAAAAA
  3   1   3        nb Tbd1      in                        CBXT18975.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAGCTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGTTGTACACACACTTGGACGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAAATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTTTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAAAAAAAAAAAAA
  3   1   2       ext Ova1      in                         CABE9560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTGNCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACTACTTCAGTGTTTTTTCTTGAAAGCATTTAAAGGAGAACTAAGCCTG
  3   1   2       ext Gas7      in                         XZG65900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTACTTGAAGTATATGATCACTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAG
  5  -1   2       ext Fat1      in                         CABC4833.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGTGGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACT
  3   1   3        nb Te3       in                         CAAM6229.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACT
  3   1   3        nb Te3       in                         CAAM4487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAAC
  5   1   3        nb Te3       in                         CAAM4487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTCTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACGGTGACATTTTTCCTCCTACATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCAACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAAAAAAAAAAAAAAA
  3   1   2       ext Gas  FL   in                   TGas122g21.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACTACTTCAGTGTTTTTTCTTGAAAGCATTTAAAGGAGAACTAAGCCTGAAAGAAAGAATAGATTAATTAGAAAAAAAAAAAAAAAATTCAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas       in                    TGas114i06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTTTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       ext TpA       in                    TTpA014e06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTTTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTTTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTTTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCACCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Tbd1      in                         CBXT2160.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAAAAAAAAAAAAAAA
  3   1   3        nb Tbd1      in                         CBXT2160.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAAAAAAAAAAAAAAA
  3   1   3        nb Te4       in                         CAAN4111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCAACTACTTCAGTGTTTTTTCTTGAAAGCATTTAAAGGAGAACTAAGCCTG
  3   1   3        nb HeRe      in                     EC2CAA42CE10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAAATTCGTGATTCAACATAATGGACAGCTGTACACGCACTTGGACGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCACCACACTGCATTCTGGTCTGTTTTCCACACACGGCAACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTAATTTGATATTTTTAGCAGTTTATTATTATTCAATATCTTTGTAATACTGCCTTATATGGAAGACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATAAATTTTAAATCTGCTCTTTGC
  3   1   3        nb TpA       in                    TTpA008i10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCGATGGATCCGGCTCCCGGCGTTGCTGAATACTGTATTTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGTTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACCCCCCCTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTGGAATACTGCCTGACCCATCGCCCCACTGCATTTTGGTTTGTTTTCCCCCCCCGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTTTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTCCAAAACAATTTTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTCCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCTAAAAAAAACAACTCANCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb HdA       in                   THdA003a19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTCTAATGGCTACATCTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTCTTATTCTCTGGCATATATATTTTAAATCTGCTCTTTGCAGTGTATGCAACCT
  3   1   3        nb HdA       in                    THdA003a19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATAATGCCTGACCCATCGCCACACTGCATTTTGGTTTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTTTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACAAAACAATTTTAATGGGTACATTTATTTTTTTTTTTTTTACTATTTGATATTTTTAGCAGTTTATTATTATTCAATATCATTGTAATACTGCCTTATATGGAAAACTTTGTACAACAAAATGGGATACTTGTTATATTTTCCTGATTTTTTTTATTTTTTGGCATATATATTTTAAATCTACTCTTTGCAGGGTATGCAACCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCGC
  5   1   2                                         Xt7.1-TGas132b02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACCGGGCATGATGGGAACAGCAGCAGGCTGCGGTGCAGGGGTTGCAACTCCATATGCTGGGGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTNCAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGCTGGATCAGAACAAGTGCGCCCTAGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCTGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGGTTTCAGAGTGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATGNATAAAGAATGNAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACCAGGGTTTTGAAAAAAAGGATTATAAATTAATTAAAGACCAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008282750                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATGATGGGAACAGCAGCAGGCTGCGGTGCAGGGGTTGCAACTCCATATGCTGGGGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTNCAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATGGCGAAGCTGGATCAGAACAAGTGCGCCCTAGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCTGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGGTTTCAGAGTGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATGNATAAAGAATGNAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACCAGGGTTTTGAAAAAAAGGATTATAAATTAATTAAAGACCAAAAAAAAAAAAAAAAAAAAA
  5   1   4      seed Te3       in                         CAAM3857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACCGGGCATGATGGGAACAGCAGCAGGCTGCGGTGCAGGGGTTGCAACTCCATATGCTGGGGTACCGGGCATGATGGGAACAGAAATTGCATTTTCAGGAAAGCACAATGGTATTTGCATCTACTTCTGCCGCATTATCGGTAATATTTGGGATGGAAGCGTAGCTGTGGAAAACACCTTCAAGAGCGGGAACAGAGAAGTCACAGCGATTGACAGCAGTGTTACACCACAGCTTCTGGAGTCTGTTCTTCAAGAGCTCAAAGGGTTACTGGAGTTTCTTGATCGATACTCCCAGTTTACTGCTGGATCTCTAGGTAACCCCAGCTTTGGTACACCTGCAAATCGTCAGCAGCGACTTGTGGGCCTGGGCCGGCCTGACTCTGGCAGTTCACAGCAAGCCCAACAAGAACTCCAAAGAAAATACCACACTGAAGCTCAGCTTGCAGAACAGTTATCTCTCCAGGGGATCCATCAGCTGGTTAGGAAAATGTGCCAAGCTCTTGCTTTGTGGAAGCTACTGTGTGAACATCAGTTTAGCCTCATTGTTTCAGATCTACAAAAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTNCAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAA
  5   1   2       ext Gas       in                   TGas132b02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCGTATGGCGAAGCTGGATCAGAACAAGTGCGCCCTAGGATTTGCTGTGGCGATACTATGAGAAGAACAGAAATTTCTGCAATGCTGCTCGTGTCGTGGCCAAACTTGCAGATATGCCCAGCACAGAGATCTCATTAAAGCAACGACTTGAATACATCTCCAGAGCCATTCTCAGTGCCAAGAGCTCCACTACAATGTCCACCCTTGCTGCCGACGGCGAGTTCTTGCACGAGCTGGAAGAAAAGTTAGAGGTAGCAAGAATTCAGCTGCAAATACAAGAGACCCTAAGCAGACAATATTCCCACCATTCGGCTGTGGGGGATGCAGTGTCGCAGCTTGATTCTCAGCTAATGGACATTACAAAGCTGTTTGGACAATATGCTGATCCATTTAGGGTTTCAGAGTGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATAT
  3   1   4      seed Te3       in                         CAAM3857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGTTTGGACAATATGCTGATCCATTTAGCTTTTCAGAATGCAAACTAGCAATTATACACTGTGCTGGACATTCAGATCCTATATTGGTGCAGACACTCTGGCAAGAAATCATGNATAAAGAATGNAGCGACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTAT
  3   1   2       ext Gas       in                    TGas132b02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTTTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACCAGGGTTTTGAAAAAAAGGATTATAAATTAATTAAAGACCAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-CABC1047.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATCAGCTTATATGACAGGCCAACCTCATTTTCTGGTTGGTAATTTGCGACGACCCCTAAGCTCAGCTTCTCAACAGCTCCTCGAAGCACACTGAGCACGTAAGTGTCAGACACTTTTCAAGATGGGGAGCTCCTGTGACAAGTGAAGGCCTTTGATCATTGCTGCTATTGAGATGCTGAAACTTTAGGCTGGCACAGTAAGAAAAAGTATATAAAATATAGCATTTTTAGCCATATTCTTTTTTTAGGCTTCAGTTCTCACTTAAAAAAAGCTATTGAGTTCCTTGGACAGAAACTGAATGTCTGTGTTCTTACACACAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCCACAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATGATTTCTTGCCAGAGTGTCTGCACCAATATAGGATCTGAATGTCCAGCACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTT
                                                  Xt7.1-CHK-1008282756                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTATATGACAGGCCAACCTCATTTTCTGGTTGGTAATTTGCGACGACCCCTAAGCTCAGCTTCTCAACAGCTCCTCGAAGCACACTGAGCACGTAAGTGTCAGACACTTTTCAAGATGGGGAGCTCCTGTGACAAGTGAAGGCCTTTGATCATTGCTGCTATTGAGATGCTGAAACTTTAGGCTGGCACAGTAAGAAAAAGTATATAAAATATAGCATTTTTAGCCATATTCTTTTTTTAGGCTTCAGTTCTCACTTAAAAAAAGCTATTGAGTTCCTTGGACAGAAACTGAATGTCTGTGTTCTTACACACAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCCACAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTCTTGCCAGAGTGTCTGCACCAATATAGGATCTGAATGTCCAGCACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACGGCA
  5   1   4      seed Te5       in                         CAAO8209.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                catcagcttatatgacaggccaacctcattttctggttggtaatttgcgacgacccctaagctcagcttctcaacagctcctcgaagcacactgagcacgtaagtgtcagacacttttcaagatggggagctcctgtgacaagtgaaggcctttgatcattgctgctattgagatgctgaaactttaggctggcacagtaagaaaaagtatataaaaTATAGCATTTTTAGCCATATTCTTTTTTTAGGCTTCAGTTCTCACTTAAAAAAAGCTATTGAGTTCCTTGGACAGAAACTGAATGTCTGTGTTCTTACACACAGGAACTCCAGGAGCAGCTGAAGATAACCACTTTTAAAGATCTTGTGATCAGAGACAAAGAGCTGGCGGGGGCTCTTACCGCATCTTTGATCAATTGCTACATCCAAGACAACGCATCAGTGGATGGAGTTAGTTACCGACTTCAAGAAGTGTGTCCTCTTCTGTACAGCACTGACGATGCAGTGTGCTCAAAGGCAAATGAACTTTTGCAAAGATCCCGCCATGTTCCAAACAAACTGGAAAAGGAGAGAATGCTACGAGAGTCATTAAAAGAGTATCAAAAAATAAGTCAACAGGTTGACCTTCCTAATGTGTGTGCTCAGTACAGGCAAGTACGCTTCTATGAGGGAGTGGTGGAGCTCTGCCTAACTGCTGCTGAGAAGAAAGATCCTCAGGGGCTAGGCCTTCATTTCCCACAGAACGGAGAACCTGAGGAGGATGTGGCTGGCCTGCAGGCTTTTCAGGAGAGGTTAAATAGCTACAAATGTATCACTGATACACTTCAAGAGCTGG
  3  -1   2       ext Fat1      in                         CABC1047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATAATGATTTCTTGCCAGAGTGTCTGCACCAATATAGGATCTGAATGTCCAGCACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCCTGCATAATGAGGAGACTTT
  5  -1   2       ext Fat1      in                         CABC1047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGTCCAGCACAGCCTGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTNTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTTACGGCACGAGG
  3   1   4      seed Te5       in                         CAAO8209.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGAGCGACAGCTGGGGAAATAGCTCGGTAGATCGAATGCAGTCCCTTCATCTAAAAATGACTTCTCTTGGAAAAATCTATGCCAGTACCCCTCGCTATTTTCCTTTGGAATTTTTGGTGAAATACCTGGAACAACAGGTGTGTAACTTCAGCTGGGACGCTGGCTTTGTAACCTACACAATGCAAGAGATCAATGTGCCTGTTCCCAAGTTACTTGAAGTATATGATCACTTGTTTAAAGCAAGGGATCCCTGGTGGAGTAGGATGAAGAAGCCCCTGCACTTGCTAGAAAGCATTTATCTTTTGCTTTCTGGGTATGTACAGGAGCCAAGCAAAGTGCCTTCCTATGAAAGGCGCCGGTTTACCACACTCTGCCTGGATGCAATATCCTGCTACCTAGTGGAACTGCAGTCGATGGATCCGGCTCCGGCGTTGCTGAATACTGTATCTAACTTCAAATCTTTGCAAGCTAAATTAGAGCGGCTGAGCTAGTCAAGCCAGTCAGATTCATGATTCAACATAATGGACAGCTGTACACACACTTGGATGGGTTGTGGATACCATGAAGGCTGCCATTGCTTTCGGCATGGTTCCACTCATTTACCTTTGTGTGTCCTGATTTAGATCTCTCAATACGAATGTTTTATTCCTCGAATACTGCCTGACCCATCGCCACACTGCATTCTGGTCTGTTTTCCACACACGGTGACATTTTTCCTCCTGCATTAAATGAGGAGACTTTGTTATAATTCATATTTTCTTCCTTAAATATTCCGACTGCCAAACAGGGTTTTGAAAAAAAGATTATAAATTAATTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)