Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3300000000000001    0Xt7.1-CAAM9447.3.5                         19 END     3           5       15                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 322.0    0Xt7.1-CABG11994.3                         119 PI      73       1166     1967                Sec14l1-prov protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012153812 Xt7.1-CAAN6622.3.5 - 58 ESTs
                                                                       .-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAN6622.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGCGGGGCCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATATCCCAAGGCATCACCCACCTTCCCAAATGGACACCCGGGGTCCCAGCTGGCTGGCACCCCCTGCAGGCCTTCAGAAGTGGTATTCCCCGCAGCAACCAGGCCGAGCAAACAGCCTCTCAGGGACCATGTAAAGCAGACGCGGGGAGCCACAGCTTGGCCGCAGAGCCATCCACTCCTGACACTGATAAACTAGAAGCCGACTACATAGAACGCTACCTCGGGCAGCTTACGCCAATGCAGGAGAGCGCCCTTATCCACCTGCGCCAGTGGCTGCAAGAGACGCACAAAGGCAAGATCCCAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGCCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTACAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGCGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTTGTGAAAGGAGCGCCCCACGAGATCATGTTGAGATCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACAACTTTAACCAAAGAAGTGTATGGAATTTTTCTTCCACCTCAGAAATGTACTGAACAATTAGAATTCAATAGGAGACCCCCTTATATGAGAATGTCTTGTAGAACCTTTCTAACGCCTCTTGTAGAGGTTCCCTGTATGGACTGAGGTGAGTCGCACTGTTGGGTGGGCTTCACTGATAATTAACCTACAGGATGGGATGGGGGGGCTGGTCACATGACAGGGCTTACGCCACTGTTTATTTCTCAAGTGACTGTAGACATCACAATGCACCTCACTGCACTGCCTTATTTATTGGGTGGCACGTACCTCTAGGGCCCCAATGCTCATTTAAAGGAGAAGGAAAGGTACAATCACTTTGGGGGGCTAACATCTTGGCAGTCATTTTACCTTTCCTTCTCCTTGAAGCCCCTTATAATGATATATATCTGTGCATGCTCAAGCCTCTGTAGGACACCTTGGCTCTCCGGCTGCCACAGAACTACAACTATCAACAGCTTTTCTGTAGCGGTGTTGCCT
                                                  Xt7.1-CHK-1008264954                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATATCCCAAGGCATCACCCACCTTCCCAAATGGACACCCGGGGTCCCAGCTGGCTGGCACCCCCTGCAGGCCTTCAGAAGTGGTATTCCCCGCAGCAACCAGGCCGAGCAAACAGCCTCTCAGGGACCATGTAAAGCAGACGCGGGGAGCCACAGCTTGGCCGCAGAGCCATCCACTCCTGACACTGATAAACTAGAAGCCGACTACATAGAACGCTACCTCGGGCAGCTTACGCCAATGCAGGAGAGCGCCCTTATCCACCTGCGCCAGTGGCTGCAAGAGACGCACAAAGGCAAGATCCCAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGCCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTACAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGCGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTxGxxAxAGGAGCGCCCCACGAGATCATGTTGAGATCxxGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACAxxTTxAACCAAAGAAGTGTATGGAATTTTTCTTCCACCTCAGAAATGTACTGAACAATTAGAATTCAATAGGAGACCCCCTTATATGAGAATGTCTTGTAGAACCTTTCTAACGCCTCTTGTAGAGGTTCCCTGTATGGACTGAGGTGAGTCGCACTGTTGGGTGGGCTTCACTGATAATTAACCTACAGGATGGGATGGGGGGGCTGGTCACATGACAGGGCTTACGCCACTGTTTATTTCTCAAGTGACTGTAGACATCACAATGCACCTCACTGCACTGCCTTATTTATTGGGTGGCACGTACCTCTAGGGCCCCAATGCTCATTTAAAGGAGAAGGAAAGGTACAATCACTTTGGGGGGCTAACATCTTGGCAGTCATTTTACCTTTCCTTCTCCTTGAAGCCCCTTATAATGATATATATCTGTGCATGCTCAAGCCTCTGTAGGACACCTTGGCTCTCCGGCTGCCACAGAACTACAACTATCAACAGCTTTTCTGTAGCGGTGTTGCCTGCAAGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     3     3     5     3     5     6     7    14    15    16    17    16    17    17    18    18    19    18    19    19    20    19    20    20    22    20    23    20    23    20    23    20    24    20    24    20    24    20    24    20    24    20    24    20    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    22    24    21    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    23    24    22    23    22    23    22    23    21    22    21    22    21    22    21    22    21    22    21    22    20    21    20    21    20    21    18    19    16    18    17    18    17    17    16    17    15    15     7     7     4     4     4     4     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     4     5     4     5     4     5     4     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     6     5     6     5     6     4    13     4    13     5    13     7    16    11    20    16    20    19    21    19    21    18    21    23    25    24    25    23    25    24    25    24    25    24    25    25    25    25    25    25    25    25    25    25    26    26    27    27    28    27    28    27    28    27    28    27    28    27    28    26    27    26    27    26    27    26    27    26    27    26    27    26    27    26    27    26    27    27    27    26    26    26    26    26    26    26    26    25    26    24    24    23    25    25    25    24    25    25    25    25    25    23    25    25    25    25    25    25    25    25    25    26    26    26    26    26    26    25    26    26    26    25    25    25    25    25    25    25    25    25    25    25    25    22    25    22    25    22    25    22    25     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3
  5   1   2      ests                                Xt7.1-CAAN12511.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGCGGGGCCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATAT
  5   1   2      ests                                 Xt7.1-CAAN6622.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGTCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTCCAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGTGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGAGCGCCCCACGAGATCATGTTGAGTCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAAACACTTTAACCAAAGAAGTGTATGGAATTTTTCTTCCACCTCAGAAATGTACTGAACAATTAGAATTCAATAGGAGACCCCCTTATATGAGAATGTCTTGTAGAACCTTTCTAACGCCTCTTGTAGAGGTTCCCTGTATGGACTGAGGTGAGTCGCACTGTTGGGTGGGCTTCACTGATAATTAACCTACAGGATGGGATGGGGGGGCTGGTCACATGACAGGGCTTACGCCACTGTTTATTTCTCAAGTGACTGTAGACATCACAATGCACCTCACTGCACTGCCTTATTTATTGGGTGGCACGTACCTCTAGGGCCCCAATGCTCATTTAAAGGAGAAGGAAAGGTACAATCACTTTGGGGGGCTAACATCTTGGCAGTCATTTTACCTTTCCTTCTCCTTGAAGCCCCTTATAATGATATATATCTGTGCATGCTCAAGCCTCTGTAGGACACCTTGGCTCTCCGGCTGCCACAGAACTACAACTATCAACAGCTTTTCTGTAGCGGTGTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACGATTTACCAGTCATCCTGTG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---TG-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CT----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                               BLH ATG     470    2067                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     470     287                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     470     848                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI      40      32                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     470     119                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sc ---- 2e-023     NP_013796.1 Phosphatidylinositol/phosphatidylcholine transfer protein involved in coordinate regulation of PtdIns and PtdCho metabolism, products of which are regulators in Golgi to plasma membrane transport; functionally homologous to mammalian PITPs [Saccharomyces c ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 3e-165     NP_609028.2 CG9528-PA [Drosophila melanogaster] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ce ==== 3e-180     NP_001040875.1 T23G5.2a [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 0          XP_783768.2 PREDICTED: similar to Sec14l1 protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 0          NP_957392.1 SEC14-like 1 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Mm ==== 0          XP_979801.1 PREDICTED: similar to SEC14-like 1 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAH82398.1 MGC81931 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 0          NP_001087870.1 MGC81931 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 0          NP_002994.2 SEC14 (S. cerevisiae)-like 1 isoform a [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ==== 0          XP_414710.2 PREDICTED: hypothetical protein [Gallus gallus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          AAI21464.1 Unknown (protein for MGC:146514) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAN6622.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAA------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TGA------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------TAA------------------------------------ATG------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------ATG---TGA---------------TAG---------------------------TAG---------------------------------------------TGA------------------------TGATAA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                            ]
  0   1   1           Te4  FL                         CAAN12511.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATATCCCAAGGCATCACCCACCTTCCCAAATGGACACCCGGGGTCCCAGCTGGCTGGCACCCCCTGCAGGCCTTCAGAAGTGGTATTACCCGCAGCAACCAGGCCGAGCAAACAGCCTCTCAGGGACCATGTAAAGCAGACGCGGGGAGCCACAGCTTGGCCGCAGAGCCATCCACTCCTGACACTGATAAACTAGAAGCCGACTACATAGAACGCTACCTCGGGCAGCTTACGCCAATGCAGGAGAGCGCCCTTATCCACCTGCGCCAGTGGCTGCAAGAGACGCACAAAGGCAAGATCCCAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGTCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTCCAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGCGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGCGCCCCACGAGATCATTGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACCAAAAAAAAAAAAAAAA
  5   1   2      ests                                Xt7.1-CAAN12511.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGCGGGGCCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATAT
                                                  Xt7.1-CHK-1008229147                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATATCCCAAG
  5   1   2       chi Te4       in                         CAAN1985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCTCATGAGTTGAGTGCAGTTGGAGAGCTCTTATGAGTTGAGTGCAGTTAGAGAGCTCTCATGAGTGGGGGGACAGTTGGAGAGCTGTCATGATGGCAGTTGTGAACCTGCAAGTCCTAAAGTCCCTGGCAACCCTTGGCGTGCCCCGTAGTAATGTGCAGGGGGGCAGTTTGTCTAAGCCATCCTTTCATAACCTGGGCCCAACCCAGACCCAGTTTGTGAAGAACTTTACTACCTGTGCCCAACCCACCCTCTATGGTGATTGGAAAACAACCCTGTGCCACCAATGATGGGCAGAGGGTGATGGGCACACACAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACT
  5   1   2   14  bld Te4  5g3  in                         CAAN8373.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCAGCGTGCTGGGGGCGGGGCCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCGAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCTAACTCAACGTGGACGCGCCGCGACTCCTGATAAAAATCGCGAGGGTCGAATTTGTCTACTTCATTCAG
  5   1   2   14  bld Te4  5g3  in                         CAAN9302.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTGGGGGCGGGGCCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTT
  5   1   2   14  bld Te4  5g3  in                         CAAN7406.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGGATTCCGGGATTCGTCGACCCCGCGTCCGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACG
  5   1   2   14  bld Te4  5g3  in                         CAAN2611.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCACAGGCTGGGGATTGTGTCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGA
  5   1   2   14  bld Te4  5g3  in                         CAAN7354.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCACTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAAATGAGGATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGT
  5   1   2   14  bld Te5  5g3  in                         CAAO6334.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTTGAGGGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTC
  5   1   2   14  bld Te3  5g3  out                       CAAM14907.5p .......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTG
  5   1   2      seed Te4  FL   in                        CAAN12511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGG
  5   1   2   14  bld Te4  5g3  in                         CAAN7642.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTC
  5   1   2   14  bld Te4  5g3  in                         CAAN9618.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAGGAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACC
  5   1   2   14  bld Te4  5g3  in                        CAAN10355.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTC
  5   1   2   14  bld Te4  5g3  in                         CAAN1446.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCAC
  5   1   2       chi Te4       in                         CAAN3244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGACCAGCAGGATCCAGCTGTAGGCAGCAGCCAGTAGGAAGAACTGCATTCTGGTGACTGCCTGCTCTGTGCACGGGCGCTTCTCCCTGCGCACCTACTCACTATAGGATCTAAGGGTAGCCATACACAGGCCAATAAAAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCA
  5   1   2   14  bld Te4  5g3  in                         CAAN9243.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGGACATCAGTCGTTCTTTGGCTTTGAGAGCACG
  5   1   2   14  bld Te3  5g3  in                        CAAM14004.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTG
  5   1   2       bld Te5       in                         CAAO7206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTG
  5   1   2   14  bld Te4  5g3  in                         CAAN1788.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAG
  5   1   2   14  bld Te4  5g3  in                         CAAN8515.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGG
  5   1   2   14  bld Te3  5g3  out                        CAAM9447.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAAATGAGCAGTA
  5   1   2       bld Te4                                 CAAN11564.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATATCCCCAGGGCATCACCCACCTTTCCCAAAT
  5   1   2   24  bld Te3  5g                              CAAM2137.5p .............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAATCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCAC
  5   1   2   14  bld Te4  5g3  in                         CAAN2853.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGTACCACGCCATGGGCATTAACAGGACATAGGAAGCCATGAGTATAAGCTCTGTTGGGGCCAAATTAGAAGAAAATAGAAGAAGAAAAAATGGCTGACTCGTCTTGGAGAGCTGCGGATACTAAGCATCAGAGCTGAGCAAGAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAATCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTA
  5   1   2   34  bld Te3  5x3  out                        CAAM4484.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGAGGGAGCCGGGAGGGCAGCGGAGGGGATCGCGGAGTAAAGAATGGTGACAGGCGGCAGGGAGTGACAGTCACAGCACGGAGACAGGATCTCAGTATCCCCCCCCCATACAACAAAGGAGAGGAATTTGCCGAGGGAGAGAGATCTTTCCGCAGGATTTACAACGCCTTTAGGTGTGAAACTGCTCCGCTCGTAGCCCCTGGGGACATTGGTCACCTAAGCGATTTGCCACCAGGAAGCAGGACACCGGCTGCCATCAGTCACAGCCGCTGAGAAGAGATGGTGCAGAAGTACCAGTCGCCGGTGCGGGTCTACAAGTACCCCTTTGAGTTGGTCATGGCGGCCTACGAGAAGCGCTTCCCCACCTGCCCCCAGATCCCGGTGTTCCTGGGCAGCGACATCCTGCAGGAGCACAAGAGCGAGGACGGGGCACTTCACGTGGTGGAACGCAGCTGCAAACTCAACGTGGACGCGCCGCGACTCCTGAAAAAAATCGCGGGGGTCGAATTTGTCTACTTCATTCAGAAGAACACTGTGAACTGGAAAGATCGGACGCTGCTGATCGAGGCTCACAACGAGACCTTCTCCAGCCGTGTGTTAGTGAACGAGACCTGCAGTTACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGG
  5   1   2       bld Lun1      in                         CABD2954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACTCAGTTCACCCAGAAAATGAGGAATGGACATGCTTCGAGCAGACTGCGTCTCTGGACATCAAGTCGTTCTTTGGCTTTGAGAGCACGGTGGAGAAGATCGCAATGAAGCAGTACACCGCCAACATCAAGAGGGGTAAGGAAGTCATCGAATTTTACTTGAACGAGCTCATATCCCAAGGCATCACCCACCTTCCCAAATGGACACCCGGGGTCCCAGCTGGCTGGCACCCCCTGCAGGCCTTCAGAAGTGGTATTCCCCGCAGCAACCAGGCCGAGCAAACAGCCTCTCAGGGACCATGTAAAGCAGACGCGGGGAGCCACAGCTTGGCCGCAGAGCCATCCACTCCTGACACTGATAAACTAGAAGCCGACTACATAGAACGCTACCTCGGGCAGCTTACGCCAATGCAGGAGAGCGCCCTTATCCACCTGCGCCAGTGGCTGCAAGAGACGCACAAAGGCAAGATCCCAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGCCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTACAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGCGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGCGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTGAAGGTCTCACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTAT
  5   1   2      ests                                 Xt7.1-CAAN6622.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGTCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTCCAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGTGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGAGCGCCCCACGAGATCATGTTGAGTCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAAACACTTTAACCAAAGAAGTGTATGGAATTTTTCTTCCACCTCAGAAATGTACTGAACAATTAGAATTCAATAGGAGACCCCCTTATATGAGAATGTCTTGTAGAACCTTTCTAACGCCTCTTGTAGAGGTTCCCTGTATGGACTGAGGTGAGTCGCACTGTTGGGTGGGCTTCACTGATAATTAACCTACAGGATGGGATGGGGGGGCTGGTCACATGACAGGGCTTACGCCACTGTTTATTTCTCAAGTGACTGTAGACATCACAATGCACCTCACTGCACTGCCTTATTTATTGGGTGGCACGTACCTCTAGGGCCCCAATGCTCATTTAAAGGAGAAGGAAAGGTACAATCACTTTGGGGGGCTAACATCTTGGCAGTCATTTTACCTTTCCTTCTCCTTGAAGCCCCTTATAATGATATATATCTGTGCATGCTCAAGCCTCTGTAGGACACCTTGGCTCTCCGGCTGCCACAGAACTACAACTATCAACAGCTTTTCTGTAGCGGTGTTG
                                                  Xt7.1-CHK-1008227709                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGTCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTCCAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGTGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAxAxxxGAGCGCCCCACGAGATCATxTxxxxTCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAAxxxxTTTAACCAAAGAAGTGTATGGAATTTTTCTTCCACCTCAGAAATGTACTGAACAATTAGAATTCAATAGGAGACCCCCTTATATGAGAATGTCTTGTAGAACCTTTCTAACGCCTCTTGTAGAGGTTCCCTGTATGGACTGAGGTGAGTCGCACTGTTGGGTGGGCTTCACTGATAATTAACCTACAGGATGGGATGGGGGGGCTGGTCACATGACAGGGCTTACGCCACTGTTTATTTCTCAAGTGACTGTAGACATCACAATGCACCTCACTGCACTGCCTTATTTATTGGGTGGCACGTACCTCTAGGGCCCCAATGCTCATTTAAAGGAGAAGGAAAGGTACAATCACTTTGGGGGGCTAACATCTTGGCAGTCATTTTACCTTTCCTTCTCCTTGAAGCCCCTTATAATGATATATATCTGTGCATGCTCAAGCCTCTGTAGGACACCTTGGCTCTCCGGCTGCCACAGAACTACAACTATCAACAGCTTTTCTGTAGCGGTGTTGCCTGCA
  5   1   2       bld Te4       in                         CAAN6287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCCCTTATCCACCTGCGCCAGTGGCTGCAAGAGACGCACAAAGGCAAGATCCCAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGTCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTCCAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGTGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCCAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACG
  5   1   2       bld Te1                                 CBWN14051.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAAGACGAGCACATCCTGCGCTTCCTGCGGGCTCGCGATTTCAACATGGAGAAGGCCAGAGAGATGCTGTGCCAGTCCCTTTCCTGGCGCAAGCAGCACCAAGTGGATTACATCCTACAGACCTGGCAGCCGCCCCGTGTACTAGAGGAGTACTATGCCGGGGGTTGGCATTACCACGACAAGGATGGACGCCCACTGTATATTTTGCGCTTGGGACAGGTGGACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGCGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGGACTTGTCCCCAAGTCGCTGTACCATCTGACGAGGACGCAGAA
  5   1   2       bld Te5       in                         CAAO5402.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACACAAAGGGCTTGGTGAAAGCGCTCGGGGAGGAAGCCATCCTGCGGCATGTTCTATCCATTAATGAAGAAGGACAGAAACGCTGTGAGGAGAACACTCGTCAGTTTGGCCGCCCCATCTGGTCATGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGCGCCCCACGAGATCATTGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGNGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCA
  5   1   2       bld Te4       in                         CAAN6622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGACCTGCCTGGTGGATCTTGAAGGTCTCAACATGAGGCATCTCTGGAGGCCTGGAGTAAAAGCCTTGCTCAGGATTATAGAGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGCGCCCCACGAGATCATTGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGNGTCGACGATGTATTGGCGTCTCTGCAGGGCTCNAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCC
  5   1   2       bld Te5       in                         CAAO2223.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTTGTGGAGGCTAATTACCCAGAAACCTTAGGGAGGCTGCTGATTGTACGGGCCCCACGCGTGTTCCCTGTTCTCTGGACCCTGGTCAGTCCATTCATTAACGAGAACTCCAGGCAGAAATTCCTTATATACAGCGGCAACAACTACCAGGGGCCAGGGGGCATCGCAGACTATGTGGACAAAGAGATCGTCCCGGATTTCCTTGGGGGAGAGTGTGTGTGTAACATTCCCGAGGGAGGACTTGTCCCCAAGTCGCTGTACCAGTCTGACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGCGCCCCACGAGATCATTGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTC
  5   1   2       chi Te4                                  CAAN8709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGTGTTTATCTGGCTTTGTCGTGCACGGAGACGCCAAGGGTAGCCCCCCACTCAGATGCTCTGTTCCAATCCTGTTGGAAAGCAGCTTCGTTGGCGCTGGTTCTTCAGTCCCAGTAACACTAGACGCTCTTTTGTGCCATGAAGTGAGACAAGATGGCCGCCAGGGACCTTGTCATCTACAGTGAAAATAAGGCCAGCCATGAGCATATGGTCCATTAAACTAGGGGTGCCGACCCCCCAAATAAGTGTTTGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGA
  3   1   2       bld Lun1      in                         CABD2954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACGAGGACGCAGAAATGTCGGATCACATACGGCTCTGGACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGCGCCCCACGAGATCATTGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTGTTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTCACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCAGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4       in                         CAAN3244.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACAGAGACGATTTACCAGTCATCCTGTGTGTGGAAAGGAGCGCCCCACGAGATCATTGTGAGATCCTGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCNTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN2611.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGAGACGATTTACCAGTCATCCTGTGTGTGAAAGGAGCGCCCCACGAGATCATGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4       in                         CAAN6622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAGAGACGATTTACCAGTCATCCTGTGTGTGAAAGGAGCGCCNCACGAGATCATGTTGAGATCCTGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN9302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAGAGACGATTTACCAGTCATCCTGTGTGTGAAAGGAGCGCCCCACGAGATCATGTTGAGATCCTGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTCACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTTGGGGGTCGGCACCCCTAGTTTTATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te3  5g3  in                        CAAM14004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGAGACGATTTACCAGTCATCCTGTGTGTGAAAGGAGCGCCCACGAGATCATGTTGAGATCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN9243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAGACGATTTACCAGTCATCCTGTGTGTGAAAGGAGCGCCCCACGAGATCATGTTGAGATCCTGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTAGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te5       in                         CAAO2223.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGAGACGATTTACCAGTCATCCTGTGTGTGAAAGGAGCGCCCCACGAGATCATTGTGAGATCCTGGAGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN7642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGACGATTTACCAGTCATCCTGTGTGTGAAAGGAGCGCCCCACGAGATCATGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te5  5g3  in                         CAAO6334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGAGCGCCCCACGAGATCATGTTGAGATCCTGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  FL   in                        CAAN12511.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCGCCCCACGAGATCATTGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te5       in                         CAAO7206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGCGCCCCACGAGATCATGTTGAGATCCGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTCACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTTGGGGGTCGGCACCCCTAGTTTTATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN1446.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGATCATTGTTGAGATCCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCATCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN2853.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGATCATGTTGAGATCCTGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN7406.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGATCATTGTGAGATCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN7354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGATCATTGTGAGATCTGGAGGAGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTNCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCNCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2      seed Te4  5g3  in                         CAAN9618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGAGTCGGTGATCACATGGGACTTTGACATCCTGCGTGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te5       in                         CAAO5402.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4       in                         CAAN6287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN8373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCNCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4       in                         CAAN1985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATGTTATTTTCAGCCTCTTTCACTCCAAGCGAGCCCCAGATACGCGGCAGAGGGAGTTGGCCCTAGCGGCCGGTAACGCCCCGTCCAGCAACGTGCAGCTGATTGACAAGAGCTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                        CAAN10355.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGACCCTGGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGGTGGCCTGGGATCTACATCGTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCTCAAGTGCAAACTTATGTATTAGCTTTGAGGTTCTGGCCTCGGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTGTCTCAGCTCAGCGGAGTAGCCAACACCTCGAGCAAGTCTCACAGCAGCTGCGTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGATCATGGCTGGCCTTATTTTCACTGTAGATGTCAAGGTCCCTGGAGGGCTTCTTGTCTCACTGCATGGCACAAAAGAGCGTC
  3   1   2       bld Te4  5g3  in                         CAAN8515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTGTCGATTACAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTCTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCAGCCTGGAGTCCTGTAGCGGCTTCTCTCAGCTCAGCGGAGTAACCAACACCTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCGGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACC
  3   1   2       bld Te4  5g3  in                         CAAN1788.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCAGAGTTCAGGCCCCTTTAGTGTGCAGAGAAGGGGAAAGCATTCAGGGCTCACACGTCACTCGCTGGCCTGGGATCTACATCCTGCAGTGGAAGATGCACAGTTCTGCCTCTGGCTCCAGTATGGCTCGGGTCGACGATGTATTGGCGTTTCTGCAGGGCTCAAGCCACAAGTGCAAACTTATGTATTACTTTGAGGTTCTGGCCTCCGAAGATTTCAGGGGTTCCATGTCCACCCTGGAGTCCTGTAGGGGTTTTTTTCAGTTCAGGGGAGTCACCAACACCTGGAGCAAGTTTCACAGCAGTTCCTTCATTTCCAGATAACAAACACTTTTTTTGGGGGTCGGCCCCCCTAGTTTTATGGACCATATGCTCATGGCTGGCCTTATTTTCCCTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCAGGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCCCCAAGGAAGCTGCTTTCCAACAGGATTGGAACAGAGCTTCTGAGGGGGGGGCTACCCTGGGGGTCTCCGTGCAGGACAAACCCAGATAACCCCTTTACCC
  3  -1   2       chi Kid1      in                        CABA10684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGGCGAGAGGTCGAGCAAGTCTCACAGCAGCTCCCTCATCTCCAGATAACAAACACTTATTTGGGGGGTCAGCACCCCTAGTTTAATGGACCATATGCTCATGGCTGGCCTTATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACCAAAGAAGTGTATGGAATTTTTCTTCCACCTCAGAAATGTACTGAACAATTAGAATTCAATAGGAGACCCCCTTATATGAGAATGTCTTGTAGAACCTTTCTAACGCCTCTTGTAGAGGTTCCCTGTATGGACTGAGGTGAGTCGCACTGTTGGGTGGGCTTCACTGATAATTAACCTACAGGATGGGATGGGGGGGCTGGTCACATGACAGGGCTTACGCCACTGTTTATTTCTCAAGTGACTGTAGACATCACAATGCACCTCACTGCACTGCCTTATTTATTGGGTGGCACGTACCTCTAGGGCCCCAATGCTCATTTAAAGGAGAAGGAAAGGTACAATCACTTTGGGGGGCTAACATCTTGGCAGTCATTTTACCTTTCCTTCTCCTTGAAGCCCCTTATAATGATATATATCTGTGCATGCTCAAGCCTCTGTAGGACACCTTGGCTCTCCGGCTGCCACAGAACTACAACTATCAACAGCTTTTCTGTAGCGGTGTTGCCTGCAA
  5  -1   2       chi Kid1      in                        CABA10684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTTCACTGTAGATGACAAGGTCCCTGGCGGCCATCTTGTCTCACTTCATGGCACAAAAGAGCGTCTAGTGTTACTGGGACTGAAGAACCAGCGCCAACGAAGCTGCTTTCCAACAGGATTGGAACAGAGCATCTGAGTGGGGGGGCTACCCTTGGCGTCTCCGTGCAGGACAAAGCCAGATAAACACTTTAACCAAAGAAGTGTATGGAATTTTTCTTCCACCTCAGAAATGTACTGAACAATTAGAATTCAATAGGAGACCCCCTTATATGAGAATGTCTTGTAGAACCTTTCTAACGCCTCTTGTAGAGGTTCCCTGTATGGACTGAGGTGAGTCGCACTGTTGGGTGGGCTTCACTGATAATTAACCTACAGGATGGGATGGGGGGGCTGGTCACATGACAGGGCTTACGCCACTGTTTATTTCTCAAGTGACTGTAGACATCACAATGCACCTCACTGCACTGCCTTATTTATTGGGTGGCACGTACCTCTAGGGCCCCAATGCTCATTTAAAGGAGAAGGAAAGGTACAATCACTTTGGGGGGCTAACATCTTGGCAGTCATTTTACCTTTCCTTCTCCTTGAAGCCCCTTATAATGATATATATCTGTGCATGCTCAAGCCTCTGTAGGACACCTTGGCTCTCCGGCTGCCACAGAACTACAACTATCAACAGCTTTTCTGTAGCGGTGTTGCCTGCAAGGGCCGGAACATGTCGATCTAGAACCCCATGACCTATCCTGCTCTCTCTGACCTGGGGCAGGCACTAGTGTTGGTCTGATACCTACATACCTACGATCCCTACATCCTTCTAGAGAATGTAGTCATTAGTGCATTTGCTTAAAG
  5   1   0       add Te4       out                        CAAN1688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCTGTAGCGGTGTTGCCTGCAAGGGCCGGAACATGTCGATCTAGAACCCCATGACCTATCCTGCTCTCTCTGACCTGGGGCAGGCACTAGTGTTGGTCTGATACCTACATACCTACGATCCCTACATCCTTCTAGAGAATGTAGTCATTAGTGCATTTGCTTAAAGCCTAAGGAGAACCTAACCTCTTTCCTAATGCCAGACTGCACGTTTTCTGGGCCGTTCATTCACGTTTCCGCATTTCCGTTATGAAATCCAGGCAGTATTTTTAGCTGGCTGAGCAGGAGCAGTCTGTCGGGACCAGGTCCGGTTTCCTGACCAGGGTAGGAGAGCAGCCCACAAGCTGAAAGCTGAGTGTCTGTAAGAGGCAGCTTGGCTGCACTAACCAATGGTGCTCTGCTGCTAATAATTCTCTATATGATATATATTTGTGTATGCTTCAATATACTCTTAGGTTAGCTTTTATTATAAACCTTTAATATCAAATAGGGGTGCTCCAGGCTATGGGTGTTTGTATCATACGCCTACAAAGGGATCATCTATTAACTCCCCATTGCAATGATGCAGTTGGTGGGTGGCTCACCCTAACTGAGGTGGCTCCCCTCTCTGGTGAGGAAAAGGCTACACAAACCAGCGTAAACACAACAATTGCCCGGCTACAGGTGGCTACTGAGGCGACCTATGCCACTAGCAGTCGGGGTACTCGGGCCTGAACCACTTTAGTCCCAGTACTGACCTGAATGTAGACTAGGATGCCTCTCTGTGTTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)