Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas143i09.3.5                       61 END     1           1        1                novel protein similar to mouse ADP-ribosylation factor-like 12 Arl12 [Xenopus tropicalis]
     2   0.0    0Xt7.1-st29j03.3                             3 END     1           1       33                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012153917 Xt7.1-TNeu095k24.3.5 - 66 ESTs
                                                                       .-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu095k24.3.5                                                                                                                          TTTCCCCTCTCTCCTACTGAGCGGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCCCGGGGAGAGCGGGGAAGGGGAAGGCGGGGAGAGGGTTCATGGAGCCGGGGGTTGCTGCCTGGGCAAATCGGCGAATAAGGTACCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTGGGAATGTTGGCGGCCGAGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTGTTGGCAAAGAGTCTATGATCTACCTCAAGGGAACGGGTCGTTTTTTGATTTTTGAGAATCGGACAATAAAAGTCAGTTGGTGCAGAAGGTCCGCAGCAAAATCGGATACGGGATCCAGCTGACCAAGGAGGTCGACGGCGTGTGGGTCTATAACCGCAGCAGTTACCCCATCTTCATCAAGTCTGCCACACTGGACAACCCGGACTCTAGGACGTTATTGGTCCACAAAGTGTTCCCTGGATTTTCCATCAAAGCGTTTGACTTTCATTAAGAATTCTGCCNGGAGGGACCCAATGACCACGAGTTCATGCAGCAACCATGGACCGGATTTACTGTACAGATAAGCTTTGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTCATCAGCAGTTGCCCGTGCTGGCTGGAGGTGATATTCAATAACCGGTGACTCGGAGACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCATGCGGACTCGCTCTTTCTTTTGTTTTTACGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAATAACAAAATGCCAAATTAAAAAAACAAACAAACA
                                                  Xt7.1-CHK-1008265433                                                                                                                                CTCTCTCCTACTGAGCGGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCCCGGGGAGAGCGGGGAAGGGGAAGGCGGGGAGAGGGTTCATGGAGCCGGGGGTTGCTGCCTGGGCAAATCGGCGAATAAGGTACCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTxGxAATGTTxGxxxxCGAGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTxxxxGxAAAGAGTxxAxxATCTACCTCAAGGGAACGGxTxxTTTTTTGATTTTTxxxAxTCGGACAATAAAAGTCAGTTGGTGCAGAAGGTCCGCAGCAAAATxxxxxxxxxxxTCCAGCTGACCAAGGAGGTCGACGGCGTGTGGGTCTATAACCGCAGCAGTTACCCCATCTTCATCAAGTCTGCCACACTGGACAACCCGGACTCTAGGACGTTATTGGTCCACAAAGTGTTCCCTGGATTTTCCATCAAAGCGTTTGACTxxxAxxAAGAATTCTGCCTGxAGxGACCCAATGACCACGAGTTCATGCAGCAACCATGGACCGGATTTACTGTACAGATAAGCTTTGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTCATCAGCAGTTGCCCGTGCTGGCTGGAGGTGATATTCAATAACCGGTGACTCGGAGACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCATGCGGACTCGCTCTTTxxTTTGTTTTTACGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAAxAAxAAAATGCCAAATAAAAAAAACAAA
                                                      consensus depths                                                                                                                               2     3     2     3     3     4     4     5     5     5     6     7     5     7     5     7     5     7     5     7     4     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     6     8     7     8     7     8     7     8     6     8     6     8     6     8     6     7     6     7     5     7     6     7     6     7     6     7     5     7     5     7     6     7     5     7     6     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     2     2     1     1     1     1     1     1     1     1     2     2     2     2     2     3     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     6     6     6     6     6     5     6     6     6     6     6     5     6     6     6     6     6     5     6     3     7     3     7     3     7     3     7     2     6     2     6     2     6     2     6     2     6     2     6     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     4     2     3     2     3     1     2     1     2     1     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     3     3     4     4     4     4     4     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     4     4     4     4     6     6     7     7     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    14    15    13    14    13    14    13    14    13    14    13    15    14    15    12    15    12    14    12    13     8    13    11    13     8    12     8    11     8    11     9    12     9    12     9    11     9    11     9    11     9    11     9    11     9    11    10    14    13    18    14    19    18    21    18    21    18    21    18    21    18    21    18    21    19    22    19    22    18    21    18    22    18    22    18    21    20    23    20    23    21    24    20    24    20    24    20    24    20    24    20    24    24    27    25    28    27    30    27    31    29    32    29    32    27    30    28    31    28    31    28    31    29    34    28    32    28    32    30    32    31    33    31    33    31    34    31    34    28    33    30    33    29    33    28    33    29    33    29    33    29    33    29    33    26    32    27    32    27    32    27    32    27    32    27    32    27    32    27    32    27    32    27    32    30    32    26    32    26    32    24    30    24    29    22    29    16    23    18    22    10    17     9    16     9    16     9    16     9    16     9    16     9    15     9    15     9    15     9    15     9    15     9    15     9    15     9    14     8    13     2     7     3     7     2     4
  5   1   2      ests                                 Xt7.1-ANBT2349.5                                                                                                                          TTTCCCCTCTCTCCTACTGAGCGGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCCCGGGGAGAGCGGGGAAGGGGAAGGCGGGGAGAGGGTTCATGGAGCCGGGGGTTGCTGCCTGGGCAAATCGGCGAATAAGGTACCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTGGGAATGTTGGCGGCGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTCCCGTTGGCAAAGAGTGGAAATAATATTTGGGGGCAGGGGGTCGTTTTTTGATTTTTGAGAATATTGGTACATTCGTCAGTTGGTGCTGGGTGCAGTTGGCACTTTTATTAGGTAACATAGCCTTTTAGTGCGACGAGTGAGGCTCTATAACGCAGGATGGCGCAGATTTTAATTGGCCCGTTATGGGGAAGCNGGCTNTCATCTATGGGGGGTGGGGGGAAAGGAAAAATTAAAAGCNGAAA
  5   1   2      ests                               Xt7.1-TNeu095k24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTACGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAATAACAAAATGCCAAATTAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T--
                                               BLH ATG     614    1275                                                                                                                          
                                               BLH MIN     614     144                                                                                                                          
                                               BLH MPR     140     144                                                                                                                          
                                               BLH OVR     614     477                                                                                                                          
                                               ORF LNG     614      21                                                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 6e-022     NP_498493.1 SMAll body size SMA-3, dwarfin family member SMA-3 (44.5 kD) (sma-3)[Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 1e-022     CAL49422.1 smad2 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 7e-028     NP_477260.1 CG5201-PA, isoform A [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 4e-045     BAE06694.1 Smad6/7 [Ciona intestinalis] -=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 3e-073     XP_798238.2 PREDICTED: similar to inhibitory protein SMAD6 [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Gg ==== 2e-090     NP_989579.1 MAD, mothers against decapentaplegic homolog 6 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 4e-158     NP_778257.2 MAD, mothers against decapentaplegic homolog 7 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 3e-167     NP_001036125.1 MAD homolog 7 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 3e-169     NP_005895.1 MAD, mothers against decapentaplegic homolog 7; MAD (mothers againstdecapentaplegic, Drosophila) homolog 7; Mothers against decapentaplegic,drosophila, homolog of, 7 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAC17489.1 Mad-related protein Smad7 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 0          NP_001081017.1 MAD, mothers against decapentaplegic homolog 7 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu095k24.3.5                                                                                                                                           TGA---------TAA------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAAATG---------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------TGA------------------------TAG---ATG------------------------------TAA------------------------------------------------TAG------------------------------------------------------------------------------TGA------------------------------------------------------TGA------------TAG---------TAA---------------TAG---------TAAATG------------------TAG---------TGA---TGATAATAATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------TGA------------------------------------------------------TAA---------ATG------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------ATG---------------------------------------------------------------------------------------------TGA------------------ATG------TAA------------------------------------TGA------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------TGA------------------------------------------TAA------------------------------------------------------------------------------------TAA---TAG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------TAA---TAA---------------------------------------------TAA------------------ATG---------TAA------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                  ...
  5   1   2      ests                                 Xt7.1-ANBT2349.5                                                                                                                          TTTCCCCTCTCTCCTACTGAGCGGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCCCGGGGAGAGCGGGGAAGGGGAAGGCGGGGAGAGGGTTCATGGAGCCGGGGGTTGCTGCCTGGGCAAATCGGCGAATAAGGTACCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTGGGAATGTTGGCGGCGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTCCCGTTGGCAAAGAGTGGAAATAATATTTGGGGGCAGGGGGTCGTTTTTTGATTTTTGAGAATATTGGTACATTCGTCAGTTGGTGCTGGGTGCAGTTGGCACTTTTATTAGGTAACATAGCCTTTTAGTGCGACGAGTGAGGCTCTATAACGCAGGATGGCGCAGATTTTAATTGGCCCGTTATGGGGAAGCNGGCTNTCATCTATGGGGGGTGGGGGGAAAGGAAAAATTAAAAGCNGAAA
                                                  Xt7.1-CHK-1008232891                                                                                                                                CTCTCTCCTACTGAGCGGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCCCGGGGAGAGCGGGGAAGGGGAAGGCGGGGAGAGGGTTCATGGAGCCGGGGGTTGCTGCCTGGGCAAATCGGCGAATAAGGTACCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTxGxAATGTTxxxxGxGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTCCCxxxxxxAAAGAGTGGAAATAATATTTGGGGGCAGGGGGTCGTTTTTTGATTTTTGAGAATATTGGTACATTCxxxAGxTGGTGCxGxxxGCAGTTGGCACTTTTATTAGGTAACATAGCCTTTTAGTGCGACGAGTGAGGCTCTATAACGCAGGATGGCGCAGxTxxxxxxTxxCCCGTTATGGGGxxxCAxxxxAxxATCTATGGGGGGTGGGGGGAAAGGAAAAATTAAAAG
  5   1   2       add Gas       in                   TGas097n13.p1kSP6 TCGCCGTGTCTCCGCTGTGCGGCCGGTCCCTCCTCCTCTCCCCCCCCCCTCTCCCATCGCACATTTCCATAACACAGACGGGGCGGATCAGCCCTTTGAGAAGAGGAAAGACAGTCCACTTTATTTTTTTCCCTCTCTCTACTGAGCGCCGGATAAGGATTTTCTTGTGGATTAACAAGCGAGAGGCGCACCCCAGGCTCTACTTCTTTACTGGACCGCATCGCGTACGGATATCTATAAGGTCTGCCGCCCTAGTGCCCCTACTCTCTGCCATTTGCCCCCCCATACACAAGGGGATATTATCGGGCAGACCCCGCTCGTTTTGTGGATGTACGAGTTGTGGGGGGGACCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCGCCCAAGCCGGGCAGCGCTCTGTGCTCCCATTCATGCCCCGCTGCT
  5   1   2   14  bld Brn3 5g3  in                         CAAK2428.5p .................................................ACATTTCCATAACACAGACGGGGGCGGATCAGCCCTTTGAGAAGGAGGAAAAGACAAGTCCCACTTTATTTTTTTCCCCTCTCTCCTACTGAGCGGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCCCGGGG
  3  -1   2       bld Tail                                 CBSW4229.g1                                                                                                          TTTTTTTTTTTTTTTTTTTCCCCTCTCTCCTACTGAGCGGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCC
  5   1   2       add Neu                            TNeu136f02.p1cSP6                                                                                                                                                GGCCGGATAAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTGCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGGGGTGGGGGGAGCCCCTTTCCTACCGGGAGGAGTGTGTATAAATGCCCTTTAGATCCCAAGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTACCCCCTGTATGTGTAGCCGGGGCGGTGGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAA
  5   1   2       bld Gas8      in                          st58g02.5p                                                                                                                                                       ATAAGGATTTTTCTTGTGGATTAAACAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCGCGTACGGATTATCTATAAGGTTCTGCCGCCCTAGTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGCTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCC
  5   1   2       add Gas8      in                          st59g02.5p                                                                                                                                                                                CAAGCGAGAGGCGCAACCCAGGGCTTCTACTTCTTTACTGGAACCGCATCNCGTACGGATTATCTATAANGTTCTGCCGCCCTANTGCCCCTACTCTCTGNCCATTTGNCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCNTACCGGGAGGATTGTGTANAAATGCCCTTTANATCCCAGGNCAAGCCGGGCAGCGCTCTGTGCTCCATTCAANGCCCCGCTGCTCCNGGCTCGGCTGCCCANCATTAGCCCGNTGTATGTGTAGCCGGGGCGGCTGCTTGCCGTTTGCNGTATTCCTGNCNCTGCGANTCGGATCCNCCCGCCNCACTTTGCAGGATCNCTTCCCCTAA
  3  -1   2       add Gas8                                  st87p24.3p                                                                                                                                                                                GCGAGAGGCGCAACCCAGGGACTTCTACTTCTTTACTGGAACCGCATCNCGTACGGATTATCATATAAGGTTCTGCCGCCNTAGCTGCCCCTACTCTCTGCCCATTTGCCCCCCATACACAAGGGATATTATCGGCAGACCCGCTCGTTTGTGGATGTACGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGNAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGNATTAGCCCGCTGTATGTGTAGCCGGGGCGGCTGCTTGCCGTTTGCANTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCANTTTGNAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCNCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATNCAGGATTCTTCATGATTTGCGGGCGTCATGCACGNTGTTTAACCGGGAAGNCTTGCTCTCGTCNCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGA
  5   1   2   14 seed Gas6 5g3  in                         ANBT2349.5p .............................................................................................................................................................................................................................................................................................................................................CCGAGTTGTGGGGGGAGCCCGCTTTCCTACCGGGAGGATTGTGTATAAATGCCCTTTAGATCCCAGGCCAAGCCGGGCAGCGCTCTGTGCTCCATTCAATGCCCCGCTGCTCCCGGCTCGGCTGCCCAGCATTAGCCCGCTGTATGTGTAGCCGGGGCGGTTGCTTGCCGTTTGCAGTATTCCTGTCGCTGCGACTCGGATCCCCCCGCCGCACTTTGCAGGATCTCTTCCCCTAAAAGACTGGCGCATGTTCCAGATCGCTTTGGCTTGTCGGACCCCCAGCTCCCCCCTACCCTCCCGGGCTGCTGCTGCTGGTCTCTGCCCGGCCTCGGATCCAGGATTCTTCATGATTTGCGGGCGTCATGCACGTTGTTTAGCCGGGAAGCCTTGCTCTCGTCCCGCATGTTCAGGACCAAACGATCGGTGCTCGTCCGGCGACTCTGGAGGAGCCGAGCTCCCGGGGAGAGCGGGGAAGGGGAAGGCGGGGAGAGGGTTCATGGAGCCGGGGGTTGCTGCCTGGGCAAATCGGCGAATAAGGTACCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTG
  5   1   2      skin Gas7 PIPE in                         XZG28457.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGAGCCGGGGGTTGCTGCCTGGGCAAATCGGCGAATAAGGTGCCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTA
  5   1   2       bld Neu       in                   TNeu095k24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCGAATAAGGTACCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTGGGAAGAGAAAACGAGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTCCCTGGATATCTTCTATGATCTA
  3  -1   2       bld Ovi1      in                         CABI2503.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCGCCCGGGAAGGCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCTCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTGGGAAGAGAAAACGAGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTCCCTGGATATCTTCTATGATCTACCTCAAGGGAACGGCTTCTGCCTTGGGCAGTTGAACTCGGACAATAAAAGTCAGTTGGTGCAGAAGGTCCGCAGCAAAATCGGATACGGGATCCAGCTGACCAAGGAGGTCGACGGCGTGTGGGTCTATAACCGCAGCAGTTACCCCATCTTCATCAAGTCTGCCACACTGGACAACCCGGACTCTAGGACGTTATTGGTCCACAAAGTGTTCCCGGGATTTTCCATCCAAGCGTTTGACTA
  3  -1   2       bld Ovi1      in                         CABI4922.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGAGAGGCCGCTGGGGGGCTCGGAGGCTGCAGAACTGAAAGCCCTCGCCCACTCCGTGCTGAAGAAGCTGAAGGAGAAGCAGCTGGAGGGGCTGCTGCAGGCGGTGGAGTGTAAAGGGGGAGCCCGCAGCCCCTGCCTGTTGCTGCCGGCGGCCAAGCTGGACTCCAGGCTGGGGCAGCAGCCCTTCTCCCTGCCGCTGCTGCTCTGCAAGGTCTTCAGGTGGCCGGACCTCAGGCACTCGTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTCTGCTGCAACCCGCACCATCTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCCCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTGGGAAGAGAAAACGAGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTCCCTGGATATCTTCTATGATCTACCTCAAGGGAACGGCTTCTGCCTTGGGCAGTTGAACTCGGACAATAAAAGTCAGTTGGTGCAGAAGGTCCGCAGCAAAATCGGATACGGGATCCAGCTGACCAAGGAGGTCGACGGCGTGTGGGTCTATAACCGCAGCAGTTACCCCATCTTCATCAAGTCTGCCACACTGGACAACCCGGACTCTAGGACGTTATTGGTCCACAAAGTGTTCCCTGGATTTTCCATCAAAGCGTTTGACTA
  3   1   2       bld Gas8      in                          st58g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCGAGGTCAAACGACTTAGTTGCTGCGATTCCTATGGCAAGAACAACCCGGAGCTGGTNTGCTGCAACCCGCACCATNTCAGCAGGCTGTGCGAACTAGAATCTCCCCCACCTCCCTACACCAGATACCCCATGGACTTTCTCAAACCGACTGCGGATTCTCCAGACTCTGTCCCTTCCTCCACAGAAACAGGGGGAACAAATTTTTTGGCCCCTGAGGGGCTTTCAGGTAAGAGCAATGGTTAATGCTGATTTTTGGTATTTATTATTATGTAGCATGTGTATTAGTAATGTTGGCGGCTCCNCAACAGATGTAGCCTGATTGTATAGGAATGTTGTTGGCAAAGAGTGGAAATAATATTTGGGGGCAGGGGGTCGTTTTTTGATTTTTGAGAATATTGGTACATTCAAAAGCNTTTTCTGGGTGCAGTTGGCACTTTTATTAGGTAACATAGCNTTTTAGTGCGACGAGTGAGGCTCTATAACGCAGGATGGCGCAGATNTTAATTGGCCCGTTATGGGGAAGCNGGCTNTCATCTATGGGGGGTGGGGGGAAAGGAAAAATTAAAAGCNGAAATGCTCNGTAAATTCTTCCCGAGTCTTCATTAAGAATTCTGCCNGGAGGCNCCAGCNGTCTGTATAATTTCACTTCCAGATGTCATCGGCT
  3   1   2       add Gas8      in                          st59g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTGCGAACTAGAATCTCCCCCACCTNCCTNCACCAGATACCCCATGGACTTTCTCAAACCGNNTGCGGATTCTCCAGACTCTGTCCCTTCCTCCNCNGNAACNGGGGGAACNAATTTTTTNGCCCCTGAGGGGCTTTCNNGTAAGAGCAANGGTTAATGCTGANTNTTGGTATTTATTNTTANGTAGCANGNGTATTAGTAATGTTGGCGGCTCCNCAACAGANGNAGCCNGATTGTATAGGAATGNTGTTGGCAAAGAGTGGAAATAATNTTTGGGGGCNGGGGGTCGTTTTTTGATTTTTGAGAATANTGGTACATTCAAAANCNTTTTNTGGGTGCNGTTGGCNCTTTTATTAGGTAACATAGCCTTTTAGTGCGNCGNNTGAGGCTNTATAACNCAGGATGGCGCAGATTTTAANTGNCCCGTTATGGGGAAGCNGGCTNTCATCTATGGGGGGTGGGGGGAAAGGAAAAATTAAAAGCNGAAATGCNCNGTAAATTCNTCCCGAGTNTTCNTTAAGAATTNAGCCCGGAGGC
  5   1   2      ests                               Xt7.1-TNeu095k24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTACGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAATAACAAAATGCCAAATTAAAAAAA
                                                  Xt7.1-CHK-1008225516                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAAxAAxAxAATGCCAAATTAAAAAAACAAACA
  5   1   2       bld Tail      in                         CBSW3512.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGCTTTCAGATTCCCAACTTCTTCACGAGACTGGGGACCCGTCCCACTGGTGCGTGGTGGCGTATTGGGAAGAGAAAACGAGGGTGGGTCGCTTATACTCTGTCCAAGAGCCCTCCCTGGATATCTTCTATGATCTACCTCAAGGGAACGGCTTCTGCCTTGGGCAGTTGAACTCGGACAATAAAAGTCAGTTGGTGCAGAAGGTCCGCAGCAAAATCGGATACGGGATCCAGCTGACCAAGGAGGTCGACGGCGTGTGGGTCTATAACCGCAGCAGTTACCCCATCTTCATCAAGTCTGCCACACTGGACAACCCGGACTCTAGGACGTTATTGGTCCACAAAGTGTTCCCTGGATTTTCCATCAAAGCGTTTGACTACGAGAAGGCTTACAGTTTGCAGAGACCCAATGACCACGAGTTCATGCAGCAACCATGGACCGGATTTACTGTACAGATAAGCTTTGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTCATCAGCAGTTGCCCGTGCTGGCTGGAGGTGATATTCAATAACCGGTGACTCGGAGACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCATGCGGACTCGCTCTTTCTTTGTTTTTACGTCATTTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAA
  5   1   2       bld Gas7      in                         XZG65759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCATGCGGACTCGCTCTTTCTTTGTTTTTACGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGA
  5   1   2       bld Gas7                                  XZG8231.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGCGGACTCGCTCTTTCTTTGTTTTTCGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTT
  5   1   2       bld Liv1                                CAAR11918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTCTTTGTTTTTACGTCATTTTTTTTTTTTGTTGTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGTCCCCGGGTAGGGGATGGGTGTTTGGGCAATGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAACTGCCATTCTG
  5   1   2       bld Tad5                                 XZT27987.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTGTCGTCGTTCGTTTTGAGAAATAGCTTATGTCAAGAATGACCTTTTCCCTGTTCTATTCTTTACCCGAGTGAATGACTTCCGGCCAAGCTTGCCCCCGGGTAGGGGATGGGTGTTTGGGCAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAA
  5   1   2       bld Neu       in                   TNeu062b13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACGCGTGGAGTGTGCTTGTAATGTTTTTTTTTGGGGGGGGGGAAATCGACCGCTTTCTTGTGCAATGAGTAGACAATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGAC
  5   1   2       bld TbA       in                   TTbA041l23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTAGACATATTTTTGTGGGGGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCATGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAAACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGT
  5   1   2       bld TbA       in                   TTbA032l05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATATTTTTGTGGGGGAGGGGGCCGAGTGATGCACAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTACAGCAACATCTAACGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTATGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGAGGAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAGACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTAAACCCTTTTTTTTTCTTTTTGCCCCTAACATAAAATAATCCAATGTATTGGGTCAGGACATGAGGTTTGTTGTTTTAAACAAACCATTA
  3  -1   2       bld Hrt1      in                          CAAQ457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAGGGGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTG
  5   1   2       bld Gas7      in                         XZG62191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGCCGAGTGATGCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTA
  5   1   2       bld Tbd1      in                         CBXT7083.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCCCCACCCCTTTTTTTTTCCTTT
  5   1   2       bld Liv1      in                         CAAR7978.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAATTAAGTTCAGTATTTTGTCATTTTATTTTTGCATATGGGTGACCACTGCTTACACCTCACGTCTCTTCGTTTCTGCCCGGCACGCTTTATGGGGTATGAAGTGGGCGACTTTAGAGCAACATCTAAGGTGCTTTTATTGGTTAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATT
  5   1   2       bld Fat1      in                          CABC560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGTTGCAGGGATAAATGGATGCTGATGTTGTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGTAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAATTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGA
  5   1   2       bld Tad5      in                         XZT67438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTGCTTAGCAACAGCAGTGACAGTGATAATAATAAAGGCACCTTAGGCTGCTCCGCTACTGTTCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGTAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCCATACACCCCTGTTCCTTCGCTCCGGG
  5   1   2       bld Lun1      in                        CABD13006.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTGCTATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGAAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCCACAGGGCTA
  5   1   2       bld Gas7      in                         XZG23103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCTATAGCCAAACAAGCACTGCAGACTCTTCAGACCAATGTCTTTTATTCACGACTGGTAATTATACATTTCACACGGAACGCTCTCCGCCTCGACTCCCCCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGTAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCCTGCATGTGTATATTCTGTGAT
  5   1   2       bld Gas6      in                         ANBT1132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGACCCGACTGCTTTGAGGTGTAAACATTATTGCTTAGTCTGATTTGCAGTGATCTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCTCAACCCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGAAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTG
  5   1   2       bld Gas7      in                         XZG21782.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGTCATATGTCTCTATCAAGACCAAACCAAAAAAAAAACTGCCATTCTGATACCTGACTCCCCCCCCCCCCCCTCAAACCTTTTTTTTTCTTTTTGCCCCTAAAATAAAATAATCCAATGTATTGGGTCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGTAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGGGTATATTCTGGGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTG
  3   1   2      seed Neu       in                    TNeu095k24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAGGACATGTGGTTTGTTGTTTTAAACAGACCATTACAAGATAACTGCCCAACTCCGTGTTATTTCAGTCCCCTTAGTGGAAAGGGTTAACACATTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGAAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Ovi1      in                         CABI9480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATATAGGGCGAGAGGCGGCCGCCTAGGCCTCCAGTTTTTTTTTTTTTTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAGAAAAC
  5  -1   2       bld Ovi1      in                         CABI9480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCGCCTAGGCCTCCAGTTTTTTTTTTTTTTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCG
  5   1   2       bld Gas       in                   TGas051e12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATTTATTTATATTTTTTATTTTCTTGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCA
  3   1   2       bld Gas6      in                         ANBT1132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTATTTATATTTTTATTTTCTGGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGAAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCG
  3   1   2       bld TbA       in                    TTbA041l23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTTATATTTTTTATTTTCTTGCANGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTTTCGTTCATTTCTTTTTAATATCATACAATGGAGTGGGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTTAAAAAC
  5   1   2       chi HdA                           THdA038o07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACCTCATCAGTGTAACAGTATTAAGGGCTGATAAAAACCTACATGTACTAAAGGTCAAAAATGTTTGTTTTCCTGTTTTTTTTTTGTGATTTTAAGCTTGGGCTAAAGAAAAAATAGCCTTGTGGCCTCCAGACTAAGTCGGCAGCTTATTGACCTATGCATGGGGCCTTCTCACCTGATATCTGGCCAACGGCAGAATTCCTTCAGGCAAGGACTGCATCTGTGTTGATAAGGTCTCCTCCTGACCTTCTCCCTAAGCCTTTATTATGATCCAATCCTTAGTCTGGGGCCAAACGATCACATTCAAATTTGGCCCACAGCATCAGTGGTTAAATCAGATCCACTCATGGGGCGAGCTCACCGAATGAATATTAAAGTATATGCACAGCTGTAGGATTCCCTACAATTTTTGTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATNGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAA
  5   1   2       chi HdA                           THdA038o12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCTCATCAGTGTAACAGTATTAAGGCTGATAAAAACCTACATGTACTAAAGGTCAAAAATGTTTGTTTTCCTGTTTTTTTTTTGTGATTTTAAGCTTGGGCTAAAGAAAAAATAGCCTTGTGGCCTCCAGACTAAGTCGGCAGCTTATTGACCTATGCATGGGGCCTTCTCACCTGATATCTGGCCAACGGCAGAATTCCTTCAGGCAAGGACTGCATCTGTGTTGATAAGGTCTCCTCCTGACCTTCTCCCTAAGCCTTTATTATGATCCAATCCTTAGTCTGGGGCCAAACGATCACATTCAAATTTGGCCCACAGCATCAGTGGTTAAATCAGATCCACTCATGGGGCGAGCTCACCGAATGAATATTAAAGTATATGCACAGCTGTAGGATTCCCTACAATTTTTGTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAA
  5   1   2       bld TpA                            TTpA037o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTATTTTCTTGGCATGTGTATATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAANAACGAAAAANAAAAAGGACTCCTTAAAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTT
  3   1   2       chi Gas       in                    TGas097n13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCAAGAGCCCTCCCTGGATATCTTCTATGATCTACCTCAAGGGAACGGCTTCTGCCTTGGGCAGTTGAACTCGGACAATAAAAGTCAGTTGGTGCAGAAGGTCCGCAGCAAAATCGGATACGGGATCCAGCTGACCAAGGAGGTCGACGGCGTGTGGGTCTATAACCGCAGCAGTTACCCCATCTTCATCAAGTCTGCCACACTGGACAACCCGGACTCTAGGACGTTATTGGTCCACAAAGTGTTCCCTGGATTTTCCATCAAAGCGTTTGACTACGAGAAGGCTTACAGTTTGCAGAGACCCAATGACCACGAGTTCATGCAGCAACCATGGACCGGATTTACTGTACAGATAAGCTTTGTCAAAGGCTGGGGCCAATGTTACACGAGACAGTTCATCAGCAGTTGCCCGTGCTGGCTGGAGGTGATATTCAATAACCGGTGACTCGGAGACGAGCGGACATCTGGACTCTCAACTACTTTGCTGCTAATATTTCCTCCTGAGTGCTTGCTTCTTCATGCGGACTCGCTCTTTCTTTGTTTTTACGTCATTTTTTTTTTTGTTGTTGTCGTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAAAGGTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAAAAA
  3   1   2       bld Gas6 5g3  in                         ANBT2349.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGAAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGG
  3   1   2       bld Brn3 5g3  in                         CAAK2428.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTT
  3   1   2       bld Lun1      in                        CABD13006.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTTCACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGAAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAAC
  3   1   2       bld Gas7      in                         XZG65759.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATTCTGTGATCATCAGAATTTCAGGCATCACCCCTAACTCCTCNACTGCCAGAGGTGCCTTTGGCAGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7 PIPE in                         XZG28457.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTAAAGGAGTTAATTCCCTGACTTCCTGATCTCCATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAAAAAAAAAAAAAGG
  5  -1   2       bld Ovi1      in                         CABI2503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTGAATACATGGGGTGTGGGATCAGACGGAGGGTAGTCTCTTATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTG
  5   1   0       add Gas8      out                        st116b19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCNCCANACTAAGTCGGCAGCTTATTGACCTATGCANGGGGCCTTCNCACCNGANATCNGGCCAACGGCAAAATTCCTTCAGGCAAGGACNGCATCTGNGTTGATAAGGTCNCCNCCNGACCTTCNCCCTAAGCCTTTATTANGATCCAANCCTTAGTCGGGGGCCAAACGATCACNTTCAAATTTGGCCCACAGCANCAGGGGTTAAATCAAATCCNCTCAGGGGGCGAGCTCNCCAAANGAATATTAAAGTATATGCNCAGCTGTAGGATTCCCTACAATTTTNGTAGNAAGGGCAACTAAAATCATTTTTTTTTCGGGTTCAANATCNCCNAAAGGNCTACAATTNGGGAAA
  5  -1   2       bld Ovi1      in                         CABI4922.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAACATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAAT
  3   1   2       bld Gas7      in                         XZG21782.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGGTTAATAAGAAGTTGTGACCTCAGATTTCATTCTGGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGG
  3   1   2       bld Tad5      in                         XZT67438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGAAAACCTGATTGGTTGCTGGTTTGACATCCCACCATAAAACAAATGTGGCGTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCC
  3   1   2       bld Liv1      in                         CAAR7978.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTGGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAAC
  3   1   2       bld Fat1      in                          CABC560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAACCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCCAAATTAAAAAAAAAACAAAC
  3   1   2       bld Gas7      in                         XZG62191.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAATACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCC
  5  -1   2       bld Hrt1      in                          CAAQ457.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TACACCCCTGTTCCTTCGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCCAAATTAAAAAAAAAACAAACAAACACAAA
  3   1   2       bld Neu       in                    TNeu062b13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATGAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG23103.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCCAAATTAAAAAAAAAACAAACAAAC
  3   1   2       bld TbA       in                    TTbA032l05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGTGTAAGTGAACTACAACTCCCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTTTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGAATAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTGTGAGACGAAACAATCCAGTATTTGCTCTATACTTTTTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTCTCTTTTCTCGGTCAATTTTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGGTATTTTTGTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTTTTTGGAAATTACAGCATTGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Ovi1      in                         CABI3930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTTTGAGACGAAACAATACAGTATTTGTTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCC
  5   1   2       bld Ovi1      in                         CABI3930.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGCATTTTTCTATCATTAAATTTGTTGAAGAATTCTGGGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGTTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCCAAAAAAAAAAAAAAAA
  3   1   2       bld Limb      out                       CBSU5144.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACTTGTAGTCCAACATCATCTTGGGAGCCAAGGTTAGCCAACAGGGTTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCGGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTTTGAGGTGAAACAATACAGTATTTGCTGTATACTTTCTCTACTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTTTAAATCCGGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGTTTCGGAAAAAAAGAAAGCGGAAAAAAAAACGTTTCGAAAAACGACAAAAAAAAAAAAGGACTCCTTAAAAAAAAAACTTGAGATTTATTAAAACAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCCAAATTAAAAAAAAATATCAAAC
  3   1   2       bld Gas       in                    TGas051e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCCAAGGTTAGCCAACAGGGCTATATGAAAGACTAGTAAGGGACTATGCTCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTTTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACGAGAATGCCGAAATTAAAAAAAA
  5   1   2       bld TbA                            TTbA058a21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTCTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCC
  3   1   2       bld Tail      in                         CBSW3512.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCAAGGCCCGCATCCCTGCAAAGGGAAGACACAGAGTATACGGAACTCACGAATATGTTTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTCTACTTATAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTTTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTTTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAGCGGAAAAAAAAACGTTTCGAAAAACGACAAAAAAAAAAAAGGACTCCTTAAAAAAAAAACCTGAGATTTATTAAAACAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCCAAATTAAAAAAAAAAAACAAACAAACATAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT7083.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGTATACGGAACTCCACGAATATGTCTGAGACGAAACAATACAGTATTTGCTCTATACTTTCTTCTCCTTATAAAGGTACACGTTATGCACAGGGAAGGGTTAAATTCGTGTTTTTTTTTCTCGTTCATTTCTTCTTAATATCATACAATGGAGTGTGGTAACGTTAGCATTTTCCTAGCTCAGTGAGCATGTTTAACATAAGCTATTTTTTTAAATCCCGAAGTTTAAATGATCAAGAAAAAAAGAAAAGCACTCTTTGGAACTTACGCATCGTAGTGCTTCGGAAAAAAAGAAAACGGAAAAAAACGTTTCGAAAAACGAAAAAAAAAAAGGACTCCTTAAAAAAAAAAAAACTGAGATTTATTAAAAAAAATTGTATTTTATGTTATATATAAATATATTATTACTTGTAAATATAAAAGACGTTTTATAAGCATCATTATTTATGTATTGTGCAATGTGTATAAACGAGAAAAATAAAAAAGATGCACTTTGCTTAATATAAATGCAAATAACAAAATGCCAAATTAAAAAAAAAACAAACAAACATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)