Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-TEgg049f18.5                         24 END     1           1        4                polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 22%

 1012153919 Xt7.1-TGas091e24.3.5 - 75 ESTs
                                                                       ......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050......6060......6070......6080......6090......6100......6110......6120......6130......6140......6150......6160......6170......6180......6190......6200......6210......6220......6230......6240......6250......6260......6270......6280......6290......6300......6310......6320......6330......6340......6350......6360......6370......6380......6390......6400......6410......6420......6430......6440......6450......6460......6470......6480......6490......6500......6510......6520......6530......6540......6550......6560......6570......6580......6590......6600......6610......6620......6630......6640......6650......6660......6670......6680......6690......6700......6710......6720......6730......6740......6750......6760......6770......6780......6790......6800......6810......6820......6830......6840......6850......6860......6870......6880......6890......6900......6910......6920......6930......6940......6950......6960......6970......6980......6990......7000......7010......7020......7030......7040......7050......7060......7070......7080......7090......7100......7110......7120......7130......7140......7150......7160......7170......7180......7190......7200......7210......7220......7230......7240......7250......7260......7270......7280......7290......7300......7310......7320......7330......7340......7350......7360......7370......7380......7390......7400......7410......7420......7430......7440......7450......7460......7470......7480......7490......7500......7510......7520......7530......7540......7550......7560......7570......7580......7590......7600......7610......7620......7630......7640......7650......7660......7670......7680......7690......7700......7710......7720
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas091e24.3.5                                                                                                                                                                                                                                                                                                                                                                     CTACATTTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGTATTGTTTATATTGGAGCTGTAAATCGCTTGTACCAACTTTCTGCAGAGCTCGATATGCAAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACACCACCCATTGACTCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTATAACAAGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTTTTAAAGGAATTTGCTCGTTGAGGGCTATGAGCGATATTTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGAAAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCAATTTGTAACTGCTTTTGAGAATGATGATTATGTTTATTTTGTCTCAACACGAGCAGATCGAATTAGTAATGAAAATCGGACTTTTATTTCCCGTCTTTGTAAGGATGATTTCAACTACTACTCCTATATTGAGATGCCTCTTGAATGTAAAAACCAGAGGAATAATGAGAGCTACAATTTCAGCCACTCTGTTTTTGTTACTAAACCGGGCAGTGACTTAGCAGATATCATGAAACTTCCATCCACTGAAACAACAGTTCTCTTTGGTGTTTTTAGCAGAAAACAAGTTTCAGATCAATCTGCTGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGGAGCTGCTAAAAGTTATCGCTGTGGGTCAGAACACTTGCCCTACCCCTTGGAGTGCAAGGAAGGTGTATCCAAAAGTTCTGTGTTAATAAGAGAGAAGAATCCTTTTAGCTCAGTTGCCATCGCTGTTGAGAATGAGCACACCATTGCATTTTTGGGGACAGCTGAAGGAAAACTTGTGAAGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTAAGAAAAAGGCCTACCGAGTTCCTGTTCAAGATTGTGCCCGTTCTTCAAATTGCAATGAATGCATTTCAACAAATGATCCTTATTGTGGTTGGTGTGTTCTTGAAGGAAAATGCACAAGGAAGGTTGATTGCCCAAGGAACAATAACAGTCACTGGTTATTTAGTCCTTCTGGAACATGTATGCAAGTCAAGAGTGCGACGCCAGGGAATATGAGTGTCATGTCACTGCGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTGTTACTAGCAGGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCTCTCAACGGGATGATGTTATTGAGCCTAATATGGAAGAAAATTGTCCACAGTTCTATGAACCCAATCCATCATTGATTCCAATGAAACATAAAAGTACCATAACATTTAATGGGAAAAATCTTGATCATTATAAGAATGAAGATTTCAGTGCAGGCAGTGATGAATTTACGTTCAAAACAGATGTGTTACAAATTGATGGATCCTTCTCCCTTTCTATACCAGAGTTTCCTGCAGAAGATAAAGAAACTGTTCCTTTGGGTATTTACATTAAAGTGAATGAAAAAAAGATTGACAGTAAATTAAATGTTAATCTCTACAACTGCATGTATGGCAGAAGTGACTGCAGCCTGTGCCTTGCTGCCGATCCTGTATACCAGTGTGTCTGGTGTAATGACAAATGTGTATACAAGGATATGTGTGAGGAATCACCTGCTACTGAGTGCCCAGCTCCTAAAATCACTGATCTTGTGCCAATAGCAGCACCTTTAAAGGGGGGAATTCGCCTCACCATAAAAGGATCAAATTTAGGAATAAAACCTGCTGATGTTGAAGAAATAATAGTGGCAAACACCCCGTGTACATTTATTGAAGAATTGTATTCTGTCTCCACTAGTGTTGTTTGTGAAGTTGGTGCTGTGGACGAACCTGATTCAGGGAAAGTTAAAATAAAGATTAAGGAGAAGATGGGAATATCGAGTCAGATTTTTACATACCAGCATTTTCTTTCAGTCTGAGCTGTGTGCCTCCTTTGTGTCAAACTATGCTGTCAGCTTCAGATGGTGGTACCAGCAAGCTGTCTACTTTTCTTGGCATTCATATCGAGTCAGATTTTTACATACCAGGATCCAAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTTTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTTATAATAAAGTACATTTTTTT
                                                  Xt7.1-CHK-1008265434                                                                                                                                                                                                                                                                                                                                                                           TTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGTATTGTTTATATTGGAGCTGTAAATCGCTTGTACCAACTTTCTGCAGAGCTCGATATGCAAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACACCACCCATTGACTCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTATAACAAGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTTTTAAAGGAATTTGCTCGTTGAGGGCTATGAGCGATATTTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGAAAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCAATTTGTAACTGCTTTTGAGAATGATGATTATGTTTATTTTGTCTCAACACGAGCAGATCGAATTAGTAATGAAAATCGGACTTTTATTTCCCGTCTTTGTAAGGATGATTTCAACTACTACTCCTATATTGAGATGCCTCTTGAATGTAAAAACCAGAGGAATAATGAGAGCTACAATTTCAGCCACTCTGTTTTTGTTACTAAACCGGGCAGTGACTTAGCAGATATCATGAAACTTCCATCCACTGAAACAACAGTTCTCTTTGGTGTTTTTAGCAGAAAACAAGTTTCAGATCAATCTGCTGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGGAGCTGCTAAAAGTTATCGCTGTGGGTCAGAACACTTGCCCTACCCCTTGGAGTGCAAGGAAGGTGTATCCAAAAGTTCTGTGTTAATAAGAGAGAAGAATCCTTTTAGCTCAGTTGCCATCGCTGTTGAGAATGAGCACACCATTGCATTTTTGGGGACAGCTGAAGGAAAACTTGTGAAGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTAAGAAAAAGGCCTACCGAGTTCCTGTTCAAGATTGTGCCCGTTCTTCAAATTGCAATGAATGCATTTCAACAAATGATCCTTATTGTGGTTGGTGTGTTCTTGAAGGAAAATGCACAAGGAAGGTTGATTGCCCAAGGAACAATAACAGTCACTGGTTATTTAGTCCTTCTGGAACATGTATGCAAGTCAAGAGTGCGACGCCAGGGAATATGAGTGTCATGTCACTGCGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTGTTACTAGCAGGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCTCTCAACGGGATGATGTTATTGAGCCTAATATGGAAGAAAATTGTCCACAGTTCTATGAACCCAATCCATCATTGATTCCAATGAAACATAAAAGTACCATAACATTTAATGGGAAAAATCTTGATCATTATAAGAATGAAGATTTCAGTGCAGGCAGTGATGAATTTACGTTCAAAACAGATGTGTTACAAATTGATGGATCCTTCTCCCTTTCTATACCAGAGTTTCCTGCAGAAGATAAAGAAACTGTTCCTTTGGGTATTTACATTAAAGTGAATGAAAAAAAGATTGACAGTAAATTAAATGTTAATCTCTACAACTGCATGTATGGCAGAAGTGACTGCAGCCTGTGCCTTGCTGCCGATCCTGTATACCAGTGTGTCTGGTGTAATGACAAATGTGTATACAAGGATATGTGTGAGGAATCACCTGCTACTGAGTGCCCAGCTCCTAAAATCACTGATCTTGTGCCAATAGCAGCACCTTTAAAGGGGGGAATTCGCCTCACCATAAAAGGATCAAATTTAGGAATAAAACCTGCTGATGTTGAAGAAATAATAGTGGCAAACACCCCGTGTACATTTATTGAAGAATTGTATTCTGTCTCCACTAGTGTTGTTTGTGAAGTTGGTGCTGTGGACGAACCTGATTCAGGGAAAGTTAAAATAAAGATTAAGGAGAAGATGGGAATATCGAGTCAGATTTTTACATACCAGCATTTTCTTTCAGTCTGAGCTGTGTGCCTCCTTTGTGTCAAACTATGCTGTCAGCTTCAGATGGTGGTACCAGCAAGCTGTCTACTTTTCTTGGCATTCxTxxCxAGTCAGATTTTTACATACCAGGATCCAAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTTTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTxxxAATAAAGTACAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                          3     4     3     4     3     4     3     4     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     5     3     6     3     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     6     6     6     6     6     5     6     6     6     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     2     4     2     4     3     5     3     5     3     5     3     5     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     7     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     5     4     4     4     5     3     4     3     4     3     4     4     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     8     5     9     5     9     5     9     5     9     5     9     5    10     5    10     5    10     5    10     5    10     4     9     5    10     5    10     6    10     6    10     6    10     5    10     5    10     5    10     6    10     6     9     6     9     6     9     8    11     8    11     8    11     9    12     9    12     9    12    10    13    12    15    12    15    12    15    13    16    13    17    14    18    14    18    14    19    19    20    19    20    19    20    20    21    20    20    21    21    20    20    20    21    21    22    22    23    22    23    22    23    22    23    24    26    25    27    26    27    26    27    26    28    27    28    28    28    28    29    29    30    29    30    29    30    29    30    29    31    30    33    29    33    30    33    31    35    30    34    29    33    27    33    28    32    27    32    27    31    28    32    27    31    27    31    27    31    27    31    16    31    16    31    18    31    18    31    18    30    18    30    18    30    18    30    18    30    19    32    19    32    18    30    18    30    18    30    18    30    18    30    18    30    18    30    17    28    17    28    17    28    16    23    12    19    12    18    12    17    12    17    12    17    13    18    13    18    13    18    13    18    13    18    13    18    14    18    14    18    14    18    11    15    11    14    11    14    11    14    10    14    11    14     8    11     8    10     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     8     5     8     3     5
  5   1   2      ests                                Xt7.1-CAAK12585.5                                                                                                                                                                                                                                                                                                                                                                     CTACATTTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGTATTGTTTATATTGGAGCTGTAAATCGCTTGTACCAACTTTCTGCAGAGCTCGATATGCAAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACACCACCCATTGACTCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTATAACAAGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTTTTAAAGGAATTTGCTCGTTGAGGGCTATGAGCGATATTTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGAAAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCAATTTGTAACTGCTTTTGAGAATGATGATTATGTTTATTTTGTCTCAACACGAGCAGATCGAATTAGTAATGAAAATCGGACTTTTATTTCCCGTCTTTGTAAGGATGATTTCAACTACTACTCCTATATTGAGATGCCTCTTGAATGTAAAAACCAGAGGAATAATGAGAGCTACAATTTCAGCCACTCTGTTTTTGTTACTAAACCGGGCAGTGACTTAGCAGATATCATGAAACTTCCATCCACTGAAACAACAGTTCTCTTTGGTGTTTTTAGCAGAAAACAAGTTTCAGATCAATCTGCTGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGGAGCTGCTAAAAGTTATCGCTGTGGGTCAGAACACTTGCCCTACCCCTTGGAGTGCAAGGAAGGTGTATCCAAAAGTTCTGTGTTAATAAGAGAGAAGAATCCTTTTAGCTCAGTTGCCATCGCTGTTGAGAATGAGCACACCATTGCATTTTTGGGGACAGCTGAAGGAAAACTTGTGAAGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTAAGAAAAAGGCCTACCGAGTTCCTGTTCAAGATTGTGCCCGTTCTTCAAATTGCAATGAATGCATTTCAACAAATGATCCTTATTGTGGTTGGTGTGTTCTTGAAGGAAAATGCACAAGGAAGGTTGATTGCCCAAGGAACAATAACAGTCACTGGTTATTTAGTCCTTCTGGAACATGTATGCAAGTCAAGAGTGCGACGCCAGGGAATATGAGTGTCATGTCACTGCGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTGTTACTAGCAGGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCTCTCAACGGGATGATGTTATTGAGCCTAATATGGAAGAAAATTGTCCACAGTTCTATGAACCCAATCCATCATTGATTCCAATGAAACATAAAAGTACCATAACATTTAATGGGAAAAATCTTGATCATTATAAGAATGAAGATTTCAGTGCAGGCAGTGATGAATTTACGTTCAAAACAGATGTGTTACAAATTGATGGATCCTTCTCCCTTTCTATACCAGAGTTT
  5   1   2      ests                               Xt7.1-TGas091e24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTCAGATTTTTACATACCAGGATCCAAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTTTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTATAAATAAAGTACAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                               BLH MIN     210     295                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MPR      18     295                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR     210      64                                                                                                                                                                                                                                                                                                                                                                     
                                               CDS MIN     210     295                                                                                                                                                                                                                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 6e-160     XP_001195685.1 PREDICTED: similar to Plexin-A4 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 0          NP_500018.3 PLeXin family member (plx-1) [Caenorhabditis elegans] --------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 0          NP_524637.2 plexin A CG11081-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xt ---- 0          AAI33057.1 Unknown (protein for MGC:146050) [Xenopus tropicalis] ---------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 0          NP_001088457.1 hypothetical protein LOC495321 [Xenopus laevis] -----------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAI08846.1 LOC494999 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 0          XP_689930.1 PREDICTED: similar to Plexin B2 precursor (MM1) [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Hs ---- 0          XP_371474.3 PREDICTED: similar to Plexin-B2 precursor (MM1) [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Mm ---- 0          XP_484491.3 PREDICTED: plexin B2 isoform 1 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 0          XP_423623.2 PREDICTED: hypothetical protein [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas091e24.3.5                                                                                                                                                                                                                                                                                                                                                                                             TAA---------------------------------------------------------------------------------------TGA---------------------------TAA---------------------------------------------TAA------TGA------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TGA------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------ATG---------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------TGA---------------TAA---------------TGA------------------------------------------------------------TAA------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------TAG---------------------------------------TAATAA---------------------------------------------------------TAA------------------TAA------------------------TAA------TAA------ATG------------------------TAA------TAA---------------------------------------------------------------------------TAA---------------------TAA---------------TGA---------------------------------------------------------------------------ATGATG------------------TGA------------------TAA------------------------------------------------------------------------------------TAG------------------ATG---TAA---------TAG------ATG---------------------------------TGA---TAA---TGA---------TAA------------------ATG---------------ATG---------------------TAA---------------------------TGA------------------TAA---------------------------------------TAA---------------TAA------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Brn2 FLt5                       CAAJ12858.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGAGTAAGTTAAAGCATGAAAGCATTTGTTGTAGGATTTTAACTTCTATTTGGATATCTGTACATATCCATTACAAGATAAAGCTTACTGGCTGCATTTTTTTATGCAAGAAAAGGGAATAGTTTGGGCCGTTATGGACAGATTGCTTGTGAAATTCCCCTGGATTTATCCTTGCTTACAGTTAACTGTATTTGTTAAATATTTGCTCCTAAATTGATTTTTTTTTCCAGCTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATAAAAAAAAAAAAAAA
  0   1   1           Gas  FLt5                   TGas031j03.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTTTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCCTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                Xt7.1-CAAK12585.5                                                                                                                                                                                                                                                                                                                                                                     CTACATTTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGTATTGTTTATATTGGAGCTGTAAATCGCTTGTACCAACTTTCTGCAGAGCTCGATATGCAAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACACCACCCATTGACTCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTATAACAAGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTTTTAAAGGAATTTGCTCGTTGAGGGCTATGAGCGATATTTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGAAAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCAATTTGTAACTGCTTTTGAGAATGATGATTATGTTTATTTTGTCTCAACACGAGCAGATCGAATTAGTAATGAAAATCGGACTTTTATTTCCCGTCTTTGTAAGGATGATTTCAACTACTACTCCTATATTGAGATGCCTCTTGAATGTAAAAACCAGAGGAATAATGAGAGCTACAATTTCAGCCACTCTGTTTTTGTTACTAAACCGGGCAGTGACTTAGCAGATATCATGAAACTTCCATCCACTGAAACAACAGTTCTCTTTGGTGTTTTTAGCAGAAAACAAGTTTCAGATCAATCTGCTGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGGAGCTGCTAAAAGTTATCGCTGTGGGTCAGAACACTTGCCCTACCCCTTGGAGTGCAAGGAAGGTGTATCCAAAAGTTCTGTGTTAATAAGAGAGAAGAATCCTTTTAGCTCAGTTGCCATCGCTGTTGAGAATGAGCACACCATTGCATTTTTGGGGACAGCTGAAGGAAAACTTGTGAAGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTAAGAAAAAGGCCTACCGAGTTCCTGTTCAAGATTGTGCCCGTTCTTCAAATTGCAATGAATGCATTTCAACAAATGATCCTTATTGTGGTTGGTGTGTTCTTGAAGGAAAATGCACAAGGAAGGTTGATTGCCCAAGGAACAATAACAGTCACTGGTTATTTAGTCCTTCTGGAACATGTATGCAAGTCAAGAGTGCGACGCCAGGGAATATGAGTGTCATGTCACTGCGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTGTTACTAGCAGGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCTCTCAACGGGATGATGTTATTGAGCCTAATATGGAAGAAAATTGTCCACAGTTCTATGAACCCAATCCATCATTGATTCCAATGAAACATAAAAGTACCATAACATTTAATGGGAAAAATCTTGATCATTATAAGAATGAAGATTTCAGTGCAGGCAGTGATGAATTTACGTTCAAAACAGATGTGTTACAAATTGATGGATCCTTCTCCCTTTCTATACCAGAGTTT
                                                  Xt7.1-CHK-1008234636                                                                                                                                                                                                                                                                                                                                                                           TTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGTATTGTTTATATTGGAGCTGTAAATCGCTTGTACCAACTTTCTGCAGAGCTCGATATGCAAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACACCACCCATTGACTCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTATAACAAGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTTTTAAAGGAATTTGCTCGTTGAGGGCTATGAGCGATATTTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGAAAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCAATTTGTAACTGCTTTTGAGAATGATGATTATGTTTATTTTGTCTCAACACGAGCAGATCGAATTAGTAATGAAAATCGGACTTTTATTTCCCGTCTTTGTAAGGATGATTTCAACTACTACTCCTATATTGAGATGCCTCTTGAATGTAAAAACCAGAGGAATAATGAGAGCTACAATTTCAGCCACTCTGTTTTTGTTACTAAACCGGGCAGTGACTTAGCAGATATCATGAAACTTCCATCCACTGAAACAACAGTTCTCTTTGGTGTTTTTAGCAGAAAACAAGTTTCAGATCAATCTGCTGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGGAGCTGCTAAAAGTTATCGCTGTGGGTCAGAACACTTGCCCTACCCCTTGGAGTGCAAGGAAGGTGTATCCAAAAGTTCTGTGTTAATAAGAGAGAAGAATCCTTTTAGCTCAGTTGCCATCGCTGTTGAGAATGAGCACACCATTGCATTTTTGGGGACAGCTGAAGGAAAACTTGTGAAGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTAAGAAAAAGGCCTACCGAGTTCCTGTTCAAGATTGTGCCCGTTCTTCAAATTGCAATGAATGCATTTCAACAAATGATCCTTATTGTGGTTGGTGTGTTCTTGAAGGAAAATGCACAAGGAAGGTTGATTGCCCAAGGAACAATAACAGTCACTGGTTATTTAGTCCTTCTGGAACATGTATGCAAGTCAAGAGTGCGACGCCAGGGAATATGAGTGTCATGTCACTGCGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTGTTACTAGCAGGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCTCTCAACGGGATGATGTTATTGAGCCTAATATGGAAGAAAATTGTCCACAGTTCTATGAACCCAATCCATCATTGATTCCAATGAAACATAAAAGTACCATAACATTTAATGGGAAAAATCTTGATCATTATAAGAATGAAGATTTCAGTGCAGGCAGTGATGAATTTACGTTCAAAACAGATGTGTTACAAATTGATGGATCCTTCTCCCTTTCTATACCAGAGTTTCCTGCA
  5   1   2       bld Brn2 5g3  in                        CAAJ11929.5p CGGACGCGTGGGTGGCTATTGCCTAGTGGCCAGTGAAATTCCTTCGCACTCCTCCCAATCCAGTGCCTCTGGCACCCCCTCCCATTCCTTGAGAGCTCCCAGGCAGTCTGAAATCCGATCCTCCGCAGCCGGCTCAGAGGGGAGGACTCTCTCCCTGTTATTCTGCCTTTTTTTTCCTGCTTCCTGTTTCTGGTATTGTGCTGGGGAGCGGATGTGCGCAGCGCCCACAGGTGTGTCTCCTCTCGGCGCTCAGTGCTAGGGAGTCGGCTGGGAAGGACTGTGCGAGGCTGATATGGACACAGTGAGGGCCGGGGGGTCGGGGCGCGGAGCCGCACTACATTTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGTGTGCGGCTTCCTGGATAGAAAGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGTATTGTTTATATTGGAGCTGTAAATCGCTTGTACCAACTTTCTGCAGAGCTCGATATGNCAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACA
  5   1   2       bld Te3       in                         CAAM8904.5p                                                                                                                                                                                                                                             TGCGCAGCGCCCACAGGTGTGTCTCCTCTCGGCGCTCAGTGCTAGGGAGTCGGCTGGGAAGGACTGTGCGAGGCTGATATGGACACAGTGAGGGCCGGGGGGTCGGGGCGCGGAGCCGCACTACATTTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTACACACGGCTGAGAAGTTTTGCGAATATATTTCTGAGAGA
  5   1   0       add HdA       out                 THdA029h01.p1kaSP6                                                                                                                                                                                                                                                                                                          GACTGTGCGAGGCTGATATGGACACAGTGAGGGCCGGGGGGTCGGGGCGCGGAGCCGCACTACATTTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGTGAGTTCCTCCCAAATTCCGCTCTTATTTTTAGGCTATCTTGTCATAGCACCTGTTGGCCGGAGAGTGGGGCAGCGCTGTGCTGGACATTCTCCACTCAGTCACCTTCCTTCCAGCTCATCTGTGCTAAGTTTTAGCGCTGGGTGTCTGGGCGGGGGGAGTGGCCGGGCTCCTTTGGACTGGGGATTAGCGATCAGTCTTATCAAAGTGACCCCTTCCAGCTTTAATGGAAACCTGTGAACTTGGGAAGGAGGTAAGAGGCGCTGTCCCACCCGCAGGGTTCTGTGGGAGCGGGAGTAGCATGGGGTGCCACAGACTGGGAGCTCCTTTCCCACGGTTACATCCACGCACCACACCACCTGCCTTGGGAGTTACCTGATTCATAAAATCTATTTCAGGAATGTGCTGACACTTCTGCTTTGTTTCAAATAATAGCAAAGTCAATGTACAGTTGTTTGCTCTTCAGCTTANGATCATTTTAGTTCAGGCTTGTTCATACTGGATATTGCATGGCTGCTATTGTTTGTACA
  5   1   2   10  bld Spl1 5g3  in                         CABK2421.5p ..........................................................................................................................................................................................................................................................................................................................................................CGGAGCCGCACTACATTTCTCTCAGCGTCTCCATTAAGTCCGGGAAAGCCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGCATTGTTTATATTGGAGCTGTAAACCGCTTGTACCAACTTTCTGCAGAGCTCGATATGCAAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACACCACCCATTGACTCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTATAACAAGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTTTTAAAGGAATTTGCTCGTTGAGGGCTATGAGCGATATTTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGAAAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCA
  5   1   2   14  bld Brn3 5g3  in                        CAAK12585.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................CCGCGGGAAGCGGAGCCTAGCAGGAGACTTGTTGGGAGGAAGGGGACAGAGGACAGAGGACAGAAAGTGCCAATATTGACTCATTATAAGTAAAAGGCAGACTGTTTAAACAAGGCTGAGAAGTTTTGCGAATATATTTTTGAAAGACACTAAATAACTACTCTGACCAACAATGGCTTTATGGTTTCAAGTTTCCAGCCTAATTATCTGCATCATATTGATGCCACAAGCACAAACATTTCTCTCTTTCTTTAGTGACACAGATTTAAACCATCTTGCTGTTAACAATGACACTGGTATTGTTTATATTGGAGCTGTAAATCGCTTGTACCAACTTTCTGCAGAGCTCGATATGCAAGTGAATTTTACCACAGGTCCAAAATTAGATAAAAAATCTTGCACACCACCCATTGACTCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTATAACAAGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTTTTAAAGGAATTTGCTCGTTAAGGGCTATGAGCGATATTTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGANAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCATTTTGTAACTGCTTTTGAGAATGAGGATAATGTTTATTTTG
  5  -1   2      skin Gas1                               IMAGE:6990859                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATCTTGCACACCACCCAATGACTCCCCAGCAGTGTCCCTCTGCAGAAATAACAGATAATTCTATCAGGCTGCTGCTGCTAGATAAGCCACATGAACGGATTATTGTATGTGGTAGCATTCTTAAAGGAATTTGCTCGTTGAGGGCTATGAGCGATATCTCTACAGAGCTTTGGTATAAAGATAACCTAGGAGAAAAGTCTTTTGTTGCGAGCAATGATGAAGTTATATCTACTGTTGGATTGGTCACTAACCATGGCAAAGAAAAAAGGAGGCTTTTATTTGTTGGAAAAGGCCATGTACAAAATGACAATGGAATTATCATAAGTACGCGGATACTGGAAAAGAAAGAAGATAGAGATGTTTTTGAAGTGTATCAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCAATTTGTAACTGCTTTTGAGAATGATGATTATGTTTATTTTGTCTCAACACGAGCAGATCGAATTAGTAATGAAAATCGGACTTTTATTTCCCGTCTTTGTAAGGATGATTTCAACTACTACTCCTATATTGAGATGCCTCTTGAATGTAAAAACCAGAGGAATAATGAGAGCTACAATTTCAGCCACTCTGTTTTTGTTACTAAACCGGGCAGTGACTTAGCAGATATCATGAAACTTCCATCCACTGAAACAACAGTTCTCTTTGGTGTTTTTAGCAGAAAACAAGTTTCAGATCAATACGCGGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTGAAGAAAC
  5   1   2      skin Te3       in                         CAAM5955.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAGACTCTGCAACATTTAAATCTGTTGATCATATAAAACATTTCCAGCAATTTGTAACTGCTTTTGAGAATGATGATTATGTTTATTTTGTCTCAACACGAGCAGATCGAATTAGTAATGAAAATCTGACTTTTATTTCCCGTCTTTGTAAGGATGATTTCAACTACTACTCCTATATTGAGATGCCTCTTGAATGTAAAAACCAGAGGAATAATGAGAGCTACAATTTCAGCCACTCTGTTTTTGTTACTAAACCGGGCAGTGACTTAGCAGATATCATGAAACTTCCATCCACTGAAACAACAGTTCTCTTTGGTGTTTTTAGCAGAAAACAAGTTTCAGATCAATCTGCTGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGGAGCTGCTAAAAGTTATCGCTGTGGGTCAGAACACTTGCCCTACCCCTTGGAGTGCAAGGAAGGTGTATCCAAAAGTTCTGTGTTAATAAGAGAGAAGAATCCTTTTAGCTCAGTTGCCATCGCTGTTGAGAATGAGCACACCATTGCATTTTTGGGGACAGCTGAAGGAAAACTTGTGAAGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTA
  5   1   2      seed Tad5      in                          XZT6053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGGAGCTGCTAAAAGTTATCGCTGTGGGTCAGAACACTTGCCCTACCCCTTGGAGTGCAAGGAAGGTGTATCCAAAAGTTCTGTGTTAATAAGAGAGAAGAATCCTTTTAGCTCAGTTGCCATCGCTGTTGAGAATGAGCACACCATTGCATTTTTGGGGACAGCTGAAGGAAAACTTGTGAAGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTAAGAAAAAGGCCTACCGAGTTCCTGTTCAAGATTGTGCCCGTTCTTCAAATTGCAATGAATGCATTTCAACAAATGATCCTTATTGTGGTTGGTGTGTTCTTGAAGGAAAATGCACAAGGAAGGTTGATTGCCCAAGGAACAATAACAGTCACTGGTTATTTAGTCCTTCTGGAACATGTATGCAAGTCAAGAGTGCGACGCCAGGGAATATGAGTGTCATGTCACTGCGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGGTAAATACATCCTTTATTCAAAATAAAAATCTTGACATTGCAGGCTGGGGGGCTTTGTTACTTTGCCCTGAATAAGAAATGCAAAATAATAAATGCTGTTCTCTAAA
  3  -1   2       bld Ovi1      out                        CABI1310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGCAGAAAACAAGTTTCAGATCAATCTGCGGTCTGTGTGTTTTCACTGTCTGAGATTAATAATAAATTTGAAGAAAACCGTGAGGCATGTTACACAAGTAATAAAGCTGATCTCAAGACTCTATTTTTTAAGCCATATGGAGGAGAACTGTCCTGTGCAAATTCACCATCGGCTTTTATCAGAGACCAATCATATGAGTATAGGAACCTTTCCTTTGAAACATCAAGTGCAGTGAAGAATGGCATGGTGTTTGATGCTGATCAAAAACATCTGTATGTAATGACTAAGAAAAAGGCCTACCGAGTTCCTGTTCAAGATTGTGCCCGTTCTTCAAATTGCAATGAATGCATTTCAACAAATGATCCTTATTGTGGTTGGTGTGTTCTTGAAGGAAAATGCACAAGGAAGGTTGATTGCCCAAGGAACAATAACAGTCACTGGTTATTTAGTCCTTCTGGAACATGTATGCAAGTCAAGAGTGCGACGCCAGGGAATATGAGTGTCATGTCACTGCGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTNGTACTAGCANGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCCTCTCACGGGATGATGTTATTGAGCCTAATAT
  5   1   2       bld Gas       in                  TGas091e23.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAGAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAA
  5   1   2       bld Gas       in                  TGas091e24.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCAAGGTTACATTAACTGTGGAACCCTCAATATATTTATTATATGACGATAATCTGATTTGTGACTTTGGAGGAGCGAAAACTACAGCTGAATTGCAGCAAGATGGGACAATCTCTTGCCAACCCCCAAATCGAATTCCATCCCCAGAAAAAGGCAAAGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTGTTACTAGCAGGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCTCTCAACGGGATGATGTTATTGAGCCTAATATGGAAGAAAATTGTCCACAGTTCTATGAACCCAATCCATCATTGATTCCAATGAAACATAAAAGTACCATAACATTTAATGGGAAAAATCTTGATCATTATAAGAATGAAGATTTCAGTGCAGGCAGTGATGAATTTACGTTCAAAACAGATGTGTTACAAATTGATGGATCCTTCTCCCTTTCTATACCAGAGTTTCCTGCAGAAGAAAAGAAACTGTTCCTTTGGGTATTTACATTAAGTGAATGAAAAAA
  5   1   2      skin Brn3      out                       CAAK10362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGATAATGTTAACATTACAATCAACCTAAGCTTTCAGAAGAATGGTGATGTGTTTTTTGCAAATTATTCTTATCCATTCTATAATTGTAAAGAAGCAATAAACCTTTCAGAGAATATGCCATGTACATCCTGTGTTACTAGCAGGTGGAATTGTCAGTGGGATATAAATAATCATAGGTGTGAGGACTCCTCTCAACGGGATGATGTTATTGAGCCTAATATGGAAGAAAATTGTCCACAGTTCTATGAACCCAATCCATCATTGATTCCAATGAAACATAAAAGTACCATAACATTTAATGGGAAAAATCTTGATCATTATAAGAATGAAGATTTCAGTGCAGGCAGTGATGAATTTACGTTCAAAACAGATGTGTTACAAATTGATGGATCCTTCTCCCTTTCTATACCAGAGTTTCCTGCAGAAGATAAAGAAACTGTTCCTTTGGGTATTTACATTAAAGTGAATGAAAAAAAGATTGACAGTAAATTAAATGTTAATCTCTACAACTGCATGTATGGCAGAAGTGACTGCAGCCTGTGCCTTGCTGCCGATCCTGTATACCAGTGTGTCTGGTGTAATGACAAATGTGTATACAAGGATATGTGTGAGGAATCACCTGCTACTGAGTGCCCAGCTCCTAAAATCACTGATCTTGTGCCAATAGCAGCACCTTTAAAGGGGGGAATTCGCCTCACCATAAAAGGATCAAATTTAGGAATAAAACCTGCTGATGTTGAAGAAATAATAGTGGCAAACA
  5   1   2      ests                               Xt7.1-TGas091e24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTCAGATTTTTACATACCAGGATCCAAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTTTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTATAAATAAAGTACAT
                                                  Xt7.1-CHK-1008224788                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTTACATACCAGGATCCAAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTTTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTxxxAATAAAGTACATTTTTTT
  5   1   2       bld Brn2      out                       CAAJ19241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAAGATAAAGAAACTGTTCCTTTGGGTATTTACATTAAAGTGAATGAAAAAAAGATTGACAGTAAATTAAATGTTAATCTCTACAACTGCATGTATGGCAGAAGTGACTGCAGCCTGTGCCTTGCTGCCGATCCTGTATACCAGTGTGTCTGGTGTAATGACAAATGTGTATACAAGGATATGTGTGAGGAATCACCTGCTACTGAGTGCCCAGCTCCTAAAATCACTGATCTTGTGCCAATAGCAGCACCTTTAAAGGGGGGAATTCGCCTCACCATAAAAGGATCAAATTTAGGAATAAAACCTGCTGATGTTGAAGAAATAATAGTGGCAAACACCCCGTGTACATTTATTGAAGAATTGTATTCTGTCTCCACTAGTGTTGTTTGTGAAGTTGGTGCTGTGGACGAACCTGATTCAGGGAAAGTTAAAATAAAGATTAAGGAGAAGATGGGAATATCGAGTCAGATTTTTACATACCAGCATTTTCTTTCAGTCTGAGCTGTGTGCCTCCTTTGTGTCAAACTATGCTGTCAGCTTCAGATGGTGGTACCAGCAAGCTGTCTACTTTTCTTGGCATTCTTCCCAGTACATGCAGAGACACAGGAAGATCCAAACCCAGATTCTCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGA
  5   1   2       bld Gas8                                  st82h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGGAATATCGAGTCAGATTTTTACATACCAGGATCCAAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACNAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATA
  5   1   2       bld Gas8                                  st83h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAATATCGAGTCAGATTTTTACATACCAGGATCCAAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACAATTAAGGGCCAAAGACTAGAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTG
  5   1   2       bld Te4       in                        CAAN10732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCAACCTGGCCTCCAGGTGATTCCCATTAAAGCTGCATTAATATCACTTATTTTGCTTTATGCTAATTTTATTATTTGCTACTGAATTTAGAGTTCTTAACAAGCATACATTATGTTGGCTTGCTGCTAATTTTGTTTATCTAAACTATACAATATTTTTTTCAGTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACGTATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCC
  5   1   2       bld Te4       in                         CAAN7827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCAACCTGGCCTCCAGGTGATTCCCATTAAAGCTGCATTAATATCACTTATTTTGCTTTATGCTAATTTTATTATTTGCTACTGAATTTAGAGTTCTTAACAAGCATACATTATGTTGGCTTGCTGCTAATTTTGTTTATCTAAACTATACAATATTTTTTTCAGTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACGTATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCAGAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCCAAAGAGCGTCACAAAAGAGATAC
  5   1   2       bld Gas8                                  st84h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGAGTCAGATTTTTACATACCAGGATCCNAACCCAGATTATCTACACCCACTTGAAGGTATAATGGCTGGTGGTACTCGGTTGACANTTAAGGGCCAAAGACTANAAACAGGATCCGAGAATGATATCAGAGTGACCCTTGATAGCATACCTTGTGCCGTTAAATCTTTTGGTGAAGAAATTGTTTGTGATACAGGAATGGCTTCCAAAAAAGGAGAGGTGGCAGTAAAGCTGTTGTATGGCGACCGCACAGAAATAAATGCTGGACACTTTATATACAAGGAAAATCCATCAATTGCTCATTTTACTCCAGACAGAAGCTTTGCCAGTGGTGGGAGACATATTACAATTTCAGGGTCAGGATTTAACCTTGTACAGAATTTCANAATAATTGCAAGACTGCAGGGAGAAGACAGTTCTTCGGTTACAGAANATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAA
  5   1   2       bld Gas8                                  st85h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGCTCATTTTACTCCAGACAGAANCTTTGCCAGTGGTGGGAGACATATTACAATTTCNGGNTCNGGATTTAACCTTGTACAGAATTTCACAATAATTGCAAGACTGCAGGG
  5   1   2       bld Gas7                                  XZG4893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGATGAATCCAAAACTATTTCACAGGAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGA
  5   1   2       bld Fat1      in                         CABC4536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGACATCCTTGAAAAAGTAAATGACTCTGTGATTATATTCACGTCTCCACAAGTGCCAGAAAATTACCTGACCTCTGGGGTTACAATTGTGATTAAAATGGATGGACTTGAGTCACCTCTTCAGACTAATGAACTTTCTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCAGAGGCCAGGCGGCAAACTGT
  5   1   2       bld Spl1                                 CABK5129.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTCTTGTACATCCCGGATCCTACATTTGAGAACTTCACTGATGGTATTAAGAAGCAAGTGAATAATCTCATAAATGCTAAGGGTGATAATCTTAATGCTGCAATGACAATTGAAGAGGCCAAAGCATTTGTGGGTGAAGGCACCTGCAAAATAAATACTCTAACATCTACTGACTTGTACTGTGTCCCCCCAGAAGAACAACCCCCACCAAAGAGGCGTCACAAAAGAGATACAGCAAATAACTTACCAGAGTTCATAGTGAAATTTGGAAAGCGTGAATGGGTCCTGGGAAAAGTTGAATATGGACAATCCCCTGCTATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTNTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGNGC
  5   1   2       bld Te4       in                         CAAN8023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCCTCTTCACATTATTATTCCTGTTGTTATCATTCCAATGCTTCTAATCATTGGAATTGCAGTTTACTTTTACAGGCGGAAAAGTCAACAAGCAGAGCGTGAGTATGAAAAAGTCAAACTGCAGCTCGAGGGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTTTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCGTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTA
  3  -1   2       bld Int1      in                         CAAP1904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCTTGGAAGAGACTGTGAGAGAGCGCTGCAAGAGGGAATTTACAGAACTAATGATTGAGATGGAAGATCAAACCAGTGATCTCAGTGAGGCCGGCATCCCTTTCCTAGATTACAAAACATACACAGACAGGGTGTTCTTCCTGTCATCCAAAGATGGGGAAAAAGATGTGATGATAACTGGAAAGCTGGATATCCCAGAGGCCAGGCGGCAAACTGTAGAAGTAGCTCTGAACCAGTTCTCGAACCTTCTTAACAGTAAATCATTCCTTACAATTTTCATTCACACTCTAGAAAGCCAAAAGGACTTCTCTGCCAGAGAAAAACTCTATTTAGCCTCCCTGCTAACTGTGGCTTTGCATGGGAAACTGGAATATTACACTGATATCATGAGAGCATTATTAATGGAGTTAATGGACCAATATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAA
  5   1   2       add Brn2      in                        CAAJ15475.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATGTGGCCAAAAACCCCAAGCTTCTCCTTCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGTAAGTAATATTGGTAGCTTCACAGCTGCCAAGGATAATCTCATTTAAGTCCTTTGAAGCATATAGTTCTTGTTGAATGGCTTGCTCCATTCAGTTAAGTGAGAATATTATAGTTGTCTAGATTCATTTAGGCTAGTTTTTTTTTTTTTGTTTTTTTTTTACAATTAATCCTTGATTCCTAATGCAGGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGGTAAGTACATTAAGTAATTTAGCAAAAATAAAAAAAAATAGAAATGTTAGAATTTGGGTATGAGAAGATCCATCCATTAAGCATGTTCCGTAGTTATGTATTCTATGTTATATATTGAAAAATTGCCCTGCAAAGTATCAGCTTAGCTAATGCACGTGGATAGTAAATGTCTAATATACAGCTGTCCTTGCTGAGGGGATATAGTGAAAAGTAATTTGATGGTTTCAGAAACAGCAACAAATTTTGAACTGATCATATTTAGAAAGTGTTTTTTATTTCCATAAGATGTAATATACATTTGCATTATCTTGATTTTTCACCTATTTTTTTTTTTTTTT
  5   1   2       bld Brn2      in                        CAAJ15999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTAACACAGTAAAAGGGGATGTGTCCCATCCTAAATAGAATGGGGATCCATCCCCTTTAACACAGTAAAACAGTAAAATCTTGTCCTACAATAGGCAGAGGTAATTAAAATGATGTGCACATTTAATCTGTTTAATTATTAACACATTTGTGGTTCATTAAGTAATATTACAGACACTACCTGGGTTTCCTGAGAAAAAGTTTAAGAAACATTGGCTTGTAGTCAAAACAACATTTTGGAATTCCATGTTGTGTTTAATGTTCTTTGCAGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGANAG
  3   1   2       bld Brn2 5g3  in                        CAAJ11929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGCAGGTCAGAAACTGTTGTGGAGCGGATGCTTTCAAATTGGATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCGTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAATTC
  5   1   2       bld Int1      in                         CAAP1904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGTCCATATGTTTATACCAGTATTTGAAAGACACTGTTGGTGAGCCTTTATACAAACTCTTCAAAGCAATTAAACACCAAGTGGAAAAGGGCCCAGTTGATGCTTTGCAAGCTAAAGCCAAATACACACTCAATGATACAGGATTACTAGGGGATGATGTTGAGTACAAACAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAA
  5   1   2       bld Brn2 FLt5 in                        CAAJ12858.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTTGACCGTCAACGTAATTGTTCAAGAGGAAGGTGCAGAACCAGTACCAGTAAAAGTGCTGAACTGTGACACAATTACCCAAGTAAAGGAGAAGATTGTTGATCAGGTTTACAGGAACATTCCTTATTCCTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCT
  5   1   2       bld Brn2 FLx  in                         CAAJ6495.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTACGGCCTAAGGCTGACAGTTTGGCTCTGGAATGGAGGCCAGGGTCTACTGCACAAATACTCTCTGATCTGGATTTAACATCACAGAAAGAAGGAAGGTTGAAACGCTATAACACACTCATGCACTACAATGTCAGGGATAATGCCACTCTCATTCTATCAAGAATGGGGATTTCTCAGCAGCAAGAGGAAAACCACCAAGACTTTCCAGGGGAAAGAAATGCATTGTTAGAGGATGAAAATAAAGCCTGGCACCTTGTCCGTCCAGCTGATGAGGTAGATGAAGTCAAATCAAAGAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGGAATCCGCCAGATGGTACAAGTTAGTGACCAGGATATGAATACACATTTAGCA
  5   1   2       bld Gas  FLt5                      TGas031j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAGATGAAGTCAAATCAAANAGAGGAAGCATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTTTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCCTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAA
  5   1   2       bld Tad5                                 XZT15716.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGAAAGAAAAGGAAAGAACCAAAGCAATAACAGAAATATATCTAACTAGGCTGCTGTCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTT
  5   1   2       bld Brn4      in                        CAAL21000.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAG
  5   1   2       bld Gas7      in                         XZG18240.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTCAAGGGTACACTCCAGCAGTTTGTAGATAACTTCTTCCAGAGTGTCCTTAATTCCAATCAAGTGGTACCACCAGCTGTGAAATACTTCTTCGATTTCCTTGATGAGCAAGCAGAAAAATATGAAATCAAAGATGAAGATACTGTCCACATATGGAAAACAAACAGTTTATCACTAAGATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATATACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTT
  5   1   2       bld Mus1      in                         CABH6633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTTTGGGTGAATATACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCCTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACGGATCTTTGACCGGAACACCCCACTTAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAAACTGCTTT
  5   1   2       bld TbA       in                   TTbA003o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAATAACTGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCA
  5   1   2       bld Tad5                                 XZT35036.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAAAATCCACACTTTATTTTTGATGTGCATGTTCACCAAGTAGTAGATGCTTCCTTGTCAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGGTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTG
  5   1   2       bld Tad5      in                         XZT63787.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGTCATCGCACAGACTTTCATGGATGCCTGCAGCAGGACGGAGCACAAGCTTAGCAGAGAATCTCCAAGCAACAAGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGNGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAAT
  5   1   2       bld Tad5      in                         XZT32409.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCTTGTATGCAAAAGAGATCTCAACTTACAAAAAAATGGTGGAAGACTATTACAAGGGAATCCGCCAGATGGTACAAGTTAGCGACCAGGATATGAATACACATTTAGCAGAAATTTCAAGGGCTCACACGGAGTCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTAC
  3   1   2       bld Te4       in                         CAAN7827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCATAAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTT
  3   1   2       bld Te4       in                        CAAN10732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATTAAATACACTAGTAGCACTACATCAGCTGTATCAGTATACAAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATT
  5   1   2       bld Neu       in                   TNeu086h06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAATAAATACTACGATGAGATAATAAACGCTCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACATCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGG
  5   1   2       bld Egg       in                   TEgg078f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTGGAGGAGGATCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACA
  3   1   2       bld Brn2      in                        CAAJ15999.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGACCAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGAT
  3   1   2       bld Brn2 FLx  in                         CAAJ6495.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCCTGCAGCCCAGCGCATGCAGTTAGCATATCGGCTACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTAC
  3   1   2       bld Brn2 FLt5 in                        CAAJ12858.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCACTTAAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACG
  3   1   2      seed Brn4      in                        CAAL21000.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAAATAGCCGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTT
  3   1   2       bld Fat1      in                         CABC4536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCAGCACTAGAGAACAAAGTGACAGATCTTTGACCGGAACACCCCACTTAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGCGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGAT
  3   1   2       bld Brn3 5g3  in                        CAAK12585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGACAGATCTTTGACCGGAACACCCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTT
  3   1   2       bld Brn2      in                        CAAJ15475.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCACTTAAAACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACGGAT
  3   1   2       bld Te3       in                         CAAM5955.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACGTTTTCAAATTGAAGATGTTCAGTTTTTCCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTG
  3   1   2       bld Mus1      in                         CABH6633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCATAAGAGTGTTATATTTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGAT
  3   1   2       bld TbA       in                    TTbA003o20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTTAAAAAGTTTTATTACCTTTTTTTAAATCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTTTTCCCCCTCAGCTCATATTTGTAATAATTGGACAATGGGGGGGTTACCCCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCCCAGGGGGGGAAGTAACTGCTTTTTTTTGTGGCCAGATTTTAATGGGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTTTTCAATTCCTTTTTTTATTTTGAAGTTTTTTTTATATAAATATACATTTTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTTTTTTTGTGAAAAATTGTGACCAATTTAAGTTAATGAGGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCACTTGTATTAAAAATGTCCCTGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Te3                                  CAAM1416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCACCTGCCCGCGTATCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTT
  3   1   2       bld Gas       in                    TGas091e24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATTGTATACGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTTTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCGAGCGGGCCCTGTGACACCAAAAAAAGTTATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                         CAAN8023.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCCATGTAGAAAACTGTGCTAAAAGAGCCTTTTTTAATATCTCATATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGC
  3   1   2       bld Tad5      in                         XZT63787.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATATAATGNCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAACATACAAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACC
  3   1   2       bld Neu       in                    TNeu086h06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATAATTGCACAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTTCAACGGGCCTGTGACACCAGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                          XZT6053.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCACAATGAAGAGTTCAGGCATTAACTTTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATGC
  3   1   2       bld Tad5      in                         XZT32409.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATGAAGAGTTCAGCATTAACATTTTTACATTCATTATGCAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCTCATTGCAC
  5   1   2       bld Te5       in                         CAAO3758.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAACATACAACATTTTTAGTGTTATTTATAGTCGAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATANAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTTAAACTCACGGGCCTGTGACACCAGCAAATGA
  3   1   2       bld Limb                                CBSU7688.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATAGTCAAGCAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATG
  3   1   2       bld Gas       in                    TGas091e23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATACATGGAAAGAGCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTTTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAAATCGAANCGGGCTCTGTGACACTCAAAAATAAGTTAGTTAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3       in                         CAAM8904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAATCATTTCAGCATATTAGGACTTGGATAAACCACTCTTCCCCCTCAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTAC
  3   1   2       bld Spl1 5g3  in                         CABK2421.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGCTCATATCTGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTTATAATAAAGTACATTTTTTTGGAGGAAG
  5   1   2       bld Tad5      in                         XZT30947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGANAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCTCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCCAGCAATGAAAGCCTCATGTATTCATT
  3   1   2       bld Egg       in                    TEgg078f21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAATAATTGGACAATGTGGTGGTTACACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCACTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGGTATTTTTTTATAATAAAGTACATTTTTTGGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tail                                 CBSW2956.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAGTGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG18240.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATTTAATTTGTAACTGCATTTCCATTTTCCACTAAATGCCACAGGGGGAGAAGTAACTGCTTTTTATTGTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCACTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGC
  5   1   2       bld Tad5      ?                          XZT67016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACAGGNGGGAGAAGTAACTGCTTTTTATTCTGGCCAGATTTTAATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCTCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCCTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTATAATAAAGTACA
  3   1   2       bld Tad5      in                         XZT30947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGTGGTTAATTACTGATGTCAACGGTACCAAAAGAAGAGGTTTAATACATTTAAAGCACAAATCAAGATTTTTTTAGCTCTTCAATTCCTTTTTTTACTCTGAAGTTTATTTTATATAAATATACATTCTAATGTGCCTTATATGTAACATTTTAAGAAAAGACTGATACGTGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTACGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCTCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCCTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTATAATAAAGTACATTTTTTTGGAT
  5   1   2       bld Neu       in                   TNeu124o11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATTTTGTAAAGAATACATGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTTATAATAAAGTACATTTTTTTGG
  3   1   2       bld Neu       in                    TNeu124o11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATTTTGTAAAGAATACAGAAAATTTATTTATGCCACTGATTTTCTTTTTGTGAAAAATTGTGACCAATCTAAGTTAATGATGTATGAATACAGTAAACGTTGACATGATTATGTACAATTGTAATGTATCTCTTGTATTAAAAATGTCACTGATATTGTTTTTGGGAGCTTAATATTGCATTTGGGAGTATGAGTACGGTATAGTATATAGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTGTTTTATAATAAAGTACATTTTTT
  5   1   2       bld Egg                            TEgg103h05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCATTTCTACATTAGGACCATGCTGTAACATACAATATAGGAAAATATGAGGATTTGTGGTTTTAATTCAACAAGCAGCACCTGATTGTAACCTTGAGAACTCCAATAAAGAGTCTCGCATTGCACAATGACTGGCATCAGGCAGATGTTCTATTTACATATAAGCAATTAAACTCAACGGGCCTGTGACACCAGCAAATGAAAGCCTCATGTATTCATTTAAATACAATTGCCTCCTCGTTTTAGTATCTTGCATCATATCTAAGAAGTTATTTTTATCTAAAGGGATAGTGCCATCACATGATTACCTTGTTATTTTTTTTATAATAAAGTACA
  3   1   2       bld Te5       in                         CAAO3758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACATGATTACTTGTTATTTTTTTATAATAAAGTACATTTTTTGGAGGAAGCGTTAATGGTATTTTCATCACATAATAGATTTAGAATAAATAAATATATATATATAATTTTTTTCCAAACAGCAGTGCACATGTTCGAGTATATGACAAATTTTATCTTTGGAAAAAATTAAAGAAATTTTTAGAACCCCCGGTATCCATTTAAAAATGCTGATTTTGCCattgtttcccctactcactgtactgttaatatgacccaagtcacataaaagcaaactgggtttctccttcttgggtgctattctcatgtctaccactatgtggACATGGGGGTACATTTAGCAATGTGCACAATTTCTGAAATTGTTTTGATCTCTACTAAGCTGAAATCTTCTCCAGCCTTCAGGAAACTTGCTTTTTGGAAGGATGAGGTGTCTGGGTTGTTAGAAATCAATGCTTTTCATTGTATTTAATGTATTTGGGACTAAAGTTTCCACTGTATTGCCTGTATTTGTGGTGCAACTACTTTCTGCCTCTCGCTGTATTTTATGTGTTTTGGCTGACACCACTTTTGCCCCTAACTGATTCGTTTTGTAAAAAAACATGTTTTCCTGTTACAGTATTCCTTCAAGATATTTTACATACAATTGGCTTAATACTGAATGAGAGGTGGCTTAGTTATGTATTATTATAACATTAGTTATGTAAGATGTCTTCAGACACTTGTGATGATTACAATTACATTTCATACAAAGAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)