Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 17 Aug 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 99%

 1012153978 Xt7.1-CABE12370.3.5 - 42 ESTs
                                                                       -80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABE12370.3.5                                                                                 CCGAACCCGAGCATGACCTTCTGTCTCCTGGGGGCGGTACCGAGAGGCCAGGGATGATCTGCCCTGACTCCCAGACGCGAGAGATCGCAAGCACATCCCAGAAAGTGCAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCATGATGAATCAAGGATACCTGCAAGAGGCCTATTTTTGGACAAAGCAAGTTCTGACAATCATGGAGAAGTCTATAGTTCTATTAAATGATGTGACAGATGGCTCTCTCTATGAGGGAGTGGCTTACGGCAGCTACACCACCCGATCCCTTTTTCAGTACATGTTTCTTGTTCAGAGACACTTCGACATTAATCACTTCGGCCATCCTTGGCTAAAAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCATTAAAAAAAAAAA
                                                  Xt7.1-CHK-1008264995                                                                                       CCGAGCATGACCTTCTGTCTCCTGGGGGCGGTACCGAGAGGCCAGGGATGATCTGCCCTGACTCCCAGACGCGAGAGATCGCAAGCACATCCCAGAAAGTGCAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCATGATGAATCAAGGATACCTGCAAGAGGCCTATTTTTGGACAAAGCAAGTTCTGACAATCATGGAGAAGTCTATAGTTCTATTAAATGATGTGACAGATGGCTCTCTCTATGAGGGAGTGGCTTACGGCAGCTACACCACCCGATCCCTTTTTCAGTACATGTTTCTTGTTCAGAGACACTTCGACATTAATCACTTCGGCCATCCTTGGCTAAAAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAAxxxxTAAAAA
                                                      consensus depths                                                                                      2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     8     9     9     9     9     9    10     9    10     9    10     8    10     9    10     9    10     9    10     9    10    10    11    10    11    11    12    11    12    11    12    11    12    12    13    12    13    12    13    12    13    12    13    13    15    14    15    14    16    14    16    13    15    14    15    14    15    17    18    17    19    17    19    15    16    16    17    17    18    20    21    20    21    20    21    20    21    23    24    23    25    23    25    24    26    23    25    23    25    23    25    23    25    24    26    25    26    24    26    25    26    25    26    25    26    24    25    24    25    24    25    25    25    24    24    23    23    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    21    22    22    22    22    22    21    21    21    21    21    21    21    21    21    21    21    21    18    20    19    20    18    20    19    19    19    19    18    18    18    18    17    18    18    18    18    18    16    18    17    18    15    18    15    18    14    17    13    16    12    14    11    14     6    12     6     8     3     3
  5   1   2      ests                                 Xt7.1-CAAP7664.5                                                                                 CCGAACCCGAGCATGACCTTCTGTCTCCTGGGGGCGGTACCGAGAGGCCAGGGATGATCTGCCCTGACTCCCAGACGCGAGAGATCGCAAGCACATCCCAGAAAGTGCAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCA
  5   1   2      ests                                Xt7.1-CABE12370.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCTAAAAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTTAAATCATAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                               BLH ATG     206     400                                                                                 
                                               BLH MIN     152     172                                                                                 
                                               BLH MPR     128     172                                                                                 
                                               BLH OVR     206     238                                                                                 
                                               ORF LNG     206     261                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Sp ==== 1e-167     XP_787972.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PREDICTED - ?? ---- 0          XP_897855.1 PREDICTED: hypothetical protein LOC319901 isoform 2 [Mus musculus] ----------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 0          NP_001025396.1 hypothetical protein LOC568713 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Mm ==== 0          NP_766096.1 RIKEN cDNA B130024B19 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 0          NP_037484.1 squamous cell carcinoma antigen recognized by T cells 2 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 0          XP_419777.2 PREDICTED: hypothetical protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABE12370.3.5                                                                                                                                      ATG------------------------------------------------------------------TGA---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATGATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------ATG---------------------------------TAGATG------ATG------------------TAA---------------------------ATG------TAA------------------------------------------------------ATG---------------------------------------------------------------------------------------TAA------------TGA---------------------------------------------TGA---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  0   1   1           Gas  FL                     TGas062f12.FL-Sanger                                                                                                                                                                                             AGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCATGATGAATCAAGGATACCTGCAAGAGGCCTATTTTTGGACAAAGCAAGTTCTGACAATCATGGAGAAGTCTATAGTTCTATTAAATGATGTGACAGATGGCTCTCTCTATGAGGGAGTGGCTTACGGCAGCTACACCACCCGATCCCTTTTTCAGTACATGTTTCTTGTTCAGAGACACTTCGACATTAATCACTTCGGCCATCCTTGGCTAAAAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTCGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CAAP7664.5                                                                                 CCGAACCCGAGCATGACCTTCTGTCTCCTGGGGGCGGTACCGAGAGGCCAGGGATGATCTGCCCTGACTCCCAGACGCGAGAGATCGCAAGCACATCCCAGAAAGTGCAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCA
                                                  Xt7.1-CHK-1008241736                                                                                       CCGAGCATGACCTTCTGTCTCCTGGGGGCGGTACCGAGAGGCCAGGGATGATCTGCCCTGACTCCCAGACGCGAGAGATCGCAAGCACATCCCAGAAAGTGCAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCATGATGA
  5   1   2       bld Egg       in                   TEgg051j18.p1kSP6 GGAATTGTAGTTTTGCAAGGACTTGTTTGGTCTCTCGGAGTAGCGGGAGCGGTGGGTGCTGGAGTGTTCTGGCTAGGGCTCCGAACCCGAGCATGACCTTCTGTCTCCTGGGGGCGGTACCGAGAGGCCAGGGATGATCTGCCCTGACTCCCAGACGCGAGAGATCGCAAGCACATCCCAGAAAGTGCAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTG
  5   1   2   10 seed Int1 PIPE in                         CAAP7664.5p ................................................................................CCGAACCCGAGCATGACCTTCTGTCTCCTGGGGGCGGTACCGAGAGGCCAGGGATGATCTGCCCTGACTCCCAGACGCGAGAGATCGCAAGCACATCCCAGAAAGTGCAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAG
  5   1   2       bld Egg       in                   TEgg007n19.p1kSP6                                                                                                                                                                                   AATCCCCGGGAGTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAAT
  5   1   2       bld Gas  FL   in                   TGas062f12.p1cSP6                                                                                                                                                                                              GTGTGGGTCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAAC
  5   1   2       bld Neu  5g                        TNeu028l15.p1kSP6                                                                                                                                                                                                     TCGCTCTGATTTCTCTGGACTTGGCTCAGAGAGTCCGGCTGTATCAAAGATGGTCTGGCAGAGCTGGTGGCCTGGAGATCTAATGTCACAATGAGGACTCACACTCGGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCANGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCATGATGA
  3  -1   2       bld Int1      in                         CAAP6904.3p                                                                                                                                                                                                                                                                                                      TCACACTCGCGGGAGCCCCCAGTGTATTTTTCATACATTTGCTTTGTTACATTGTGGTTTACTGCACAGAAAAGGACATAAATACACAAATACCATTCCTTAATGCAAAATATGATGGCTATCCCATGCTATACTTCTCCAAGGGTGAGATGGAAACACTTCGAGCCCAGGCAGCGAGCAGCCATCAGCACATTTCTGCAAGAATTAATGAGGCAGTTCATGTAATGCTGACCAACCCTAGTGAGTACCTTCCCCCATGGGATCCAAAGGAGTTTTCTGCTCGATGGAATGAAATTTACGGCAACAACCTTGGTGCGCTGGCAATGTACTGCGTTTTGAATCCAGATAACACTGAAGCACTTGGCCTGGCCAGAGAATATATGGAAAGGATGGCAGCTCAGCCTAGTTGGTTAGTGAAAGATGCTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCATGATGAATCAAGGATACCTGCAAGAGGCCTATTTTTGGACAAAGCAAGTTCTGACAATCATGGAGAAGTCTATAGTTCTATTAAATGATGTGACAGATGGCTCTCTCTATGAGGGAGTGGCTTACGGCAGCTACACCACCCGATCCCTTTTTCAGTACAT
  5   1   2      ests                                Xt7.1-CABE12370.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCTAAAAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTTAAATCATAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227334                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTxAAxTCATAAAAAAAA
  5   1   2       bld Liv1      in                        CAAR11907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCCATGGGATGAAGTTCCCTTGGCACACTCTCTGGTTGGCTTTGCTACAGCTTATGACTTTCTTTACAACTCCTTTAGCAAGCAACAGAAGGTGAGGTTTCTAGAGGTAATCGCCAACGCCTCCGTAAATATGTATGAAACCTCATTCAGGAGAGGATGGGGCTTTCAGTACATTCACAACCATCAGCCCACCAATTGTGTGGCCCTGCTAACTGGAAGTTTGGTCATGATGAATCAAGGATACCTGCAAGAGGCCTATTTTTGGACAAAGCAAGTTCTGACAATCATGGAGAAGTCTATAGTTCTATTAAATGATGTGACAGATGGCTCTCTCTATGAGGGAGTGGCTTACGGCAGCTACACCACCCGATCCCTTTTTCAGTACATGTTTCTTGTTCAGAGACACTTCGACATTAATCACTTCGGCCATCCTTGGCTAAAAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGNGGTGTAGTGACTTATGGAAGTTCCCTACCTGC
  5   1   2       bld Te1       in                         CBWN6468.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCTAAAAGAGCACTTTGCATTCATGTACAGAACCGTACTTCCAGGCTTTCAGAGAACTGTGGCTATAGCAGATTCCAATTATAATTGGTTCTATGGACCTGAGAGCCAGCTGGTGTTTTTAGACAAATATGTCTTGAGAAATGGAAGTGGTAATTGGCTGGCTGAACAGATTCATGCAAACCGAGTGCAAGAAGGTCCTGGAACACCAGCTAAAGGACAGCGCTGGTGCACCCTTCATACTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTCGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAAGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAATACAAA
  5   1   2       bld Gas1      out                      IMAGE:6990290                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTCTGAGTTTCTTTGGTATGATGCAACTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTAATCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATTTCACTTAAACGTGGCAGCACTCTGGAAGCAACTTCCACCTTTTTCCCAATGTGAAATGCCCTTTGAGGCACCTCCATGAAAGGTCCTTGGACCATATTAGCCCAAAAATGAAGTTAAAATTACTGAAGGAGACCTGCCCAGTGAAACATTTTGTTAATTTTCCCCGGGTTCA
  5   1   2       bld Ova1      in                         CABE8328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTACAGTCTACTCCTCCACCTGATTTTGGCACACCTCAGCTGCACTACTTTGAAGACTGGGGTGTAGTGACTTATGGAAGTTCCCTACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGA
  5   1   2       bld Ova1      in                         CABE8498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACCTGCGGAAATTAACAGACCTTTTCTTTCCTTTAATCAGGAAAGCTTGGAGGCCGTGCTATATTTGACATTGTTCACAAAAATAAGTACAAAGACTGGATTAAAGGATGGAGAAATTTTAATGCTGGACACGAGCATCCAGATCAAAACTCTTTTACATTTGCTCCTAATGGATTTCCCTTTATAACTGAAGCTTTATATGGACCAAAATATACTTTCTTAAATAATGCTTTAATGTTCTCGCCTTCTGTGTCCGAGAGCTGCTTTGCTCCATGGCAAGGTCAGGTAACAGAAGACTGTACTTCTAAATGGCTAAAATACAAACAAGGGGAAGCTGCAGACTCTCAAGGAAGGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACA
  3   1   2       bld Egg       in                    TEgg051j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGTGGTAGCTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Eye       in                         CCAX7809.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGCTGTGGAAAAATCTGGGGTTGTTTTTATCAGGGGTGAAGGGGTTGGAGCCTACAGTCCTAACTTGAAATTGAAAAGTGTTCAAAGAAATCTTATCCTGCTACATCCACAGTTGTTACTTCTTGTAGACCATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACAGCTGAACGTCTGCTTAGGTT
  3   1   2       bld Te1       in                         CBWN6468.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATATTCACTTAGACCGTGGCAGCACTCTGGAAGCAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg007n19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACTTCCAGCTTTTTCCACAATGTGGATATGCCTTTTGAGGCAACCTCCATTGATAGTGTCCATGGAGCAATAATTAGGCACAGAGATGGAATGTATAAGATGTACTGGATGGATGACACTGGTCAGAGTGAGAAAGCAGTCATTGCTTCAACTTCTTACCCACAGGGTTATCCATACAATGGAACTAATTATGTGAATGTCACAACATACCTCAGGAAACCTATCACAAGAGCCATATATGTTTTTATAGGACCTTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                  XZT8185.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTATATGTTTTTATAGGACCCTCTGTGGACGTTGAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTC
  5   1   2       bld Tad5                                 XZT24437.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGAGCTTTAGTGTCCATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGGTATCAGTCTCAATGTTAGATGGCAGACATGTC
  5   1   2       bld Egg       in                   TEgg022a21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTAGTGTCCATGCGAGATTATCATCGAGTTGATGAGTATCTTGCTACCAGGGAACATGCATATGCTGCTTACATTTTCACGGGAGAGACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTACGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAGATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCAC
  5   1   2       bld Gas8      ?                            st9f24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATGGAGATTATCAGCAAGTTGATGTGTATCTTGCTACCAGTGAACATGCATATGCTGCTTACATTTTCACAGGAGAAACACCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACAGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTC
  5  -1   2       bld Gas                            TGas033c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTGAAGCAATGANTGCTTTCTCACTNTGACCAGTGTCATCCATCCAGTACATCTTATACATTCCATCTCTGTGCCTAATTATTGCTCCATGGACACTATCAATGGAGGTTGCCTCAAAAGGCATATCCACATTGTGGAAAAAGCTGGAAGTTGCTTCCAGAGTGCTGCCACGGTCTAAGTGAATATGGTCTACAAGAAGTAACAACTGTGGATGTAGCAGGATAAGATTTCTTTGAACACTTTTCAATTTCAAGTTAGGACTGTAGGCTCCAACCCCTTCACCCCTGATAAAAACAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTC
  5   1   2       bld Ova1      in                        CABE12370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGCACGAGGGAAACCCTAGCCAGTCCATCTATGCTAAAGTCGTTGCAGATAGACAGAAATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACAGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTANCAGTTTGCCTTCCCCTTACATCGTGCTGAAACACACA
  5   1   2       bld Ova1      in                         CABE1419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTTGTCTTTGACAAGACCTCCTCCATCGGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACAGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCG
  5   1   2       bld Spl2      in                        CBSS5794.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAGCTCTTCTCCAGAGGAAGTTAAAGATTATTCTGCGATTGTAGAGCAGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACAGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGC
  5   1   2       bld Egg       in                   TEgg031k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAATCTCCAGCACTTTAAGCCGGTTTTTCAGGAAATGGAGAAGCAAATTCTGTCTCATGTTAAAAACACGGCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACCCCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTA
  3   1   2       bld Ova1      in                        CABE12370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGTAAAAACACGGCCAGCTTTAGAAAGACAGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCAT
  3   1   2       bld Gas  FL   in                    TGas062f12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAAAACACGGCCCAGCTTTAGAAAGACGGCTGAACGTCTGCTTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCCAGTTTATCATATTAAAGTATAATTAAATCAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Int1      in                         CAAP6904.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGCTTTAGAAAGACAGCTGAACGTCTGCCTAGGTTTTCAGATAAAAGAAACACGGAGGAGGCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAAT
  3   1   2       bld Ova1      in                         CABE8328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTATGGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCATAAAAAAAAAA
  3   1   2      seed Ova1      in                         CABE8498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAAGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCAT
  3   1   2       bld Liv1      in                        CAAR11907.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTATTGAAAAAATATTTTCAGTATCTCAGCAACAGAGGCAGCAAGGCAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATAAAAAAAAAAAAA
  3   1   2       bld Int1 PIPE in                         CAAP7664.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTATCTCAGCAACAGAAGCAGCAAGCAAAACCAAAAAATTCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATC
  5   1   2       bld Gas7      in                         XZG20989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAACCAAAAAAATCAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATG
  3   1   2       bld Gas7      in                         XZG20989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGAAGGCCACAAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCAT
  3   1   2       bld Ova1      in                         CABE1419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCAT
  3   1   2       bld Spl2      in                        CBSS5794.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCAT
  3   1   2       bld Egg       in                    TEgg031k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAATGACAAATTTATAAATGCTGTACCAGATTTATTTGCACAAATAGAAGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT14845.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTCAACGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTATTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCATAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT14845.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAGTCAACGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTATTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCATAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA022e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTCAATGAGAAGCAGACGCGCCAAAAAGCTATGGCTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTTTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGTTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTATGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTTTGGTGTATACTTGAAATGAATGCTTAACATAGGGGTAGGGATACAAGTTTGCCTTCCCTTACATCCGTGATGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATGTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGGTTAGATTTTTCAAAGAAAAGGGGTATGGAAGGAAAAGTGAATAAAATTGTAACTGTAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Eye       in                         CCAX7809.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCCGCCAAAAAGCTATGGCTTCTGGCACAGAGTGAACTTCCAGTCAATGAAGAAGAAGAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTTTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCCCATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTTTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGCTGAAACACCCAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATTTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCATGAATAAAATCAGTTTATCATATTAAAGTATAATTTAAATCATA
  5   1   2       bld HdA       in                   THdA022e09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCACAGAGTGAACTTCCAGTCAATGAACAAGAACAAATGAAAGACCTTTTGGACTTTGTAGATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCTATACTGCTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCAAGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACTAGTTTGCATTCGCTTACATCCGTGCTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTCATATTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGT
  3   1   2       bld Egg       in                    TEgg022a21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATAAACCTCAAGTCAAGCAAAAATCTGTTTCTGTTAGCAAACATGTATCCCCTCACATGTTAACGACTTTCCACAGCGGGACTTCTATTTCGGACTCCTACACCAGACTGTTTTTAATTCTAAACATTTCCATCTTCATGGTCCTGTTAGTGCTACAGCTATCTCGGTTCCTGAAGCCAAAGGGTATGCAACAGAAAAGATGTCTGTATGCTATACTCACATTGGATTTTTGTATATTGATGTGGCTGTATTTATCATGTTATCAGTCTCAATGTTAGATGGCAGACATGTCAAATTGCTTCAACTGTTAAGCAGTAAGTGTCTGGTGTATACTTGAAATGAATGCTTAACATAGCTGTAGGGCTACAAGTTTGCCTTCCCTTACATCCGTGGTGAAACACACAATGGCCAGTGTGTGGAGAGAGTCCGTAATATTCAAATTCATCTACAGCACAGAAATTCAAAAATCACTTTTTAGGGGGTTTATTTTTTTATAAAGAAAAGGGGTATGAGAAGGAAAAGTGAATAAAATTGTAACTGTACCTACTCCTCTGTCAGGAATAAAATCAGTTTTCATAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)