Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 297.0    0Xt7.1-XZT35688.5                           14 PI      74       1457     2101                Rfx3 protein [Xenopus tropicalis]
     2 290.0    0Xt7.1-CAAJ14745.5                           4 PI      81        677     1026                Rfx3 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 91%

 1012153989 Xt7.1-TGas108b03.3.5 - 113 ESTs
                                                                       ...-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas108b03.3.5                                                                                                                                                                                                                                                                                                                                                                  TTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAAT
                                                  Xt7.1-CHK-1008265905                                                                                                                                                                                                                                                                                                                                                                        CCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTxxxxTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                       4     5     5     6     6     7     8     9    12    13    14    15    17    18    17    18    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    20    19    20    19    20    16    20    17    21    16    20    16    20    16    20    17    21    17    21    17    21    17    21    17    21    17    21    16    20    16    20    14    18    13    18    12    16    10    14     6    11     6    10     6     9     5     7     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     7     8     7     8     6     7     5     7     5     7     5     7     5     7     5     6     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     5     6     6     7     6     7     6     7     7     8     7     8     9    10     9    10     9    10    10    12    11    12    11    12    11    12    12    13    12    13    12    14    11    13    11    13    12    13    12    13    12    13    14    15    13    14    13    14    13    14    13    14    13    14    14    15    16    16    16    16    16    16    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    20    20    20    20    20    20    20    20    20    20    19    19    19    19    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    11    15    11    15    11    15    11    15    12    16    12    15    12    15    12    14    12    14    14    15    15    16    15    16     8     9     5     6     5     5     7     7     6     6     6     6     6     6     6     6     6     6     7     7     7     7     9    10    10    11    11    11    13    13    13    13    13    13    13    14    14    14    14    14    15    15    18    18    18    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    23    23    23    23    22    22    22    22    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    20    19    19    19    19    19    19    20    20    20    20    20    20    20    21    20    21    20    21    20    21    20    21    19    20    19    20    18    21     4     4     4     4     2     4     3     6     3     6     3     6     3     6     3     6     4     7     4     7     4     7     4     8     4     8     4     8     4     8     4     8     4     8     4     9     4     9     4     9     4     9     4    10     4    10     4    11     4    11     4    11     4    11     4    11     4    11     4    11     5    11     5    11     6    12     6    12     6    12     5    13     7    13     7    13     7    13     7    13     7    13     7    13     7    14     7    14     7    14     7    14     7    14     7    15     7    15    14    17    14    17    14    17    15    17    15    17    15    17    15    17    15    17    15    17    15    16    16    16    16    16    15    15    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9    10    10    10    10    10    10    10    10    10    12     7    12     8    14     8    14     9    17     9    18     9    18     9    18     8    17     9    18     9    21     7    21    10    24    10    24    10    24    11    25    11    25    11    24    11    24    10    24    13    24     7    24     7    23    15    23    19    23    22    23    23    23    23    23    23    23    22    22    21    22    22    22    22    22    22    22    22    22    21    22    21    22    21    22    19    22    22    23    22    23    22    22    22    22    23    23    17    23    17    23    17    23    17    23    17    23    17    23    16    23    16    23    16    23    22    23    16    22    16    22    15    21    13    21    14    21    13    21     9    21    11    19
  5   1   2      ests                               Xt7.1-TGas108b03.3                                                                                                                                                                                                                                                                                                                                                      GCAACAGTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCCAAAAAA
  5   1   2      ests                                 Xt7.1-CABG9654.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTCACACTTGCTTTGGCCCTCTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAGGTTTTTTTTTTCATGTAGAATATTATATAGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                               BLH ATG     166     469                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     157     281                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     166      16                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI      30      16                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     166       5                                                                                                                                                                                                                                                                                                                                                                  
                                                                       PROTEIN --- Dm ---- 2e-142     NP_649999.2 CG6312-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 2e-179     BAE06671.1 regulatory factor X [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Sp ==== 0          XP_790942.2 PREDICTED: similar to regulatory factor X3 [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xt ---- 0          AAI21501.1 Rfx3 protein [Xenopus tropicalis] -----------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 0          NP_033082.1 vregulatory factor X, 2 (influences HLA class II expression); regulatory factor(trans-acting) 2 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 0          NP_001013296.1 zgc:91808 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 0          NP_000626.2 regulatory factor X2 isoform a; trans-acting regulatory factor 2; DNA bindingprotein RFX2; HLA class II regulatory factor RFX2 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Gg ---- 0          XP_418212.2 PREDICTED: hypothetical protein [Gallus gallus] -----==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          AAI08518.1 MGC130921 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 0          NP_001090132.1 hypothetical protein LOC735210 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas108b03.3.5                                                                                                                                                                                                                                                                                                                                                                   TGA---------------------------------------------------------------------------------------------------------------------------------TAA---------TAG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------ATG------------ATG------------------------------------------------------------------------------------------------------ATG------ATGTAG------------------------------------------------------ATG------------------------------TAA---------------------------TAA---------------------------ATG---------ATG---TAG------TGA------------------TAA------------TAA------------------------------------------------TGA---------ATG---ATG---------------------------------------------TGA---------------------TAA------------------------TGA------------------TGA---TAA------------------------TAA---------TGA------------------------------------------------------------ATG------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------TAA------------------TAA---------------------------------------------------TAA---------------------------------------TAA---------------------------TGA------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------TAA---------------------------------ATG------------------------------------------------------------------------------------------TAA------TAA------------------------------------------ATG------------ATGTAA------------------TAG---TAGATG---------------------------------TAG---------------TAA------------------------------------------------ATG---------------TAG---------------------TAATAG------------------TGA---------TAG------------------------------------------------------------------------------------------TAA---------------TGA------------------------------------TGA------------------------ATG------------------------------------ATG------------------------------------------TGA------------------------ATG------TGA------------------TGA---------------------------------TAATAG------TAG------------ATG------------------------------------------------TAAATG---------------------------------------TAA------------------------------------------------ATG------------------------------TAA---------ATG---------TAG------------------------TGA---TAA------------------------------------------------------------------------------------------------------------------ATG------------------------TGA---------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------TAA------------TAAATG---TAA---------------------------TGATAG------------------------------------------------ATG---------------------------------------TAA------TAG------------------ATG---------------------------------------TAA---------------------------ATG---------------------------------------------------------------------------ATGTAA---------TGA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2      ests                               Xt7.1-TGas108b03.3                                                                                                                                                                                                                                                                                                                                                      GCAACAGTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCCAAAAAA
                                                  Xt7.1-CHK-1008224299                                                                                                                                                                                                                                                                                                                                                            GTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAA
  5   1   2   14  bld Te4  5g3  in                        CAAN10717.5p .........................................................................................................................................................................................................................................................................................................................CGGTTAGTGACGTCAGAGGGAGAGGATAGCAACAGTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAACTTATCCGCTCAGTGTTCATGGGCTTGC
  5   1   2       chi Fat1      in                         CABC7415.5p                                                                                                                                                                                                                                                                                                                              CGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGAGAAGTTTGTCTCAAGCATCTGGCTCTGCTCCCAAAGGGGCACATGGTCAGGGTATCTCTGTACCCAGAGCCCACCAGTTACAGCAGCAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCTTGCTACGCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGTCTTGGTACCAGGGGGTACTCCAAGTACCATTATTATGGGATCGCCTA
  5   1   2   14  bld Te4  5g3  in                         CAAN7777.5p .................................................................................................................................................................................................................................................................................................................................................GATAGCAACAGTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGTAA
  5   1   2   14  bld Te4  5g3  in                        CAAN12513.5p ......................................................................................................................................................................................................................................................................................................................................................CAACAGTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCT
  5   1   2   24 seed Te4  5g                              CAAN4440.5p ......................................................................................................................................................................................................................................................................................................................................................CAACAGTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGC
  5   1   2   14  bld Te4  5g3  in                         CAAN1908.5p ..................................................................................................................................................................................................................................................................................................................................................................TGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGAC
  5   1   2   24  bld Te4  5g                              CAAN8678.5p .........................................................................................................................................................................................................................................................................................................................................................................................CTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACA
  5   1   2       bld Egg  5g                        TEgg093a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                CCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTG
  5   1   2   12  bld Gas7 5g3  in                         XZG50016.5p ....................................................................................................................................................................................................................................................................................................................................................................................................GAGACAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACATCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCCGCCTA
  5   1   2   12  bld Gas7 PIPE in                         XZG51107.5p .......................................................................................................................................................................................................................................................................................................................................................................................................GACAGTTACTTGCCACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGTCTTGNTACAGGGGTAACTCCNAGTACCATTATAT
  5   1   2   14  bld Te3  5g3  in                         CAAM1259.5p ........................................................................................................................................................................................................................................................................................................................................................................................................CAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGA
  5   1   2   14  bld Te3  5g3  in                         CAAM4563.5p ........................................................................................................................................................................................................................................................................................................................................................................................................CAGTTACTTGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAA
  5   1   2   14  bld Te3  5g3  in                         CAAM6580.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................CTAGCCAACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCC
  5   1   2       bld Te4       in                        CAAN11518.5p                                                                                                                                                                                                                                                                                                                                                                                                                      ACCGGAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGT
  5   1   2       bld TbA  5g3  in                   TTbA007c10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                          GAGACACACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTAAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTAC
  5   1   2       bld HdA  5g3  in                   THdA003j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                CACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCTGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAAATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCC
  5   1   2   14  bld Brn3 5g3  in                         CAAK1393.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................CACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGTCTTGGTACAGGGGTAACTCCNAGTACCATTATTATGGGATCCGCCT
  5   1   2   14  bld Te4  5g3  in                         CAAN4461.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................CACGGAGCAGCAGTGGCCGGAGAAGTAACCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTT
  5   1   2   24  bld Te4  5g                              CAAN6308.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCAGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCAGCACAAGCTCCCGTAGTGCAGCCCGTACCAGCATCTCAACAGGTCCAGACTGTCCAGCATGTCTACCCAGCTCAAGTGCAGTATGTGGAAGGAGATACAGTTTACACCAATGGAGCCATCCGTACGGCTTACTCCTATAATGCGGAAGCCCAGATTTACGCACCCAGCAGTGGATCCTCCTACTTTGACTCTCAAGGAGGCGGTGCTCAGGTTACCACAGTGGTCTCAAGCCCTACAGCTATCCCTTCCCACAGTATGGTGGGTATCGCAATGGATGTGAGTGGCAGCCAGATCATCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACAC
  5   1   2       bld Gas                            TGas069k18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGCAGCCAGATCACTCTCTAGTTCTGGAGCATACCTTATCCATGGAGGACTGGAGAATTCTCGCCATACACCATCTCACACTTCTCGTACTTTCCCTGCTACGCTTGAAATGGCGATTGAAAATCTCCAAAAAAATGAAGGCATCACTTCTCACAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGTCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTT
  5   1   2       bld Hrt1      in                        CAAQ11016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCGTGCCGCAAAAGCAGCTTGCTCAACAGCCATCTTCAGTGGCTGTTGGATAATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGTCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGAGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCATTCGGAAATTTGCAAAGAGTTTGGAGGGCTGGCTTACAATGCCATGTGT
  5   1   2       bld Te4       in                         CAAN1508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTATGAGACGGCAGAAGGTGTGAGCCTCCCTCGCAGCTCACTTTATAATCACTACCTGCGACACTGCCAGGACCACAAACTTGATCCAGTAAATGCTGCATCCTTCGGCAAACTTATCCGCTCAGTGTTCATGGGCTTGCGAACACGACGCCTTGGTACCAGGGGTAACTCCAAGTACCATTATTATGGGATCCGCCTAAAGCCAGATTCTCCTTTAAACCGTCTGCAGGAGGATACTCAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTCCCCCCAGC
  5   1   2       chi Egg  5x   in                   TEgg072g19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGGAGAGGATAGCAACAGTTGCCTTGAGACCCCCGGCGCCATAGTGACTGTAGCCGTGGAGACAGTTACTTGCCAACCGGAGACACACGGAAGCATCAGTCGGCCGGTACAAGTAACCTCTGGGGATAGCGGAGCCATCATCAGCGCAGCACCGCGTACCATAACTGCCTGGGTAGCCGGACGGAGAAACCAGCATGCAGAATTCGGACAGTGGATCAGACTCTGCAACATCTGTTGCTCTAAGGACATCAGCATCATCAACGATTTATACATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCGATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCGATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCT
  5   1   2       bld Egg                            TEgg082f14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGATTCTCCTTTAAACCGTCTGCGGGAGGATACACAATACATGGCAATAAGACAGCAACCCATCCACCAGAAACAAAGATACAGGCCTGCACAGAAGATGGATGGCATGGGAGAAAATACAGCCAACAGCAGCCAGCATACCTCTCCAGAGCAATCTGTTGCAGCTCAAAGTCAGCATCATCAGCAATTTATAGATACAGCCCATGTGTTTCCAGACTTTCCAGCGCCTGATTTGGGCAATGTGCTTCTACCAGAAGGCATAACTATGACTGACATAAAAAATCTGCAGCTTATGTACCGGCGCCACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGC
  5   1   2       bld Te1       in                         CBWN8553.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTGTGAGGCTACAATTGATGTGGTGATGAATCTACAGTTCCAGTACATTGAGAAGCTATGGCAGGCTTTCTGGAACTCCAAGCCTTCTTCTCCTGATGGTTCCAACCCAATGAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCT
  5   1   2       add Te4       in                         CAAN2522.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAACAGTGAGGATGAACAGGAGCCCATTATCCCGAAAGACAAGCTGATGGTGCTTTGTAAATATGAACCCATTATGAGGTGGATGAGAAACTGTGACCACATTCTTTACCAAGCACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTGAGTAGCAGCTGCCTGCTCATGTTATTGCTTGTATTTTATTTTTTTATGCTTTGTATTTATAAAACCATGCTTATGTCTGTTCCTCTGACTGTCAGTGTAGTCCAACTGAAATACTCCAAAATTCCTATACAGACAATTCTGGCTTAATTTAGCATAACACTTTTTTAAGCTGTAGAAGCCACTAGAGAAAAGTTTACCTTTATATGTAATTCTACAACCGGTTATGCACACTGGAAAGGATTTGGTTTCTAAATTTAAAGGGAACCTTGGGCTGTTCTCAACAGCCTTTCTCAGCACTAATCAAAGCTTACGGAAACTTCTGTACTTGATGCCCAATATTTGTTGCGTGTAGTCATCAATATGTTTGCACAGGAGTGAAATACCGCATGATAGGACAGGTCTCTAGACAGGCTGTAGCAACATTAGTGGAAAATCTAATATATTTGTTCAAAATGGGGCTATATAAATATGAGGTGGGCTTCTTCCCAGATCAGAAGGTAAAGCATACCAGTTTATAAGTTAGCTTAAGACCAGAATCTTGGGCATGTTCAAATTCTCTTGTTTTTTAATTGCAAAG
  5   1   2       bld Lun1      in                         CABD4498.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACTGGTAGAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTNCATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCCTGAC
  5   1   2       bld Gas7      in                         XZG36060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGATACTCATCCCTGATGTACTGAGACCTGTTCCCAGTACATTGACCCAGGCAATTCGGAATTTTGCAAAGAGTTTGGAGGGCTGGCTTACAAATGCCATGTGTGATTTCCCCCAGCAGATAGTTCATGCCAAGGTTGGAGTAGTAAGTGCTTTTGCACAGACACTACGCCGTTATACTTCCCTAAATCATTTGGCGCAAGCTGCACGAGCTGTGCTTCAGAATACATCACAGATTAATCAGATGCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTTTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTG
  5   1   2       bld Te1                                  CBWN4392.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTCAGTGATCTAAACCGTGTTGACTTTGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCC
  3   1   2       bld TbA  5g3  in                    TTbA007c10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCCAATGTCCAGGAGCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Te4       in                         CAAN1508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGGCTTCATGGGTGTGCCAGTGTGAAGAAGGTATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATTCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTT
  3   1   2       bld Te4  5g3  in                         CAAN7777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATGGTGCAGAAGCTGGAGCAAGACTTCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATTCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTAC
  3   1   2       bld Te3  5g3  in                         CAAM1259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAAGCTAACCCTGCAGCAGCAGAGCTCATTGGACCAATGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATTCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTT
  3   1   2       bld Te4       in                        CAAN11518.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGCTAACCCTGCAGCAGCAGAGCTCATGGGACCAATGGGCAAATTGGTTGGATAATGTGNTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTAC
  3   1   2       bld Te4  5g3  in                        CAAN12513.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGGGCAAATTGGTTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATTCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACAT
  3   1   2       bld Te4  5g3  in                        CAAN10717.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGGCAAATTGGTTGGATAATGTTGTCACTCAGGTGCTGAAACCACACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATTCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTT
  3   1   0       chi Te4  FL   out                        CAAN7357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACACAAGCCTTGAAACCGTATGAAGGACGGCCCAGCTTTCNTAAAGCAGCCCGGCAATTTCTGCTCAAGTGGTCATTTTACAGTTCTATGGTTATTCGAGACTTAACCTTGCGCAGTGCTGCCAGCTTTGGTTCTTTCCACCTGATCCGCCTTCTCTACGATGAATACATGTTTTATTTAGTTGAGCACAGAGTTGCCCAGGCAACTGGAGAATCACCAATTGCAGTCATGGGAGAGTTTGGAGATTTAAATGATGCATCCCCAGGAAATATGGAAAAAGATGAAGGCAGCGATGTGGAGAGTGAGATAGAGGAAGAGCTTGATGATTCTGTAGAGCCCCCAGCCAAGAGGGAAAAGACGGAGCTGAGCCAAGCGTTCCAGGTGGGCTGCATGCAGCCATCGCTGGAGGGGAGCGTTCAGCAAAGCCTGGTCTTAAATCAGCTGCACAGCGAGCACATTGTTACAAGCACTCAGACCATCAGGCAGTGCAGTGCCACCGGGAATACCTACACTGCCGTCTAGCGCAAACAAAAGCTTGCAGAAATGAGATGTAGAAATATATCTATGTCGGGCTTAAATGAGTGGCGGCAGAACAGAATATGACTGAAATGTGACTGTTTCTGGCCTTTCAGACCCACCTTTTTTATCTTTACCCCCCCCCCCCAAGCATTTGCCCCTCCAACTCTTGCATTGTAAAGTAGATTTTCCAGGCAGTTCATGGATTTTATTATGTTTTAATATACCCAAACCTTTCTTTCATTTTAG
  5   1   2       bld Gas8      in                          st80k22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACGAAGGAAGTCCCAGCTTCCCAAAGGCAGCCAGGCAGTTTCTTCTCAAGTGGTCATTCTACAGTTCAATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTC
  5   1   2       bld Neu                            TNeu043d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTCCCAAAGCAGCCAGGCAGTTTCTTCTCAGTGGTCATTCTACATTCATGGTGATCCGAGACCTTACTCTGCGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTT
  3   1   2       bld Te1       in                         CBWN8553.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCAGTGCTGCCAGCTTTGGGTCTTTCCACCTTATACGCCTGCTTTATGATGAGTACATGTTCTACTTGGTGGAACACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTAAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT65520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAGAGTGGCACAGGCAACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGT
  3   1   2       bld Te5       in                         CAAO9544.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATTCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTT
  5   1   2       bld Te5       in                         CAAO9544.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGGGCGAGACTCCCATTGCAGTTATGGGGGAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATTCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTAAAAAAAAAAAAAAA
  5   1   2       bld Gas       in                   TGas108b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGTTTAGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTT
  5   1   2       bld Gas0                                 dad17b08.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGGGGTGACTTTGCTTCAATGTCTCCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAAT
  5   1   2       bld Neu       in                   TNeu062n20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAGTGCTGATGGATAAAGATGATGTCAGTGAGCTTGGGAGTGATAACGATGGGGATCCTCGAATTTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGC
  5   1   2       bld Gas7                                   XZG508.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTGGTCAGCCTCCAGTTAAAAGAGAACGTGTGGATCTGAATCACTCAATGCAAGAAATGTAGACTGGAGTTTCTGCGCCTTATTATTCCCTGACAAATGGGAACTTGTCACCTCTGATGCAGTCTGCCTTGTCACAGTGTAGTGCCTCTTAAACTCCCACAAGAATCCTTTTCCCCAGGTAATCCTCTGTGTCTAGTGGATATCAGCATATGGATGGAAGAATGACCTAGTGGCACTGACAATCACATCTGGCTCCATAATGCCACACATCATAAACTTTTTTTTTTCCTCCTATCAACTACCACTCTCTAAGTAATGAGCAGTGACTCTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCT
  5   1   2       bld Gas       in                   TGas064b21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGTTATGGATATGGATTTTTTTCACTATTTATCAGATCCTTTTTGGGTGAAGAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTC
  3   1   2       bld Te4  5g3  in                         CAAN4461.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAGCAATGACCACTCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGGAAAAAAAA
  3  -1   2       bld TpA       in                    TTpA006g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTCTGATGGGACTCATTAAATATCTAATATACTTTACATAATTTGACTCTTACCTCATCTATACTGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTC
  5   1   2       bld Egg                            TEgg088k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTG
  5   1   2       bld Egg                            TEgg088k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGAATTTAAAGTGGGCTGGTTTTATTTGCCAAATAACAGTGTGTTTGATACCACAGAGTGTCTGCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTT
  3   1   2       bld Gas       in                    TGas108b03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCATCATGTGCTCTTTTGAAGGTTTCTGTTAATTTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTATGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATGCTTCCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                        CAAQ11016.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGTTAATTAAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Lun1      in                         CABD4498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGTNAATTTAAAGTGTCAAATGATTTCAGTTGTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Egg  5x   in                    TEgg072g19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAAAGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCGGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTGGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTCGGTGCATTCTTTTCCTGTCATTTGCTTGTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATGCTGGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas064b21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGTCAAATGATTTCAGTTGTTGGAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACTTCCAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG36060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCAAGTGGCAGATGTGCAACACTAGTGACCGCTTATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGTGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Brn3 5g3  in                         CAAK1393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGTGGCAGATGTGCAACACTAGTGACCGCTATTTCATAAAATCTGTTGTGCTGGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Te3  5g3  in                         CAAM6580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATTCATAAAATCTGTTGTTGCTGGATAGAAAGAAATATTCTGGCGAAAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Te4  5g3  in                         CAAN1908.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Gas7 5g3  in                         XZG50016.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTTACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Tad5      in                         XZT65520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Gas7 PIPE in                         XZG51107.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATTGCTGTCTTGCAAGTGGAACATTTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  3   1   2       bld Gas8      in                          st80k22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGTGGAACATTTNCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTCTAA
  3   1   2       bld Te4       in                         CAAN2522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCAAGGTGTTTGTGGATAACACCTCTGTATAGGTTACTGGCTGGTATATAAAAACATTCTATATTTGTGTAAAACATTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCC
  5  -1   2       bld TpA       in                   TTpA006g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATATAAAAACATTCTATATTTGTGTAAAACACTACAGGGTTTCACATACTGATACCGTTGTGTTCACAGTACACTATCTAATGTACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTGGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTTTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCGGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTTTTTTGACCCCTTGCTGCATTTTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCCCAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCAAACGATCCATTCCAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu062n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACTTCAGCTGTATGCTCTAAAGAGATTCTTCTGTCTTAATTTGTAGATACCAAAGCATCTTGCAGATGAAGCACAAAATGGGATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATCATTCCAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg070h09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTATGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATGCATTCC
  3   1   2       bld Egg       in                    TEgg070h09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTGTCTAGATGTGTGCAAAGCCCTTTTTGTCTTGGCTCTGGTGCCTTCAGAATCCTGCTATGGATTCCTGTGTCCTGTATCTTCTTTTCTAAAGATGAAGACTGTTGCAGCTAATGCTCCCTAGGTGTGCATCATGCAACTTCTGTATCCTACGTTTGCTCGTTTGCCTTACTGTGGCCCAGCATTACCCCTCTTTGGCATTAAGTACAGGGGGTTTCGAAAATCCAGTGCCTTAGTGTATACAATCGTCTTCTCAGTAGCTACTTTTCTTTTGACCCCTTGCTGCATTCTTTTCCTGTCATTTGCTTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTATGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATGCATTCCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG46364.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTATGTGAAAATATCAAATCAAAATTCTACCTGTATAGAAATGTTTGCTGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAAGCTTTATCTGCTGCATGAGGAAAAA
  5   1   2       bld Neu                            TNeu051f17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCCACTTTGGATTCCACAACATTTATTTCTTTGGTTTTGAAATTATTTTCAAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATGCATTCCAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTGAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGGGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGC
  5   1   2      ests                                 Xt7.1-CABG9654.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATG
                                                  Xt7.1-CHK-1008226671                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTAAAA
  3  -1   2       bld Neu       in                    TNeu095n21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTTTTTTTTTTTTTATTTTCAACTTGGATTTTTGTTATTTTGCTAGTACCATCTCCAGTCTAGTTCTTAAGTACATACTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAAAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCT
  5   1   2       bld Gas7      in                         XZG59639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTGCATTTAAAGTCCATCAATACATTCCAAAAAAAAAAAAAAAAAAAAAAGTCTGCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTAT
  5   1   2       bld Thy1      in                        CBST7392.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTAGCCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGNGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTT
  5   1   2       bld Mus1      in                         CABH6597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATTTTGGCTGGACAGGAGTGTATTGTAAGACTTGATTCTGATAAACAACTGCTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGGGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTATGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCC
  5   1   2       bld Egg       in                   TEgg070a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGATATCTATGAATGTGAAATTGTGGCCTTTTGTCCTGCAATTGGACTGTGCAGTTGATATTCGGGTAACTGCTTCCAAGCCTGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGCCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTT
  5   1   2       bld Tad5      in                         XZT45029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGACGCGTGGGGGTATTCGGGTAACTGGGCTTCCAAGCCTGGGGCTTTACACAAATCACTAATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGGGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCCAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTATGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGA
  5   1   2       bld Gas7                                 XZG33300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGTGACTAAGCACCAGATAGAAACATTAACTTGATATTTATACTTAATGAAATGTTTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGGGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTGCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAAGTAAATTTCA
  5   1   2       bld Ova1      in                         CABE4923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTAATTGTAATGTAACTATTTTATAGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCACTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGGGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTATGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGAC
  5   1   2       bld Gas7      in                         XZG50353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAGCAGATTAGCTTTAGATGAGTTATCTTTCAGGATTAAATCTAATAATTAAATAGGTGTGGATACATGTTTAAAGTCANCTCCGTTTTTCTCAAGCTGAGATCACCTTTTAAAGAGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGATATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAAAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTGTCACACTTGC
  5   1   2       add Gas       in                   TGas095e23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGGGGTTTTAAAGGGGAAGTAATGGCTTCTCATAAAGTTTAGAAAAAGTCTGTTCAAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTGCAGTGGAAGCCAATCGGAAACAAGCACACCTGGCAAGTAAGAGTGATTTAACCCCCAGTGTTTGATTGCCTCCTTCTGCAGAAAGCAAGCAGAACACCTGCTGACTA
  5   1   2       bld Gas7                                 XZG13802.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAGAAAAGTCTGTTCAATCTGTTAATAGGGATCTGCCAAATCTAATTGACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGATATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAAAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTGTCACACTTGCTTTGGCCCTCTGTCCTTATNATAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTC
  5   1   2       bld Sto1      in                         CABG9654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCCATTTGCTAGGTCTTGAATTTCAGATGCTTGGCCCACAATGCCTTCTGTTTCCAGTGGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTATGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCANAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTA
  5   1   2       bld TpA                            TTpA004j08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTGGCCCACAATGCCTTCTGTTTGCAGTTGAAGCCAATCGGAAACAAGCACACATGGCAAGTAAGAGTGATTTAACCCAGAGTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCATGCTCTACATCAGCACTT
  5   1   2       bld Neu       in                   TNeu105i24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGGGGTGATTTAACCCAGAGTGTTTATGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTGTGGTACAAAAAATGAAACCTATTGTACTTC
  3   1   2       bld Gas7      in                         XZG50353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGTGTTTGTTTGATTGCCTCCTTCTGCAGAAAGCAGGCAGAACAGCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGATATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAAAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTGTCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTCATTTTTTGTACCACAAAATATTAATATAAGGACAGAGG
  3  -1   2       chi Gas       in                    TGas066g22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTTTTTTTTAAACATTAAATTGCATTATCATTTCAATCATTCACCTTTACATGGAAAATAAAATGAAGTCACTACCATTAACAAAGAGCAAAACAAGAAGCTTTGTCTCAAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTTCATGTAGAATATTAATATAG
  5   1   2       bld Tad5      in                          XZT8971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGCTGACTACTTGGATATCAAGAAGCACAGATGGGGCAGGCAGATGCAGCTGAAGGCTTTATCTGCTGCATGAGGAAAAACATTGTATTGAAAAGTTCCTTGAAAAGCATTTCTTGACAGCATTTCCCTTTAATAGACAGAATGCAGCTCTGAGCTATAGGTGTCTCATTATGACAACATAATGGCAGGTATGGTCATAGTTCAATATAATAGTGGACATAGTATAATACAAATATGCCTTCCACAACATATGGAAGATATTTTAGTCCATGTAAAAAGTTGACATAAATGCAGGAATCCTGTATTTTACTTAAGATACTTCAACAGAGTTAAATTTCATGTTTGTTTCCTGCCTGTAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTGGCTTTGGCCCTCTGTCCTTATATTAATATTCTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTC
  3   1   2      seed Sto1      in                         CABG9654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGCATTTGTAAGTCAAATAACCTTATGAAAGGGGTGAGGCATATTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGGGGTACAAAAAATGAAACCTATTGTACTTTTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTT
  5   1   2       bld Gas7      in                         XZG44572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTCCTCCAGTTATAAATCAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG46364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATTTTCCTCCAGTTATAAAAGACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTGTCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTAAAAAAAAAAAAAAAGG
  5   1   2       bld Egg                           TEgg074j17.p1kSP6w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAATGAGTCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTGTCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTG
  3   1   2       bld Ova1      in                         CABE4923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCATTTATAGAAATGGACCAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCGGTCCTTATATTAATATTTTGGGGTACAAAAAATGAAACCTATTGTACTTTTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTCCCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTTT
  3   1   2       bld Gas7      in                         XZG59639.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAACCTCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTGTCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGT
  5   1   2       bld Gas7                                 XZG62217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAAAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCCTGGAGACTGATAAATATCTTGCCTCACACTAATTAATACCCCCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAAAAGTTGTATTATTTTCATATGAAAATTGAAAAACTTTTATGTCCTTTTGTTGCTGTTGGGTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGGAGTGACTTCATTTTATTTTCCATGGAAAGTGAAAATTGAAATATAATGCATTTAAT
  3   1   2       bld Fat1      in                         CABC7415.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTTTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTAAAAAAAA
  3   1   2       bld Mus1      in                         CABH6597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTGGGCCCTCTGTCCTTATATTAATATTTTGGGGTACAAAAAATGAAACCTATTGTACTTTTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGGGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGT
  3   1   2       bld Gas7      in                         XZG44572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTAACTGACCGTAATATCAATCTGTTCCTAGTTTTAATCTATCACACTTGCTTTGGCCCTCTGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTTTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTT
  3   1   2       bld Tad5      in                         XZT45029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGCTTGGGCCCTCTGCCCTTATATTAATATTCGGGGGTACAAAAAATGAAACCTTTTGTACTTTTGATTTTTGCCAGAATATGGTAGATGTTATCCTGCCGCATAAATGTTTTTCCTCAAAGGAAAATTGTCCCCTGAAAGGTTTTTTTTTTTTTCATGTAGAATTTTATATGGGGGCCCCCCCCCCCCCCATGCTTTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTTTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCCCACTATTTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGGGACTTCATTTTATTTTCCATGTAAAGTGAATTTTGAATTTT
  3   1   2       bld Thy1      in                        CBST7392.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCCCTCTGTCCTTATATTAATATTTTGGGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTCCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTCCCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGT
  3   1   2       bld Neu       in                    TNeu099a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATTTTATATTAGGGGCCCCCCCCCCCCCCCCCCCATGTTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCCATGTAAAGTGAANNTATTGAAANTATAATGCCATTTAATGTTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu099a16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCCTTATATTAATATTTTGTGGTACAAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTGTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTG
  3   1   2       bld Neu       in                    TNeu105i24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATGAAACCTATTGTACTTTTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCACGNAGAANANNTANAAGGGNGGCCCCCCCCCCCCCCCCCCCATGCTNNTACTCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTTTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTTTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3  5g3  in                         CAAM4563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTATTTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTT
  5  -1   2       bld Neu       in                   TNeu095n21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAATGAAACCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu       ?                     TNeu114g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACCCTATTGTACTTCTGATATTTGCCAGAATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTACCCTGAAAGGTTTTTTTTTTCATGTAGAATATTATATAGGTGACCCCCCCCCCCCATGCTTTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCCCCCCGGCAAGGGAATAAAAATGACTGTATG
  3   1   2       bld Tad5      in                          XZT8971.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGATATGGTAGATGTTATACTGCCGCATAAATGATTTTCCTCAAAGGAAAATTGTTCCCTGAAAGGTTTTTTTTTTTTCATGTAGAATATTATATAGGGGACCCCCCCCCCCCCATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTGCCTCACACTATTTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATGGTGAAATATAATGCATTTAATGTTTAAAATAAAAAAAAAAG
  3   1   2       bld Gas       in                    TGas095e23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCCCCCCCCCCCCCATGCTGTACATGAGCACTTTTTAAAATAGGTAACTGTTAAGGACTCCCAGGTTCAGCTTTGATTCATGGGAAAGAAATTTTGGTCCACTAAAGAATTTTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGAATGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTGGCTGTTGGTTAAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTCGTAAAAGGTAGAAAATTCaaaaataaaaaaagaaaaaaaaaaaaggaaaaaaaaagcatataaagtaaaaaaaaaaaaaaaaaaaaaaaaa
  5  -1   2       bld Gas       in                   TGas066g22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGCTCTACATCAGCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGCTCTGATTCATGGGAAAGAAACTCTGGTCCACTAAAGAATTCTGCTTTAAATGAAATAAAATGGGCTTGTTTTCTTTCATGGAGACTGATAGATATCTTGCCTCACACTAATTAATACCACCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAAGTATTGAAATATAATGAA
  3   1   2       chi Egg       in                    TEgg070a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACTTTTTAAACTAGGTAACTGTTAAGGACTCCCAGGTTCAGTTTTGATTCATGGGAAAGAAATTTTGGTCCACTAAAGAATTTTGCTTTAAATGAAATAAAATGGGCTTGTTTTCCTTCATGGAGACTGATAGATATCTTCCCTTACACTAATTAATCCCCCCCAGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATTTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTTTTTGTCTTTTGTCCTTTTTTGCCTTTTTTGGGGGCAATACTTTATGTTTTAATGGGAAAGTATGGCAGTGATGAAATTATGCTTAATTAAGGCTTTTGCCATGTGATTGGCCATAGCTGGGAAAATTGTACATTATTGAACTGTTTGGGCCCAAATAAAGGTACTCTCCTGCTCTGGGGAAGTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                    THdA003j19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTAATACCACCCCGGCTTGGAAAATAAAAATGACTGTATGTGGGTACTGGCAACTACAATTTTATTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATTTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAAGGTTGAAATATAATGCATTTAATGTTAAAAAAAAAAAAAAAAAAAAAAAG
  3  -1   2       bld TpA                             TTpA008h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTTTTTTTAAATAACGTAGAAGTTGTATTATTTTCATATGAAAATTGAAATACTTTTATGTCCTTTTGTTGCTGTTGGTTAAACTGTTGTATATACTTGTGAAATCTTAATGGCCCTTTTTTTGTTTTTTGAGACAAAGCTTCTTGTTTTGCTCTTTGTTAATGGTAGTGACTTCATTTTATTTTCCATGTAAAGTGAATATTGAAATATAATGCATTTAATGTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)