Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT53621.5.5                        101 END     1           1        1                zinc finger DNA binding protein [Xenopus laevis]
     2   2.0    0Xt7.1-CABE9472.3.5                         37 END     1           1        2                RWD domain containing 3 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012154005 Xt7.1-TTbA027b02.3.5 - 66 ESTs
                                                                       ......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTbA027b02.3.5                                                                                                                               CCGACACCCTGTCTGGTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACAGTAGGTTTGTTTATAGAGTTAACTGAAGTAGAAGTGTGGAGGAGTTTTCGTGCCTTCCTTAACACAGTTGGCTTATTAAGAGAATTCCAAAGTGTTCTCAGAATCTTCTGTTTAGCACATTTTCCCTTTAAAAACCCAGGTGGTGCACTATTTCCATGGAATTTCATAGCTTTATTTTACTATACCCCACAGAAGACTCTTTTATTGGTTTTATCCCCATTGGGCCCTTTTTTACCCAGAGGCCCCTGGGTATGCTATCCCCATAGTCACAAGGCTGGTTATAGGGATAAATTGGGTTACAATCAAGTTTTTAATGAATTATGAACTTAAAGCTCTACTTCTTATTTAATTGCCAGCATACTCCTTTCAAGCTCCAGGCCTTAAAGTGGAAAGAACATACAGCCCCAGTTAATGAATATAAGCACTTTTGGGGTGAGTCAGAGTCCCTGTTAAACTAGTATACCACCATTTGCACCCCCTGGCCACCCTTGACACTTATGTGCCAATATAAAGTACAGCAGACTGGAAAGCAGATCTAATGGAATAGTGACTGTTTTAGAATGCAGCATTTATAAAATCCCCTGTTATTTCTTGTCTGTATAGTCAGAGCCGTTTTTATTGCTGTAATGGGGCTCTGGTATTCATATAAAATAGTCTTTTTCAACCTGGGGCCCTTTAGCTGTAATTGAATGCCCAATGCCCACTTATAGCCTGTGGCTATTGGAGGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGTGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATTGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTC
                                                  Xt7.1-CHK-1008265908                                                                                                                                     CCCTGTCTGGTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACAGTAGGTTTGTTTATAGAGTTAACTGAAGTAGAAGTGTGGAGGAGTTTTCGTGCCTTCCTTAACACAGTTGGCTTATTAAGAGAATTCCAAAGTGTTCTCAGAATCTTCTGTTTAGCACATTTTCCCTTTAAAAACCCAGGTGGTGCACTATTTCCATGGAATTTCATAGCTTTATTTTACTATACCCCACAGAAGACTCTTTTATTGGTTTTATCCCCATTGGGCCCTTTTTTACCCAGAGGCCCCTGGGTATGCTATCCCCATAGTCACAAGGCTGGTTATAGGGATAAATTGGGTTACAATCAAGTTTTTAATGAATTATGAACTTAAAGCTCTACTTCTTATTTAATTGCCAGCATACTCCTTTCAAGCTCCAGGCCTTAAAGTGGAAAGAACATACAGCCCCAGTTAATGAATATAAGCACTTTTGGGGTGAGTCAGAGTCCCTGTTAAACTAGTATACCACCATTTGCACCCCCTGGCCACCCTTGACACTTATGTGCCAATATAAAGTACAGCAGACTGGAAAGCAGATCTAATGGAATAGTGACTGTTTTAGAATGCAGCATTTATAAAATCCCCTGTTATTTCTTGTCTGTATAGTCAGAGCCGTTTTTATTGCTGTAATGGGGCTCTGGTATTCATATAAAATAGTCTTTTTCAACCTGGGGCCCTTTAGCTGTAATTGAATGCCCAATGCCCACTTATAGCCTGTGGCTATTGGAGGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGTGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCxxTGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGxxxxxxTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTC
                                                      consensus depths                                                                                                                                    2     4     2     4     3     5     4     5     4     6     5     7     5     7     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12     9    11     9    11     9    11     9    11     9    11     9    11     7     9     6     9     6     9     6     9     6     9     6     8     6     8     7     8     6     7     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     3     4     3     4     3     4     3     4     2     4     2     4     2     4     2     4     2     3     2     3     1     2     1     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     3     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     5     6     6     7     7     7     7     9     7    10     7    10     7    10     7    10     7    10     7    10     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     8    10     8    10     8    10     8    10     8    10     8    10     8    10     8    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    11     9    11     8    11    10    12     9    12    10    12    10    12    11    12    11    12    10    12    10    12    10    12    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7    10     7     9     6     9     7    10     6     9     5     7     4     7     4     7     4     6     4     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     8     8     8     8     9     9    10     9    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     9     9    10     8    10     9    10     9    10     8    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11     9    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    11     8    10     7    10     8    14     7    14     8    16     7    15     6    15     7    16     9    19    10    21    10    22    10    23    11    25    14    27    14    27    13    27    13    27    13    26    13    25    12    25    12    24    13    26    14    27    14    27    14    27    24    27    24    27    24    27    24    27    24    27    24    27    24    27    24    26    24    26    24    26    24    26    25    27    25    27    25    27    25    27    25    27    25    27    25    27    25    27    24    27    24    27    24    27    24    27    24    25    25    25    25    25    25    25    25    25    25    25    25    25    24    24    24    24    24    24    24    24    24    24    24    24    23    23    22    22    22    22    22    22    21    21    20    21    19    20    19    20    19    20    19    20    18    19    14    15     9    11
  5   1   2      ests                                 Xt7.1-CAAO8958.5                                                                                                                               CCGACACCCTGTCTGGTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACAGTAGGTTTGTTTATAGAGTTAACTGAAGTAGAAGTGTGGAGGAGTTTTCGTGCCTTCCTTAACACAGTTGGCTTAT
  5   1   2      ests                               Xt7.1-TTbA027b02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTAATTGAATGCCCAATGCCCACTTATAGCCTGTGGCTATTGGAGGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGTGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATG
                                                                   SNP                                                                                                                                                                                                                               ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------A-----
                                               BLH ATG     106     902                                                                                                                               
                                               BLH MIN     106     101                                                                                                                               
                                               BLH MPR     106     101                                                                                                                               
                                               BLH OVR     106     503                                                                                                                               
                                               CDS MIN     106     101                                                                                                                               
                                               EST CLI     -12       4                                                                                                                               
                                               ORF LNG     106      21                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- ?? ---- 4e-017     AAY53609.1 tetraspanin family protein [Branchiostoma belcheri xiameng] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ==== 7e-026     NP_492636.1 tetraspanin family member (tsp-7) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                  PROTEIN === Dm ==== 1e-033     NP_524132.1 Tetraspanin 74F CG5492-PB [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Br ==== 4e-039     AAY53608.1 tetraspanin family protein [Branchiostoma belcheri tsingtaunese] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ==== 3e-040     CAJ81845.1 CD63 antigen (melanoma 1 antigen) [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 2e-049     XP_794023.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PREDICTED = Dr ==== 1e-110     NP_991213.1 hypothetical protein zgc:77759 [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 1e-112     NP_033972.1 CD151 antigen [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 8e-115     NP_004348.2 CD151 antigen; platelet-endothelial cell tetraspan antigen 3; hemidesmosomaltetraspanin CD151; membrane glycoprotein SFA-1; platelet surface glycoproteingp27 [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN === Gg ==== 1e-117     NP_001006472.1 similar to Platelet-endothelial tetraspan antigen 3 (PETA-3) (GP27) (Membrane glycoprotein SFA-1) (CD151 antigen) [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 1e-143     AAH77579.1 MGC83668 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 1e-143     NP_001086867.1 MGC83668 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTbA027b02.3.5                                                                                                                                                                                            TGA------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TGA------------------------------------------------------------------------------------------ATG---------TAA------------------------------------------------------TAA---ATG---------------------------------------ATGTAA------------------------------------------------------ATG------------------------------TAG---------------TAAATG---------------------TAG---------ATG---------------TGA---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TGA---------------------------------TAA------------------------------------------------------------------TAA------------------------ATG---------------------------------------------------------------------------------------------ATG---------TAG---------------TAG---TAA---------------------TAATGA---ATG------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------ATG------------------------------------TAA---------------------ATG---------TAA---------------------------------------------------ATG---------------------------------------------------------TGAATG---------------TAG------------------ATGTAA------TAA---TAG------TGATGA---------------------TAA------------------------------------------------------------------------------------TAG------ATG---------------TAG---------------------------------------------------TAA------------------ATG---------TGA------------------------------------------------------------------------ATG---------------------------------------------------------------------TAA---------------------------ATG------------------------------------TGA---TAA---------------------------------------------------------------------TGA---------------------------------------------------------TAA---------TAA------------------------TAAATG------------------------------------------ATG---------------------------------------------TAA---------------ATG---TGA------------------------------------------------------------------------------------------TAA---------------TGA------------TAA---------------------------------------TGA---------------------TGA------------TAA---------------------------------------TAG---------------------------------------------------------------------------------------TAA---------------------------TAG---------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------TGA---ATG---------------TAG------ATG---------------------------TAG------------------------------------------------------------TGA------------------TGA---------ATG---------------------------TAG---------------------------TAA---TGA---------------TGA---------------------------------------------------TAA------------------------TGA---------------------------------------------------------------------TGA---TAG---------------ATG------------------------------------------------------------------------------ATGTAA------TAG------------------TAA---------TGA---------------------------------TAG------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------TGA------------------------------------------------------------TAAATG---------TAG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2      ests                                 Xt7.1-CAAO8958.5                                                                                                                               CCGACACCCTGTCTGGTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACAGTAGGTTTGTTTATAGAGTTAACTGAAGTAGAAGTGTGGAGGAGTTTTCGTGCCTTCCTTAACACAGTTGGCTTAT
                                                  Xt7.1-CHK-1008231532                                                                                                                                     CCCTGTCTGGTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACAGTAGGTTTGTTTATAGAGTTAACTGAAGTAGAAGTGTGGAGGAGTTTTCGTGCCTTCCTTAACACAGTTG
  5   1   2   15  bld Te3  5g3  in                        CAAM14216.5p GTTTCTCCCCACACTCcatacaggcaggtaaattgactcctgataaaattgaccatagtgtgtgtgaatgcgatagggaccttagattgtaagctccactgcggcagggactgGTGTAGATAATATGACTTTCATTTTGGTTTAAGATATTGGGTATTTTGTGCAATGTATATTTAAAAGATTTTATTGTTATCCTACTGACCTCACATGTTATTTGTGTTTCAGGGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACGGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAA
  5   1   2   14  bld Te3  5g3  in                         CAAM9528.5p ..................................................................................................................TGTCAGTCTGTCCCGACACCCTGTCTGGTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCGGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTATGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGT
  5   1   2       bld In63 5g                         IMAGE:8959972.5p                                                                                                                            AACACCCTTGTTCTTGGTACATTAAAAGCACTCGCTTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGGGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAGACGGAGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGTGCTGTGGGGATTGGCATGCTGTGTCAGCTTTTTGGGATGATTTCACCTGCTGCTGTAAGAGCTAAGGTCGAGCATATTGGAAACATTTAAGAACTTGTCTTGTTGCTGGTTTTCCCTGGCCGTGACACAT
  5   1   2   14  bld Brn2 5g3  in                        CAAJ23658.5p ............................................................................................................................TCCCGACACCCTGTCTGGTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTATGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGGTAAGCAGCTGCTAAGTGCACACATGCAGGGAAAGGTAGCACAAAGGGGAATGGAATGGAGACTTGCTAGTATTTAGACAGGCAGACCCACTCCCAACTCGCATCTGCAACCAAACTTGGACCTGCTTTTAACTACTactaaggttgaacttgatagacgtatgtcttttttttaacctaacttactatgttactTGCCATAATCCCTACTGCATAATGTAACCCATGGATGTGGCATCACTATAACCAGGACGTGACGTCACTGTGGAATGCAGCTTGCCATGCCACCCTTAAGTGATGTTACCTTACCTCAGAAGTGATAAGTGATGACTTATTNAACAAAAAAACCCAGTGGAATCATTTACTGATTGAGGTCTAGGTGCCCAAGCAAGATCATTTGATTGGGAC
  5   1   2   12  bld Gas7 PIPE in                         XZG43210.5p .............................................................................................................................................GTACATTAAAAGCACTGCTGCCGAACCCGGTCTGGATCTGTTGCCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTATGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAAGGGGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGGATTGGCATTGCCCGTGTTCAGCTTTTTTGGGAAGATTTTCACCTGCTGCCTGTTC
  5   1   2      seed Te5       in                         CAAO8958.5p                                                                                                                                                                      CTGTGCTTGTGTGGGTTTCTTACAGACAAAGCAGTTTCTCCCCACACTCCATACAGGCAGAGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCGGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTATGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTA
  5   1   2   22  bld Tad5 5g                              XZT68216.5p ........................................................................................................................................................................................CCCTGAGAAGATTCCATAGTGTTACTGAGTCGCAACCGCAGGGTCACAATGAGCGAGTACAATGAGAAAAAGGAGACCTGTGGCACTATTTGCCTGAAATACCTGCTCTTCACCTTTAACTTTTTCTTCTGGTTGGCAGGCCTGGCAGTAATGGCCGTGGGGATCTGGACACTCATTCAGAAAAGCGATTACATTAGTCTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTG
  5   1   2       bld Tad5      in                         XZT23899.5p                                                                                                                                                                                                                                                                                                                                                                                               CTTCTGCCTTCCAACACCTATGCAGCCACTGCCTACATTCTGGTCATTGCTGGAGCCATCGTTATGATAACGGGCATCCTGGGATGTTGTGCCACCTTTAAGGAGAGAAAAAGCCTGCTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCTGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATCGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAATACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGA
  5   1   2       bld Gas                            TGas046c19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCAAAGTGTATTTCATCTTGTTGCTGTGCATCTTTATCCTAGAGGTCCTGGCAGGAATCCTGGCCTATATTTACTACCAGCAGCTGAATGCAGAGCTCAAGCAGAGCCTCAAGCAAACTATGACCACAAAGTACAAACAGCCAGGAGAGGAGAAAGTGACCAATGCTGTGGACAAACTGCAACAGGAGTTTAAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGC
  5   1   2       bld TbA       in                   TTbA027b02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGTTTAATGCTGCGGCAGTAATAATTCTGAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACT
  3   1   2       bld Te5       in                         CAAO8958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGACTGGAGGGACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCACAGTCTGTTATAACATGACTTACAAGC
  5   1   2       bld In66                            IMAGE:8963272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGAACAGCATATGGATTAACTCTCCTGAGGCCGAAAAGCGGTTGGTTCCTGACAGCTGCTGCAAGACGGTTACTCAACGATGTGGCATTCGGGATCACCCATCCAACATCTACAAGACGGAGGGTGGATGCATCACCAAGCTTGAAACCTTTATTCGGGCTCACCTGCTAATTATAGGTGCTGTGGGGATTGGCATTGCCTGTGTTCAGCTTTTTGGGATGATTTTCACCTGCTGCCTGTACAGGAGCCTAAAGTCAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCAGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGCTTTCCTTATGGAGAGATTCAGAGGCATTGGGCATAATTTGCCATGCAAAGTCTGTTATTACATGACTTACAGCAAACTGGTACATTTGCAGTGACGAAACATGTACTGAGGGCCACTATTAAATATTATAATATACCGTAGTTGTTATAAGTAACTGAATTCACGTGAGGATTCCTGGCTTTCCTTACCAGTGCCTTATATAAGAAGAAT
  5   1   2       bld Gas8      in                         st102g06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGAGCCATATTGAAAACATTTAAGACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGTATCCNGTGCCAAACATCAATGTAACCAAGTTCTCATGCTAGAGACTGCAAAAACAAAACAAATCCTTTCTTTTGCTTGATGACTTTTGCTAATGATGTTCGCAGCCACAGCTAGAGATCTGACCTCCGTTAAATGGGCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACAGTAGGTTTGTTTATAGAGTTAACTGAAGTAGAAGTGTGGAGGAGTTTTCGTGCCTTCCTTAACACAGTTGGCTTATTA
  3   1   2       bld Te1       out                        CBWN2997.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTTGTCTTGTTGCCTTGTTTTTCCCTGCTGACAACATATCCTGCTGCCTTAAACACCCCCCTGGCACTGAGGCCTGTTATGGTCCTATTGTAATGGCAGAATGTTATCTCATATCACTGTGTGGACCCTTTGGAACTCTGCGGTTTTTAACCCATGATATCATCAGCCTGCGACTGT
  3  -1   2       bld Te1                                 CBWN14056.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAGAGATCTGACCTCCGTTAAATGGGCAGAACCAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCACTCCCGACGCCCTGGTTTTCCTATCG
  5   1   2       bld Te4                                  CAAN7395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAGAACAAGACACTGGGAATAGTTGCACCAAATGACAATCTCTGGAAATTGACTCTCTGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGGGGGCCCTCTTAAAAATCCCCGGGGGGGGGCCC
  5   1   2       bld Neu                            TNeu096k17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTCCGTCCCTATGACTACTCTTCGGTCCTTCCTTTCAATCCCGATGACTTGGTTTTCCTATGGAGAAGATTCAAGAGGGCATTGGGCATAATTTGCCATGGCAAAGTCTGTTATAACATGACTTACAAGCAAAACTGGTACCATTTTGCAAGTGAACGAAAACATGTACTGGAGGGGGCCACACTATATAAAATATTATTAATATACAGTAGGTTTGTTTATAGAGTTAACTGAAGTAGAAGTGTGGAGGAGTTTTCGTGCCTTCCTTAACACAGTTGGCTTATTAAGAGAATTCCAAAGTGTTCTCAGAATCTTCTGTTTAGCACATTTTCCCTTTAAAAACCCAGGTGGTGCACTATTTCCATGGAATTTCATAGCTTTATTTTACTATACCCCACAGAAGACTCTTTTATTGGTTTTATCCCCATTGGGCCCTTTTTTACCCAGAGGCCCCTGGGTATGCTATCCCCATAGTCACAAGGCTGGTTATAGGGATAAATTGGGTTACAATCAAGTTTTTAATGAATTATGAACTTAAAGCTCTACTTCTTATTTAATTGCCAGCATACTCCTTTCAAGCTCCAGGCCTTAAAGTGGAAAGAACATACAGCCCCAGTTAATGAATATAAGCACTTTT
  5   1   2      ests                               Xt7.1-TTbA027b02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTAATTGAATGCCCAATGCCCACTTATAGCCTGTGGCTATTGGAGGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGTGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATG
                                                  Xt7.1-CHK-1008225834                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGAATGCCCAATGCCCACTTATAGCCTGTGGCTATTGGAGGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGTGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGxxxCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCxxxxxxCATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAAC
  5   1   2       bld Gas7      in                         XZG38910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGTTCTCAGAATCTTCTGTTTAGCACATTTTCCCTTTAAAAACCCAGGTGGTGCACTATTTCCATGGAATTTCATAGCTTTATTTTACTATACCCCACAGAAGACTCTTTTATTGGTTTTATCCCCATTGGGCCCTTTTTTACCCAGAGGCCCCTGGGTATGCTATCCCCATAGTCACAAGGCTGGTTATAGGGATAAATTGGGTTACAATCAAGTTTTTAATGAATTATGAACTTAAAGCTCTACTTCTTATTTAATTGCCAGCATACTCCTTTCAAGCTCCAGGCCTTAAAGTGGAAAGAACATACAGCCCCAGTTAATGAATATAAGCACTTTTGGGGTGAGTCAGAGTCCCTGTTAAACTAGTATACCACCATTTGCACCCCCTGGCCACCCTTGACACTTATGTGCCAATATAAAGTACAGCAGACTGGAAAGCAGATCTAATGGAATAGTGACTGTTTTAGAATGCAGCATTTATAAAATCCCCTGTTATTTCTTGTCTGTATAGTCAGAGCCGTTTTTATTGCTGTAATGGGGCTCTGGTATTCATATAAAATAGTCTTTTTCAACCTGGGGCCCTTTAGCTGTAATTGAATGCCCAATGCCCACTTATAGCCTGTGGCTATTGGAGGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGNAACTTACACAGAGAACCTTTGTATCAGGGATGCAGAACCTA
  5   1   2       bld AbdN                               IMAGE:7006623                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTAATTGAATGCCCAATGCCCACTTATAGCCTGTGGCTATTGGATGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAatgtcgccaagcgagtggatcttctcccgatattgcccacctacgggtgggcgatatcgggagaattcaggctaattcgattgtttggccctgACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCCTTAAATGAAATTAAAAACTATAGGAAATATTTAAGCATAAATGAGTTAAAAGAAGCTCTCTGGAGCAGTGTTACACTTCATTTTTGTTTTGAAGCATATTTGCAAGTCACTTTGCCCTTTAAAACTCCCCCTCTCTTGGTGAAATTTCCACCTTCCCCACAATTATTAAAATCTGGGTTCCATTTACACCCCCAAACCTTCTGTGAGGGTTAATGTTGCCTTAATAAAAAAGGCTTCACGGTATTGGGGACCATTTTTATTTAATACTCTTGGAACTATTTTAACAAACCAAGGGGCCATATTGTCTGGTATACCCACCTCTTCGCCCGCGCTACACTTTTAACCTACCTTTTTACCCACCCTATTGGATAACTTATATGGCGTTATAAACTGAGGCGAATTTTGGCCACACCCAAAAATCGGTTTTATCTGGAAAAACCCTATACACACGTACCTTTCCCCACAGATAAAAACTCCCCTCCCCGCGTGGAGGCACTCTCGC
  5   1   2       bld In60                            IMAGE:8949298.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCCCCACACAGAGGAGCCCATCGATTCGATTCGTCCGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCGCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGCGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAGTTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCAGTTGTTTTGAGCATATTGCAGTCGCTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACCTGGAGTTGCCTCCAAATGTTATGAAACTACAGCTCCAGAATTCCCCTGGGGCTGAGGTGCACTGACATCTCCATCAATTCCACTTGCCTATTTTCCTGGTCATTTCATTCCAAGGTATAACCAACCACCCA
  3   1   2       bld Gas8      in                         st102g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTATTGGAGGGATGTAATGTGCCTAAATTTAGGCAGCATGATGAGAAGTGCTGTTGTTGCCTTACTAATTCTCCTATCCCATAATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGTGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCCTGGTGTATGTGCTATAAATGTTCTGTTGGC
  5   1   2       bld In60                            IMAGE:8949339.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGTGGGGTTCCATAAGATGACATCGATTCGTATTCGTCCCCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCGCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGCGGATCTTCTCCCGATATTGCCCACCTACGGGTGGGCGATATCGGGAGAATTCAGGCTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAGTTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTTGCTCCAAATGTTATGAAACTACAGCTCCCAGATTCCCCTGGGCTGCAGAGTGCACTGCCAAATCTCCATCATTCACTTTGCCATATTTCCTGGTTCATTCATTCCCAGTACCACACCATTTCAGTGATTTAATGTTATCTTAATATCATCGCCCATCCTGTGTTTTTCCGATTCCTTGCTTGAAAAAGCTAAAGATATTTTGCTATGAAATAATTAATAATTAAC
  3   1   2       bld Gas7 PIPE in                         XZG43210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTCCAACACAGAAATGTAAACCCTCAAAACTAGGGTTTgcaatgtcgccaagcgagtggatcttctcccgatattgcccacctacgggtgggcgatatcgggagaattcaggctaattcgattgtttggccctgACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGT
  5   1   2       bld Tad5                                 XZT24929.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGACGCGTGGGTTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTgcaatgtcgccaagcgagtggatcttctcccgatattgcccacctacgggtgggcgatatcgggagaattcaggctaattcgattgtttggccctgACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGGTATCTAATATCATCGCCCAATCCCT
  3   1   2       bld Gas7      in                         XZG38910.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGAACTTACCACAGAGAACCTTTGTATCAGGGATGCAGAACCTAATTAATTTCAAGAGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTgcaatgtcgccaagcgagtggatcttctcccgatattgcccacctacgggtgggcgatatcgggagaattcaggctaattcgattgtttggccctgACCTTAGTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAATTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTAATAATAATAAAAAATACAT
  5   1   2       bld Te1       in                        CBWN12014.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTTGCTTGGCCCTCCCCTAATACTTTCTTGTCTCCATTTTGGACCCCTCACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTCCCACAGAGAACCTTTGTATCAGGGATGCTGAACCTAATTAATTTCAAGGGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGATATCGGGAGAATTCATCGTTTGGCCCTGACCTTATTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAGTTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAACGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAACCCCTGTGTCTTTCTGT
  5   1   2       bld Te1       in                        CBWN13140.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAAACAGACCTGTTTATAGTACAGCATGAGATGTGCCTATTACTAGGACTTGGAACTTCCCACAGAGAACCTTTGTATCAGGGATGCTGAACCTAATTAATTTCAAGGGGAAGCAAAGATGCTCTGGAATTGACAAAAATGGAGTGTCATTTTTCAGTGTTCAAGTACAACACAGAAATGTAAACCCTCAAAACTAGGGTTTGCAATGTCGCCAAGCGAGCGGATCTTCTCCCGATATCGCCCACCTACGGGTGGGCGATATCGGGAGAATTCATCGTTTGGCCCTGACCTTATTAATGAACAGCAGTTGGAGCTGTTGCTGCAAATTCATTAAATGAAGTTAAAAACTAAGGGAAATATTTAGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAACGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTATGTTATCTAAATATCATCGCCCAACCCCTGTGTCTTTCT
  3   1   2       bld Gas8                                 st103g06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCAACACTAGGGTTTGCAANGTCGCCAAGCGAGTGGATCTTCTCCCGATATTGCCCACGTACGGGTNGGCGATATCGGGNGAATTCAGGNTAATTCGATTGTTTGGCCCTGACCTTAGTAATGAACAGCAGTTGGAGCTGNTGCTGCAAATTCATTAAATGAAATTAAAAAGTAAGGGAAATATTTNGCATAAATGAGTTAAAAGAGCTCTCTGAGCAGTGTTACATNCATNTGTTNTGAGCATATTGCAGTCACTNGCCTTTTAACTCCCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCC
  5   1   2       bld Ovi1      in                         CABI6449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTAAAAGAGCTCTCTGAGCAGTGTTACATTCATTTGTTTTGAGCATATTGCAGGCACTTGCCTTTTAACTCTCTCTCTTTGTGAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGC
  3   1   2       bld Brn2 5g3  in                        CAAJ23658.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCATTTGTTTTGAGCATATTGCAGTCACTTGCCTTTTAACTCCCTCTTGTGAAATTCCACTCCCAGATTATAAACTGGTCCATAAACCCAGCTCCTGGTGTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACC
  5   1   2       bld Brn3      in                        CAAK10313.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATACACCAGGAGCTGGGTTTATGTGCTATAAATGTTCTGTTTGGCATTTATTAGTCTGGATATTAAATCAAGGCATATGTGTATCCATTCGCTGTACATTACTACTATCAGCCATGAGTATGGGTAACTGGAGTTGCTCCAAATGTTATGAAACTACAGCTCCCAGAATCCCCTGGGCTGCAGAGTGCACTGCCAATTCTCCATCATTCACTTGCCATATTTCCTGGTCATTCATTCCAAGTAACCAACACCATTTCAGTGATTTAATGTTATCTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAA
  5   1   2       bld Brn4      in                        CAAL20018.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAATATCATCGCCCAATCCCTGTGTTTTTCTGTTTCTTGGCTTGAAAAAAAGCTAAAGTATTTGCTATGAATTATTAAATATTAACTTTTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCATTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGNTGATGCACTGNGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAAACACCATGGCTACATC
  5   1   2       bld Int1      in                          CAAP447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGACTACTACAAATATAAACTACTGTATCTGTCAGTAGATCCTGAACAAGCCAAGTCCAGTTATTGTAATTATTATTATTCTGTCATTTCTTATAGTGTATATTTTTAATTCTATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAAT
  5   1   2       bld Bone      ?                         CBTC2826.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATAAAATGTATTTAAGTGGCAGGTAGAGTCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGTGGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTTCATTTGAGGGGGGGTCCTGTCATTTGAGCCTTGGTGATACACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCAGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGNGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAA
  5   1   2       chi Tbd1      out                        CBXT8564.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTAGAGTCCTTTCCGTTGCAATAGTCTTCCAGCCGCAGTGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAACAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGTTTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTTCATTAGGCTTACTGCTACTTTCATGGAAATTGATATTACATTCACACCAAAAAAAAGTAAATCAGAATTACATAGAAAATTCCCTGTGCTGTGCAGAATTAAAGCCTTGATCTATGTGCATTTCCCCATAGAGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCTGCTTGTGCCCCCCAGACTTAAATTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGTCCACCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCA
  5   1   2       bld In63                            IMAGE:8959432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGCATGTCGACAAAACTCTGGGCACTGCTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGTGGGCCCCTTCCCATAGTCCCACTGCAGGCTGAGCCTAGATATTAGTCATAAAATGGGAAACTGCCCTCTGGGATCCCCCATGTTCTCTATGCAGCTGTGCCTCAGCTGTGGACTGCACACATATGTATATAGTAGAATAATGACCCTTAAATAAGGCAATTGACCTAATCATTGTGCCATACAGTCAAAGCATAGCTCCCGTCTGTATAATTACTGCATACCCAACAATGA
  5   1   2       bld In54                            IMAGE:8944913.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTTTTTAAGACCATCAATTCGAATTCGTCCCTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAAATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAAAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGCTGAGCCTAGATATTAGTCCATAAAATGGAAAAACTGCCCTCTGGGATCCCCATGTCTCTAATGCAGCTTGTGCCCTCAGCTTGTGTGGCCTGCACACATTATGTAATATAGTAGATAATGACCCTTTAATAAAAGCATATGACTATCATTGTGCATATCAGTCAAAGCATAGCTCCCCTTCTGTTATTTTACTGCATACCCAAATGAAAGACTAGCCATGTAACGGCATGTAAACTGGACAGACAGCATAGTCATGCCATGCCTTAATTCAAGCTAGTCATGAACCATTGGTCAACATATCCGCACACGGTTACTACCAATAGAACGTCTGTATGAAACCATCAGTC
  5   1   2       bld Ovi1      in                         CABI1854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCAGAAAAGGGAGCAGATTTATGCCAAGTGCCTTTGGATTGAAAGAGGTGCCCACATGGGCAGTTGCTGGTGACAGTCTGGGTTTTTTTTTCCTTTCTGAAAATTGTTTCCATTTGCATAAAATCATTCAGTCTGTTTTGTTTGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTAGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGC
  5   1   2       bld In66                            IMAGE:8966580.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAGCTTATGAAATGGGAGAGCAGATTGTACATTAGGCTTACTGCTACTTTCATGGAAATTGATATTGCATTCACACCAAAAAAAGTAAATCAGAATTTCATAGAAAATTCCCTGTGCTGTGCAGGATTAAAGCCTTGATCTATGTGCAAACTCCTGTTCTAGGGGGAAATGGGGAGGGTTAGCCCTTGCTGGGAATTTTAGTCTCAGTGCATATGCTATTGCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCATAGCTCCCCCTATCCTGTATATTTTTACTGCATTACCCACAAATTGAAAAGACTAAAGCTCACTGATACAGGGGCATTGGGTAGACTGGAGCAGGAGCAGGGCATATTAGGGTCTAGTGGGCAAATGCACCAGTAATGTATCACAGCTAAGTCTCATGACGCAGCCTATGGTGGGTACCTACACCCTCATCTTCAGCACGCTGTCATCTAACGACTAAATGAGAGTGTCGTAATAGGAACACTAGATTGCTTGACTGGGCTCTGGCACATGTAAGCCGTCAGTACTGAGCTTGCCATTCATCTGAGCTTGCAGAAACCCGTCTCTATACACGGTGTCAAGACGTGCTAGCCTCGCT
  5   1   2       bld Tad5      in                         XZT51491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCTTTGGACTGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCCTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAANATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAACCCCACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGG
  5   1   2       bld Neu       in                   TNeu073l08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGGACATACAGAGGTACCAATTTTTTCATTTGAGGGGGGGGTCCTGTCATTTGAGCCTTGGTGATGCACTGGGGTGAAATATCAAGGTGCACATAGGCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCATATGACTTATTCATTTGTGCATATC
  5   1   2       bld Ova1      in                         CABE5491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAATAATAATAAACTATAAAAAAAATTAAGGATGAGCTGCAATATATTATTGAACACCATGGCTACATCAAGGACTGCTATCGGACATCATTGAGGCCTGCTTATAACTATACTTTCAAACTATCTCTTTGTGAGCACCACTGAGGCTTGATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTAT
  3   1   2      seed TbA       in                    TTbA027b02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATAGTCTGCTGTTGCAATGTGGTGGGCCCCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTAAAAAAAAAAAAAAAAAGC
  5   1   2       bld Spl2                                CBSS4837.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTCCCATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGA
  3   1   2       bld Ovi1      out                        CABI5758.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAA
  3   1   2       bld Int1      in                          CAAP447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAAC
  3   1   2       bld Ovi1      in                         CABI1854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAGTCCCACTGCAGGGCTGAGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTAGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTC
  3   1   2       bld Gas5                                  XZF2603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTC
  3   1   2       bld Neu       in                    TNeu073l08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCCTAGATATTAGTCCATAAAATGGGAAAAAACTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATT
  5   1   2       bld Tad0                               IMAGE:6985447                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGGATCTGCCCTCTGGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGACTTAAATTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTNAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAAGTCTGCAGCTCCCGGCTCATACN
  3   1   2       bld Ova1      in                         CABE5491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTC
  3   1   2       bld Ovi1      in                         CABI6449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGATCCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTC
  3   1   2       bld Te3  5g3  in                        CAAM14216.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCNCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTC
  3   1   2       bld Tad5      in                         XZT51491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATCCCCCATGTCTCTAATGCAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCCTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTC
  5   1   2       bld Gas                            TGas112i19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCTTGTGCCCTCCAGCTTGTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGC
  3   1   2       bld Te1       in                        CBWN12014.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGCCCTCCAGACTTAAATTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTCAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                        CBWN13140.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCAGACTTAAATTGTGGCCCTGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTTTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu130o16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGATTCCCCGGTCCCCGGGGTTAGATAAATGAACCCTCTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTAGCAAGTCGCTCTGCACCTATGCACT
  3   1   2       bld Te3  5g3  in                         CAAM9528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCACACATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACGTG
  3   1   2       bld Brn3      in                        CAAK10313.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTC
  3   1   2       bld Brn4      in                        CAAL20018.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTAATATAGTTAGATAAATGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTC
  3   1   2       bld Tad5      in                         XZT23899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTAATATAGTTAGATAAAGGACCCCTTTAAATAAAAAGCAATATGACTTATTCATTTGTGCATATCAGTCAAAAGGCAATAGCTCCCCCTATCCTGTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTC
  3   1   2       bld Te4                                  CAAN9545.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTATAATTTTTACTGCAATTACCCACACAATTGAAAAGACCTAAAGCCCATTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCCCCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCTTTGGACAGCAGCACTAGTGGTGGGGTCCCCTACACTCCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATCTGAGGGGAAAGCATGTTCTGATAAATTAATGAAAACCCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTTTTTTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCCTTTTGGAAGGGCTAGGTATTTAGCCGTTCTCTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGA
  3   1   2       chi TbA  5x3  out                   TTbA049i13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACTGAAGGAATCAGAACAGGCTGCCCAGTGTTACATCAAATACATACAGGACATCTACTCCTGTGGCGGAAATTGTAGAGCACCAGGAGGTCAGCACAACCTTTGGCTATCTGGCTCAGTATTAGTTTAAGTGCAAGCTGTGGGAAGAAGCATTTGCATGTGCCCAGAAATGTTTCAATTTTAAACATACCAGGGAAGAAGGGAAAGCTCTTTTTTGACGAATTGTACCATCCAGGTACCTGGAAAAAATTGCGTCTGTGTAGTGTACCCCACCACTAGTCCTGCTGTCCAATGGAAGTCCTTTAGCCTGTTGGATACATTTCCTGGTGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTTTTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCACGGCTCATTACTGCACCAGTAGCTAAAGTGTTTTAACTACCTGAAAGAATTTTTAATAAAACGTGAGAAAATTGTGAATGTTCAAAAAAAAAAAAAAAAAAGCGC
  5  -1   2       bld Egg       ?                    TEgg010e16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTACCCACACAATTGAAAAGACCTAAAGCCCACTGATACAGGGGGCATTGGGTAGAACTTGGAGCAGGAGCAAGGGCAATATTAGGGGTCTAGTGGGCCAAAATGCACCCAGTAGATGTATCCAACAGGCTAAAGGTCTTCCATTGGACAGCAGCACTAGTGGTGGGGTACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTCAAAAAAAA
  5   1   2       bld Sto1                                 CABG2638.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACACTACACACCCTCAATTCTTTCAAGCAACACGGCTGTTACAACTCATAAACAGCAACTAAAATATGAAGGGAAAGCATGTTCTGATAAATTAATGAAAAACCCAACTTATAGGAATATTGTCCCTTTGAGCTGTGGGGCATTCTACTGATGGCAAAGCAAACTATTGTATTATAAAGCTTCAGTCGTATTTAGCAATGTATCCATTTTGTAAATGCTATGTATTTAGCCGTACACTTTATCTAACAATTTGTATCCTGTACTGAAATGGCCTTTGTCATTGCGACACATGAGAGCTCACAAGTCGCTCTGCACCTATGCACTAAAATCTCACAGCGGCGGCTTGCTTTGTACAGACGAGAGAGTCTGCAGCTCCCGGCTCATTACTGCACCGTAGCTAAATGTTTTAACTACTGAGGAATTTTTAATAAAACTGAGAAATTGTGAATGTTCAACCTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaanaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)