Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1  1.75    0Xt7.1-XZG52959.5                           12 END     4          12       36                MGC88924 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012154018 Xt7.1-TEgg042a23.3.5 - 33 ESTs
                                                                       .....-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg042a23.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGGAATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGCTGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACCATGTTATAGCGTAACTGCATGGTAAGATTTATCTCAAAAAAAGGAGAATCTTTACTTTTTAAGCTGTGTACATTGCCTCAATACCACATCTTTAAAGGAACAGCAAAAAAAGGCAAGTGTTTTAAAGTTATAAAAATATAAAGTACTGTTGCCCTGCACAGGTTATACTGGTGTGTTTGCTTCACAAAGACTGCTAATAAACTGCTGTGTAGCCCCTAGGGCACCCATTCGAGCTAGAAAAAGTAGAAAAGCCATTGGTTACATAAGCTCTATAGAATACAATGGTGTTTTACAGAGCTATCCATTATCTGCTGTTACATGTGCCATTTAGCCCTATTTCAATTTAAACAGCTACCCCCTTCCCCATTGGTGCACAGCAGCTTTGATTATATAAGCTATAGTAGGCTTTCTGAAGCAAACACAGTGCAGGGTAACAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008266368                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGCTGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACCATGTTATAGCGTAACTGCATGGTAAGATTTATCTCAAAAAAAGGAGAATCTTTACTTTTTAAGCTGTGTACATTGCCTCAATACCACATCTTTAAAGGAACAGCAAAAAAAGGCAAGTGTTTTAAAGTTATAAAAATATAAAGTACTGTTGCCCTGCACAGGTTATACTGGTGTGTTTGCTTCACAAAGACTGCTAATAAACTGCTGTGTAGCCCCTAGGGCACCCATTCGAGCTAGAAAAAGTAGAAAAGCCATTGGTTACATAAGCTCTATAGAATACAATGGTGTTTTACAGAGCTATCCATTATCTGCTGTTACATGTGCCATTTAGCCCTATTTCAATTTAAACAGCTACCCCCTTCCCCATTGGTGCACAGCAGCTTTGATTATATAAGCTATAGTAGGCTTTCTGAAGCAAACACAGTGCAGGGTAACAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     5     3     5     4     6     4     6     4     6     4     6     4     7     5     7     5     6     5     6     5     6     5     7     6     7     6     7     7     7     7     7     8     8     8     8     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    14    11    14    12    15    12    15    12    15    15    15    19    20    20    21    20    22    21    23    22    24    22    24    22    24    21    24    21    23    22    23    21    22    22    23    22    23    22    25    22    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    23    24    23    24    23    24    23    24    23    24    23    24    24    24    24    24    24    24    24    24    23    23    23    23    22    23    20    21    21    21    22    23    21    22    21    22    21    22    21    22    21    22    19    21    19    20    19    19    19    19    19    19    16    19    15    18    15    18    15    18    15    18    15    18    15    18    15    18    13    16    13    16    13    16    13    16    13    16    12    16    12    16     4     8     2     2
  5   1   2       e50                               Xt7.1-TEgg042a23.5 AAAAAAAATATGTTGATTGTACCGATATCAAAATTGCATTAGAAGGATTTGTGGTTTTCTTTTTTTTCTTGTTGCTATTTTGTTTTGGTCAAGATTATTTAACTGAAAAAAAATGTTTGGGGTCACAACCTGATCAAAGTATTTGTGAAATTTAGAGTTGGTGCATTTGGTTTGCACACAAGATACAAGTCCGTTCCGCCTGACCGTCGTGGTGCATTACTTGTTGGCTCGTAATGAGATTGTACAAAATTTTTACACACTGACAATTTTTGCACTCAAAGTCTATTTTTATAACTCCGTGGAAGATGGCTGCGCATTCAGTTTTTTATGTAAAGTGAGCTTTTAAAAGATTTTTTTTGGGGGGGGGGGATGCTCCCTGTGGGAGGCTAATCGTGCTTCAAGTTTTAGTGGGCATGACCCAAGAATCAGCAGCCTTCAAGTTCCAGTTGAAGTCCCAGCATCCTTGAATTCAGGGTAATAGCTGGCAGGTCACAGAAGGGTCCTTAATGTAACCCAGTATCATTGCCAAATTTTCACTTTGTTATTCTAACCTTCTCAGTGTACTCCATATTGAAGGCTAATACCCGCCCCCCTGCACATAGAATTGGTATCAGTGAATAATAAAAAGAATCCCCCACAGTATTCTTATTAGAACTTTTTTTTAGAAAGGAAATAAAAGGAATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGCTGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACCATGTTATAGCGTAACTGCATGGTAAGATTTATCTCAAAAAAAGGAGAATCTTTACTTTTTAAGCTGTGTACATTGCCTCAATACCACATCTTTAAAGGAACAGCAAAAAAAGGCAAGTGTTTTAAAGTTATAAAAGTATAAAGTACTGTTGCCCTGCACAGGTTATACTGGTGTGTTTGCTTCACAAAGACTGCTAATAAACTGCTGTGTAGCCCCTAGGGCACCCATTCGAGCTAGAAAAAGTAGAAAAGCCATTGGTTACATAAGCTCTATAGAATACAATGGTGTTTTACAGAGCTATCCATTATCTGCTGTTACATGTGCCATTTAGCCCTATTTCAATTTAAACAGCTACCCCCTTCCCCATTGGTGCACAGCAGCTTTGATTATATAAGCTATAGTAGGCTTTCTGAAGCAAACACAGTGCAGGGTAACAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGGGGCAAT
  5   1   2       e50                               Xt7.1-TEgg042a23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGTAACAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------C---
                                                  Xt7.1-TEgg042a23.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA---------------------------------------------------------------TGA------------ATG---TAG---------------------------TAA---------------------------------------------TAA------------------------------TAA---------------------------TAA---------------------------------------------------------------------TAATAA---------TAG---------------------------------------------------TAA------TAG------ATG------------------------------------------------------------TAA------------------------------------TGA------------TAGTAG------TGA------------------TAA---------------TAA------TGA------------------ATG------------TAA------------------------------------------TGA---------TAA---------------------------------------------------------------TAG---------------------------------------------------TAA------------TAA---TAATAA------------------------------TAA---ATG---------------TAA---------------------------------------------------------------------------------------TGA---------------TAA---------------------------------------------------ATG------------------------ATG------------------------------------------------------ATG---ATG---ATG---------------------------------------------------------------------------------------TAG------------------------TAA---TGA---------------------------------------------------------------------TAG------------------------------------------------------------------------------TAG---------------TAA------------------------------------------TGA------------------TAATAA------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------TAA------------------------------TAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                     ]
  5   1   2       e50                               Xt7.1-TEgg042a23.5 AAAAAAAATATGTTGATTGTACCGATATCAAAATTGCATTAGAAGGATTTGTGGTTTTCTTTTTTTTCTTGTTGCTATTTTGTTTTGGTCAAGATTATTTAACTGAAAAAAAATGTTTGGGGTCACAACCTGATCAAAGTATTTGTGAAATTTAGAGTTGGTGCATTTGGTTTGCACACAAGATACAAGTCCGTTCCGCCTGACCGTCGTGGTGCATTACTTGTTGGCTCGTAATGAGATTGTACAAAATTTTTACACACTGACAATTTTTGCACTCAAAGTCTATTTTTATAACTCCGTGGAAGATGGCTGCGCATTCAGTTTTTTATGTAAAGTGAGCTTTTAAAAGATTTTTTTTGGGGGGGGGGGATGCTCCCTGTGGGAGGCTAATCGTGCTTCAAGTTTTAGTGGGCATGACCCAAGAATCAGCAGCCTTCAAGTTCCAGTTGAAGTCCCAGCATCCTTGAATTCAGGGTAATAGCTGGCAGGTCACAGAAGGGTCCTTAATGTAACCCAGTATCATTGCCAAATTTTCACTTTGTTATTCTAACCTTCTCAGTGTACTCCATATTGAAGGCTAATACCCGCCCCCCTGCACATAGAATTGGTATCAGTGAATAATAAAAAGAATCCCCCACAGTATTCTTATTAGAACTTTTTTTTAGAAAGGAAATAAAAGGAATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGCTGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACCATGTTATAGCGTAACTGCATGGTAAGATTTATCTCAAAAAAAGGAGAATCTTTACTTTTTAAGCTGTGTACATTGCCTCAATACCACATCTTTAAAGGAACAGCAAAAAAAGGCAAGTGTTTTAAAGTTATAAAAGTATAAAGTACTGTTGCCCTGCACAGGTTATACTGGTGTGTTTGCTTCACAAAGACTGCTAATAAACTGCTGTGTAGCCCCTAGGGCACCCATTCGAGCTAGAAAAAGTAGAAAAGCCATTGGTTACATAAGCTCTATAGAATACAATGGTGTTTTACAGAGCTATCCATTATCTGCTGTTACATGTGCCATTTAGCCCTATTTCAATTTAAACAGCTACCCCCTTCCCCATTGGTGCACAGCAGCTTTGATTATATAAGCTATAGTAGGCTTTCTGAAGCAAACACAGTGCAGGGTAACAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGGGGCAAT
                                                  Xt7.1-CHK-1008248776       AATATGTTGATTGTACCGATATCAAAATTGCATTAGAAGGATTTGTGGTTTTCTTTTTTTTCTTGTTGCTATTTTGTTTTGGTCAAGATTATTTAACTGAAAAAAAATGTTTGGGGTCACAACCTGATCAAAGTATTTGTGAAATTTAGAGTTGGTGCATTTGGTTTGCACACAAGATACAAGTCCGTTCCGCCTGACCGTCGTGGTGCATTACTTGTTGGCTCGTAATGAGATTGTACAAAATTTTTACACACTGACAATTTTTGCACTCAAAGTCTATTTTTATAACTCCGTGGAAGATGGCTGCGCATTCAGTTTTTTATGTAAAGTGAGCTTTTAAAAGATTTTTTTTGGGGGGGGGGGATGCTCCCTGTGGGAGGCTAATCGTGCTTCAAGTTTTAGTGGGCATGACCCAAGAATCAGCAGCCTTCAAGTTCCAGTTGAAGTCCCAGCATCCTTGAATTCAGGGTAATAGCTGGCAGGTCACAGAAGGGTCCTTAATGTAACCCAGTATCATTGCCAAATTTTCACTTTGTTATTCTAACCTTCTCAGTGTACTCCATATTGAAGGCTAATACCCGCCCCCCTGCACATAGAATTGGTATCAGTGAATAATAAAAAGAATCCCCCACAGTATTCTTATTAGAACTTTTTTTTAGAAAGGAAATAAAAGGAATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGCTGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACCATGTTATAGCGTAACTGCATGGTAAGATTTATCTCAAAAAAAGGAGAATCTTTACTTTTTAAGCTGTGTACATTGCCTCAATACCACATCTTTAAAGGAACAGCAAAAAAAGGCAAGTGTTTTAAAGTTATAAAAGTATAAAGTACTGTTGCCCTGCACAGGTTATACTGGTGTGTTTGCTTCACAAAGACTGCTAATAAACTGCTGTGTAGCCCCTAGGGCACCCATTCGAGCTAGAAAAAGTAGAAAAGCCATTGGTTACATAAGCTCTATAGAATACAATGGTGTTTTACAGAGCTATCCATTATCTGCTGTTACATGTGCCATTTAGCCCTATTTCAATTTAAACAGCTACCCCCTTCCCCATTGGTGCACAGCAGCTTTGATTATATAAGCTATAGTAGGCTTTCTGAAGCAAACACAGTGCAGGGTAACAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGG
  3   1   1       add Egg  5g3  out                   TEgg048k01.q1kT7 AAAAAAAATATGTTGATTGTACCGATATCAAAATTGCATTAGAAGGATTTGTGGTTTTCTTTTTTTTCTTGTTGCTATTTTGTTTTGGTCAAGATTATTTAACTGAAAAAAAATGTTTGGGGTCACAACCTGATCAAAGTATTTGTGAAATTTAGAGTTGGTGCATTTGGTTTGCACACAAGATACAAGTCCGTTCCGCCTGACCGTCGTGGTGCATTACTTGTTGGCTCGTAATGAGATTGTACAAAATTTTTACACACTGACAATTTTTGCACTCAAAGTCTATTTTTATAACTCCGTGGAAGATGGCTGCGCATTCAGTTTTTTATGTAAAGTGAGCTTTTAAAAGATTTTTTTTGGGGGGGGGGGATGCTCCCTGTGGGAGGCTAATCGTGCTTCAAGTTTTAGTGGGCATGACCCAAGAATCAGCAGCCTTCAAGTTCCAGTTGAAGTCCCAGCATCCTTGAATTCAGGGTAATAGCTGGCAGGTCACAGAAGGGTCCTTAATGTAACCCAGTATCATTGCCAAATTTTCACTTTGTTATTCTAACCTTCTCAGTGTACTCCATATTGAAGGCTAATACCCGCCCCCCTGCACATAGAATTGGTATCAGTGAATAATAAAAAGAATCCCCCACAGTATTCTTATTAGAACTTTTTTTTAGAAAGGAAATAAAAGGAATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGATGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACAATGGTATAGCGTAACTGCATGGTAAGATTTTCTCAAAAAAAAAAAAAAAAAA
  5   1   2      seed Egg       in                   TEgg042a23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGGAATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGCTGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACCATGTTATAGCGTAACTGCATGGTAAGATTTATCTCAAAAAAAGGAGAATCTTTACTTTTTAAGCTGTGTACATTGCCTCAATACCACATCTTTAAAGGAACAGCAAAAAAAGGCAAGtgttttaaagttataaaagtataaagtactgttgccctgcacaggttatactggtgtgtttgcttcacaaagactgctaataaactgctgtgtagcccctagggcacccattcgagctagaaaaagtagaaaagccattggttacataagctctatagaatacaatggtgttttacagagctatccattatctgctgttacatgtgccatttagccctatttcaatttaaacagctacccccttccccattggtgcacagcagctttgattatataagctatagtaggctttctgaagcaaacacagtgcagggtaacagtacataatattttaattattatgatacattttcattgttttgatgttactgatcctttaACATATTTTGGGGCAATTA
  5   1   2       bld Gas       in                   TGas124a13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAATTTCTATTGTGGTTATAAATGAAAAAGGGCAAAGATTTTCGGTGCACAGACCAGAACATTTGATGATCTAGTACAGTTAGAGTGCTGAAAAACAAACGGTATGGATTAGTATACTGAACGAGACCATGTTATAGCGTAACTGCATGGTAAGATTTATCTCAAAAAAAGGAGAATCTTTACTTTTTAAGCTGTGTACATTGCCTCAATACCACATCTTTAAAGGAACAGCAAAAAAAGGCAAGtgttttaaagttataaaaatataaagtactgttgccctgcacaggttatactggtgtgtttgcttcacaaagactgctaataaactgctgtgtagcccctagggcacccattcgagctagaaaaagtagaaaagccattggttacataAGCTCTATAGAATACAATGGTGTTTTACAGAGCTATCCATTATCTGCTGTTACATGTGCCATTTAGCCCTATTTCAATTTAAACAGCTACCCCCTTCCCCATTGGTGCACAGCAGCTTTGATTATATAAGCTATAGTAGGCTTCTGAGGCAAACAcagtgcagggtaacagtacataatattttaattattatgatacattttcattgtttcgatgttactgatcctttaACATATTTTG
  5   1   2       e50                               Xt7.1-TEgg042a23.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGTAACAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228277                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTACATAATATTTTAATTATTATGATACATTTTCATTGTTTTGATGTTACTGATCCTTTAACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG52302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAAAAAAGGCAAGTGTTTtaaaaatataatgtactgttgccctgcacaggttatactggtgtgtttgcttcacaaagactgctaataaactgctgtgtagcccctagggcacccattcgagctagaaaaagtagaaaagccattggttacataAGCTCTATAGAATACAATGGTGTTTTACAGAGCTGTCCATTATCTGCTGTTACATgtgccatttagccctatttcaatttaaacagctacccccttccccattccccattggtgcacagcagctttgattatataagctatagtaggctttctgaagcaaacacacaacttttagcagtgcagggtaacagtacataatattttaattattatgatacattttcattgttttgatgttactgatcctttaacATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTAT
  5   1   2       bld Tad5      in                         XZT42559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGGACGCGTGGGgtgttttaaagttataaaaatataaagtactgttgccctgcacaggttatactggtgtgtttgcttcacaaagactgctaataaactgctgtgtagcccctagggcacccattcgagctagaaaaagtagaaaagccattggttacataAGCTCTATAGAATACAATGGTGTTTTACAGAGCTATCCATTATCTGCTGTTACATgtgccatttagccctatttcaatttaaacagctacccccttccccattggtgcacagcagctttgattatataagctatagtaggctttctgaagcaaacacagtgcagggtaacagtacataatattttaattattatgatacattttcattgtttcgatgttactgatcctttaACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGACTGCTCTATTATAAAGATGGCTAGAG
  5   1   2       bld Neu       in                   TNeu089n24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATGGTGTTTTACAGAGCTGTCCATTATCTGCTGTTACATGTGCCATTTAGCCCTATTTCAATTTAAACAGCTACCCCCTTCCCCATtccccattggtgcacagcagctttgattatataagctatagtaggctttctgaagcaaacacacaacttttagcagtgcagggtaacagtacataatattttaattattatgatacattttcattgttttgatgttactgatcctttaaCATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTA
  5   1   2       bld Ovi1      in                        CABI10693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 gcagggtaacagtacataatattttaattattatgatacattttcattgttttgatgttactgatcctttaACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAG
  5   1   2       bld Ova1      in                        CABE12186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATTCGGCACGAGGCTTTAACATATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAAGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGATGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAGACAACTGATAGTATAGCA
  5   1   2       bld Ski1      in                         CABJ3966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTTGGGGCAATTATTTTTACCCCCACTGTGTCAATTCTGAATCAGATCCTAAGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAACTATTC
  3  -1   2       bld Tbd1                                 CBXT6636.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGCGATCTAGAACGAAATCCCTTGTAGGCAGTGGGCCAGAGTGGAACACTGTAGTAGCAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATATTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATGTATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGACTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCCCTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCA
  5   1   2       bld Gas       in                   TGas130a20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTTTATACGGTAGGTGGTAGGGATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGAAGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGACTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCACTGGATTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGAT
  5   1   2       bld Sto1      in                         CABG1202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCAATTACTAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGATGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAACTATTCCGGGCGTG
  5   1   2       bld Neu       in                   TNeu124a14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGCAATTGCCATTACCACCGATGCCTTAAAAATGAATGGTAATTTGCATTACTATAACCATAATAAAATGATGCATTCTTTCCCAGATATCCCTTATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACA
  3   1   2       bld Gas       in                    TGas130a20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATATCCCTTATAATGTATGTATGTTTGNCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGACTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCACTGGATTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAACATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATANAAATAATAAAATCTATTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg042a23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATAATGTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas124a13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATGTATGTTTTGCACTTATAAGTGCTTGGCAGTTTTTTTGATACAATATACCCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGACTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCACTGGATTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAACATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATTCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu124a14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATGTATGTTTTGCACTATAAAGTGCTTGGCAGTTTTTTTGATACAATATACCCCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCCCCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                         CABJ3966.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTGGGCAGTTTTTTTGATACAATATACCCATATTTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATT
  5   1   2       bld Neu       in                   TNeu114p15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAATATTCTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTC
  3   1   2      seed Ovi1      in                        CABI10693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTAAGACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATT
  3   1   2       bld Neu       in                    TNeu089n24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAATATGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  out                  TTbA008h14.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACAATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGACCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTAAAAATGTGCATGAAAATGCCCCTGCCACTCTCCCTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTAGAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAACACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATANAAATAATAAAATCTATTTTTATTAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu       in                    TNeu114p15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAATA
  3   1   2       bld Ova1      in                        CABE12186.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATATATTAATGGAGTAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATT
  3   1   2       bld Tad5      in                         XZT42559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGATACTTTTGCCCTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATTGAGGTTGACTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCACTGGATTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAACATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAATATG
  3   1   2       bld Abd0 FL   out                      IMAGE:6999762                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTTTGCCGTGAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTGGAAATTTGCCTAATTGAGGTTGCGTGCTCTATTATAAGATGGCTAGAGCCCCACCTGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTAG
  3   1   2       bld Gas7      in                         XZG52302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATCTTTCTGATTTCAGTCCCCCTACTAATGCTTTCAGGTTGGAATTTGCCTAATGAGGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGACCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTAAAAATGTGCATGAAAATGCCCCTGCCACTCTCCCTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTAGAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAACACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATT
  3   1   2       bld Gas7      out                        XZG21953.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTTCAGTCCCCCTACTAATGCTTCAGGGTTGGAATTTGCCTAATTGAGGTTGCCTGCTCTATTATAAAGATGGCTAGAGCCCCACCTGCAAGACCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTAAAAATGTGCATGAAAATGCCCCTGCCACTCTCCCTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTAGAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAACACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAAAAAAAAGG
  3   1   2       bld Sto1      in                         CABG1202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAAGGCCTATGATACATGGAGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATAT
  5   1   2       bld Neu                            TNeu032e07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGATTTGGGGGCAATATTTCCTGCCCCTTATTTTCATTGTCTTAAAATGTGCATGAAAATGCCCCTGCCACTCTCACTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGCAAAGGGCAAGAGGAATTTAGATTTCTGTCTTTTAGCCTTTTGCTTTAATTTCCATCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAGCACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTATGGGGGTGGCAATGTCA
  5   1   2       bld Neu                            TNeu040p11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGATTTGGGGGCATATTTCCTGCCCCTTTTTTTCATTGTCTAAAATGTGCATGAAAATGCCCCTGCCACTCTCCCTGTGTTGTAAAGCAATTGCCTGCAAACTCTGGCACCGCTGGCTTTCATGCATCAAATTCATCTGTGCACTATAGCTGGTCATTTCATACCATTGCCATTAAAAATGATCAAATGTCTATGGCAAGAGGAATTTAGATTTCTGGCTTTTAACCTTTTGCTTTAATTTCCTCTGCCTTAGTGCAGTGACCTACTGTTCCTTTCCAGTGACGTACATGTACACAATAGAAACTATTGCCTTCAAAGACAACTGATAGTATAACACCACCAAACACCATAAAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATCTTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAAGTACAATGAAGAATTAGGGCATTCTATCTGGGGTATTGATATTGAGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTT
  3   1   2       bld Sto1      in                        CABG11885.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATAT
  5   1   2       bld Sto1      in                        CABG11885.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACACTTTATTTTCAGGAAAGATAAGAAGAACTTGATATTTTGATGCCATATATTTAATATCTAATAAAACCAAACTATTCCGGGCGTGTTCCCTTCACTCCAAGGAGAGACTCATCTGAAGACATTTTGGGGGTGGCAATGTCATAGGTACAATGAAGAATTAGGGTATTCTATTTGGGGTATTGATATTTTGCTATATATTGTCTTGGTATGGGGAAATGTAATGGGATTTCTTGTAAAGATTAAAATATTTGTAACTTTTTAAAATCTGGGTAATGTAAAACTATATATAAAATAATAAAATCTATTTTATATTAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)