Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CABJ3685.3                           88 END     1           1        1                calcium/calmodulin-dependent protein kinase I [Xenopus tropicalis]
     2   2.0    0Xt7.1-TTpA019a01.3                         18 END     1           1        5                (no blast hit)
     3   2.0    0Xt7.1-CAAM604.5                             6 END     2           2       50                Unknown (protein for MGC:145358) [Xenopus tropicalis]
     4   2.0    0Xt7.1-CAAM7497.5                            2 END     1           1       50                Unknown (protein for MGC:145358) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012154019 Xt7.1-TEgg042h02.3.5 - 95 ESTs
                                                                       .....-1370.....-1360.....-1350.....-1340.....-1330.....-1320.....-1310.....-1300.....-1290.....-1280.....-1270.....-1260.....-1250.....-1240.....-1230.....-1220.....-1210.....-1200.....-1190.....-1180.....-1170.....-1160.....-1150.....-1140.....-1130.....-1120.....-1110.....-1100.....-1090.....-1080.....-1070.....-1060.....-1050.....-1040.....-1030.....-1020.....-1010.....-1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg042h02.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCACCCATGGCAATCTGAACATCCCCTATAAGATCGAGGCTGTGAAAAGTGAGATAGTCGAGACCGCCAAGCCGCCGCCGCCGCTTTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCATCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTTTGTTTGTTTGTAATAATAAAATTGTACATAAAAAAAAAA
                                                  Xt7.1-CHK-1008265459                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATGGCAATCTGAACATCCCCTATAAGATCGAGGCTGTGAAAAGTGAGATAGTCGAGACCGCCAAGCCGCCGCCGCCGCTTTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCATCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTTTGTTTGTTTxTxxTAATAAAATTGTACAxAAxAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     3     3     4     3     4     3     4     2     3     3     3     4     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     4     4     4     4     4     4     5     5     5     5     5     6     5     6     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     5     5     5     5     5     4     4     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     3     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     4     6     4     6     5     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     7     8     7     8     7     8     7     8     8     9     8     9     8     9     9    10     9    10     9    10    10    11    10    11    11    12    12    13    12    13    12    13    11    13    12    13    12    13    12    13    13    14    13    14    15    15    14    15    14    16    14    16    15    17    15    17    15    17    15    17    15    17    15    16    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    14    15    15    16    14    16    15    16    15    16    15    17    15    17    19    22    21    24    21    25    20    25    20    25    20    27    20    27    18    27    22    28    21    30    24    30    24    31    23    30    24    31    23    31    26    32    27    33    27    32    27    32    27    32    27    32    23    31    24    28    24    27    24    27    23    26    23    26    23    26    23    26    23    26    24    26    24    26    24    26    23    26    23    26    23    26    24    27    22    26    22    26    23    26    23    27    21    27    21    27    22    29    24    30    26    31    27    32    32    34    25    34    30    33    25    35    26    36    26    36    26    36    27    38    29    40    33    43    33    43    32    45    29    45    30    45    29    45    29    45    29    45    30    43    27    43    25    42    25    42    19    30    19    30    20    29    20    29    20    28    20    28    20    27    19    27    19    27    18    27    18    26    18    26    19    26    19    26    19    26    19    25    18    25    19    25    19    25    19    26    20    24    20    24    20    24    19    24    17    22    18    22    16    20    12    22    10    22    13    22    13    22    12    21    11    21    11    21    11    21    10    12     8    12     6    12     6    12     3    12     4    12     3    12     3    12     4    11     3    11     2     7     4     7
  5   1   2  SIG                                     Xt7.1-CBXT11858.5 TGTTTTGACCGCGTGGGCGGCTACNACTGCATCTGCCCCCCGGGCTTCGTGGGCGAACGCTGCGAAGGCGACGATGAACGAGTGCTTATCCAATCCCTGCGACCCCCGCGGGACCCAGAATTGCATCCAGCTGGTGAACGATTACCGGTGCGAGTGCCGGCAGGGATTCACAGGAAGGCGCTGCGACTCTGTCGTGGACGGTTGCAAGGGGTTGCCCTGCAGAAACGGTGGAACGTGTGCCGTCGCCAGCAATACCGAGCGCGGATTTATCTGCAAATGCCCTCCTGGGTTCGACGGAGCCACTTGCGAATACGACGCCCGGACCTGCGGTAACCTGCGCTGCCAGAACGGCGGCACATGTATCTCGGTGCTGAAGAGCTCCAAATGCGTATGCTCGGAAGGATACACCGGCGCCACGTGTCAGTACCCCGTCGTCAGCCCGTGCGCGTCCCGCCCTTGTTACAACGGAGGGACCTGCCAATTCTCCCCCGAGGAACCTTTCTTCCAGTGCTTCTGCCCCACGAACTTCAACGGCCTCTTCTGCCACATCTTGGATTACGGCTTCATCGGAGGCCTGGGCAAGAACATCACCCCTCCCGACAACGAGGAAATCTGCGAGAATGAGCAGTGCGCCGAGCTGGCCGACAACAAGATCTGCAACGCCAACTGCAACAACCACGCCTGCGGGTGGGACGGCGGCGACTGCTCGCTCAACTTCAACGACCCCTGGAAGAACTGCACCCAGTCGCTGCAGTGCTGGAAATACTTCAACGACGGCAAATGCGACTCGCAGTGCAACAACTCCGGCTGCCTGTACGACGGCTTCGACTGCCAGAAAGTGGAGGTTCAGTGCAACCCTTTGTACGACCAGTATTGCAGGGATCACTTTCAAGACGGCCATTGCGACCAAGGCTGTAACAACGCANAGTGCGAATGGGACGGCCTGGACTGTGACAACATGCCGGAGAACCTGGCCGAAGGCACCCTGTTGATAGTCGTCCTGATGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGCTTACCCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTAATTTTTTTTGTTTCCCGGAAACTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAGTGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTGTATATCCTGATTTATATTGCGTAGAACTGGGATAGATGGACGGAGTGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTTTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TEgg042h02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAGCCGCCGCCGCCGCTTTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCGTCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTT
  5   1   2  SIG                                      Xt7.1-XZG42085.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTGTTTGTTTGTTTGTAATAAAATT
  5   1   2                                         Xt7.1-TNeu102n20.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACTAGTGTCGACGCGGCCGCTTTTTTTTTTAACCTTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTGGCCTTAATAAATATTTTTTTTGTCCAAATTTTATGAAATTGTTCCTGATTTTGAAAATGACAATGTTTTTATTTTCTATGGCCCCTAAATAATATGCAGGACCAAACCACTGGATTGTTTTTTTACCAAAAAACCAAAAAAATTTAAAATTTTTTAAAATTTTTTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTTTAGCACTAAAAACTATTTTTTTTCCCAGTTTTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAAGGTTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTGGATGGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGGGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGGTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TATCACCTGCAACATTTTTGTAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCTTCTGCGATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTCGAACAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------T--
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 3e-009     NP_014677.1 Protein involved in constitutive endocytosis of Ste3p; Akr2p [Saccharomycescerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PREDICTED - Ce ---- 5e-020     NP_493429.1 predicted CDS, mechanosensory transduction channel NOMPC (1O503) [Caenorhabditiselegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Bb ==== 2e-036     AAL02136.1 putative notch receptor protein [Branchiostoma belcheri] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN -== Cs ==== 4e-049     BAB70659.1 Notch [Ciona savignyi] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PREDICTED - Sp ---- 5e-092     XP_797451.2 PREDICTED: similar to notch homolog [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PROTEIN --- Dm ---- 1e-112     NP_476859.2 CG3936-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PROTEIN --- Ci ---- 2e-144     BAE78963.1 Ci-Notch protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PREDICTED - Bf ---- 1e-166     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PREDICTED - Dr ---- 0          XP_689515.1 PREDICTED: similar to receptor protein Notch1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PROTEIN --- Mm ---- 0          NP_032740.2 Notch gene homolog 1; Notch gene homolog 1, (Drosophila) [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PROTEIN --- Hs ---- 0          NP_060087.2 notch1 preproprotein; translocation-associated notch protein TAN-1; neurogeniclocus notch homolog protein 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PREDICTED - Gg ---- 0          XP_415420.2 PREDICTED: Notch homolog 1, translocation-associated [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PROTEIN --- Xl ---- 0          AAB02039.1 Xotch protein [Xenopus laevis]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PROTEIN --- Xt ---- 0          AAI33054.1 Unknown (protein for MGC:145358) [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...PROTEIN --- ?? ---- 0          NP_001090757.1 Notch homolog 1, translocation-associated [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg042h02.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------ATG---------------------------ATG---ATG---------------ATG------------ATG------------ATG---------------------------------------------ATG------------ATG---------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------ATGATG------------ATG------------ATG------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------TAA---------------------------------TAA------TGA---------TAA---------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------ATG---------------------ATG---ATG------------------------TAA------------------------------------------------------------------------------ATG------------------------------TAG---TAA------------------------ATG------------TAA------------------------------TAA---TGA------------------------------TAA---TGA------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------TGA------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------ATG---------------------------------------------------TAA---TAA------------------TGA---------------------------------------------------ATG---------------------------------------------------ATGTAG------------------------------ATGTAA---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2  SIG                                     Xt7.1-CBXT11858.5 TGTTTTGACCGCGTGGGCGGCTACNACTGCATCTGCCCCCCGGGCTTCGTGGGCGAACGCTGCGAAGGCGACGATGAACGAGTGCTTATCCAATCCCTGCGACCCCCGCGGGACCCAGAATTGCATCCAGCTGGTGAACGATTACCGGTGCGAGTGCCGGCAGGGATTCACAGGAAGGCGCTGCGACTCTGTCGTGGACGGTTGCAAGGGGTTGCCCTGCAGAAACGGTGGAACGTGTGCCGTCGCCAGCAATACCGAGCGCGGATTTATCTGCAAATGCCCTCCTGGGTTCGACGGAGCCACTTGCGAATACGACGCCCGGACCTGCGGTAACCTGCGCTGCCAGAACGGCGGCACATGTATCTCGGTGCTGAAGAGCTCCAAATGCGTATGCTCGGAAGGATACACCGGCGCCACGTGTCAGTACCCCGTCGTCAGCCCGTGCGCGTCCCGCCCTTGTTACAACGGAGGGACCTGCCAATTCTCCCCCGAGGAACCTTTCTTCCAGTGCTTCTGCCCCACGAACTTCAACGGCCTCTTCTGCCACATCTTGGATTACGGCTTCATCGGAGGCCTGGGCAAGAACATCACCCCTCCCGACAACGAGGAAATCTGCGAGAATGAGCAGTGCGCCGAGCTGGCCGACAACAAGATCTGCAACGCCAACTGCAACAACCACGCCTGCGGGTGGGACGGCGGCGACTGCTCGCTCAACTTCAACGACCCCTGGAAGAACTGCACCCAGTCGCTGCAGTGCTGGAAATACTTCAACGACGGCAAATGCGACTCGCAGTGCAACAACTCCGGCTGCCTGTACGACGGCTTCGACTGCCAGAAAGTGGAGGTTCAGTGCAACCCTTTGTACGACCAGTATTGCAGGGATCACTTTCAAGACGGCCATTGCGACCAAGGCTGTAACAACGCANAGTGCGAATGGGACGGCCTGGACTGTGACAACATGCCGGAGAACCTGGCCGAAGGCACCCTGTTGATAGTCGTCCTGATGCC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AAAACGCTTACCCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTAATTTTTTTTGTTTCCCGGAAACTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAGTGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTGTATATCCTGATTTATATTGCGTAGAACTGGGATAGATGGACGGAGTGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTTTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAAAAAAAA
                                                  Xt7.1-CHK-1008279916       GACCGCGTGGGCGGCTACNACTGCATCTGCCCCCCGGGCTTCGTGGGCGAACGCTGCGAAGGCGACGATGAACGAGTGCTTATCCAATCCCTGCGACCCCCGCGGGACCCAGAATTGCATCCAGCTGGTGAACGATTACCGGTGCGAGTGCCGGCAGGGATTCACAGGAAGGCGCTGCGACTCTGTCGTGGACGGTTGCAAGGGGTTGCCCTGCAGAAACGGTGGAACGTGTGCCGTCGCCAGCAATACCGAGCGCGGATTTATCTGCAAATGCCCTCCTGGGTTCGACGGAGCCACTTGCGAATACGACGCCCGGACCTGCGGTAACCTGCGCTGCCAGAACGGCGGCACATGTATCTCGGTGCTGAAGAGCTCCAAATGCGTATGCTCGGAAGGATACACCGGCGCCACGTGTCAGTACCCCGTCGTCAGCCCGTGCGCGTCCCGCCCTTGTTACAACGGAGGGACCTGCCAATTCTCCCCCGAGGAACCTTTCTTCCAGTGCTTCTGCCCCACGAACTTCAACGGCCTCTTCTGCCACATCTTGGATTACGGCTTCATCGGAGGCCTGGGCAAGAACATCACCCCTCCCGACAACGAGGAAATCTGCGAGAATGAGCAGTGCGCCGAGCTGGCCGACAACAAGATCTGCAACGCCAACTGCAACAACCACGCCTGCGGGTGGGACGGCGGCGACTGCTCGCTCAACTTCAACGACCCCTGGAAGAACTGCACCCAGTCGCTGCAGTGCTGGAAATACTTCAACGACGGCAAATGCGACTCGCAGTGCAACAACTCCGGCTGCCTGTACGACGGCTTCGACTGCCAGAAAGTGGAGGTTCAGTGCAACCCTTTGTACGACCAGTATTGCAGGGATCACTTTCAAGACGGCCATTGCGACCAAGGCTGTAACAACGCANAGTGCGAATGGGACGGCCTGGACTGTGACAACATGCCGGAGAACCTGGCCGAAGGCACCCTGTTGATAGTCGTCCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATTTTCAAAACGCTTACCCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTAATTTTTTTTGTTTCCCGGAAACTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAGTGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTGTATATCCTGATTTATATTGCGTAGAACTGGGATAGATGGACGGAGTGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTTTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAA
  5   1   4      seed Gas8      in                         st116o23.5p TGTTTTGACCGCGTGGGCGGCTACNACTGCATCTGCCCCCCGGGCTTCGTGGGCGAACGCTGCGAAGGCGACGATGAACGAGTGCTTATCCAATCCCTGCGACCCCCGCGGGACCCAGAATTGCATCCAGCTGGTGAACGATTACCGGTGCGAGTGCCGGCAGGGATTCACAGGAAGGCGCTGCGACTCTGTCGTGGACGGTTGCAAGGGGTTGCCCTGCAGAAACGGTGGAACGTGTGCCGTCGCCAGCAATACCGAGCGCGGATTTATCTGCAAATGCCCTCCTGGGTTCGACGGAGCCACTTGCGAATACGACGCCCGGACCTGCGGTAACCTGCGCTGCCAGAACGGCGGCACATGTATCTCGGTGCTGAAGAGCTCCAAATGCGTATGCTCGGAAGGATACACCGGCGCCACGTGTCAGTACCCCGTCGTCAGCCCGTGCGCGTCCCGCCCTTGTTACAACGGAGGGACCTGCCAATTCTCCCCCGAGGAACCTTTCTTCCAGTGCTTCTGCCCCACGAACTTCAACGGCCTCTTCTGCCACATCTTGGATTACGGCTTCATCGGAGGCCTGGGCAAGAACATCACCCCTCCCGACAACGAGGAAATCTGCGA
  5   1   0       add Gas8      in                          st21i13.5p                                                                                                                                                                                                                                                                                                                    GAATACGACGCCCGGACCTGCGGTAACCTGCGCTGCCAGAACGGCGGCACATGTATCTCGGTGCTGAAGAGCTCCAAATGCGTATGCTCGGAAGGATACACCGGCGCCACGTGTCAGTACCCCGTCGTCAGCCCGTGCGCGTCCCGCCCTTGTTACAACGGAGGGACCTGCCAATTCTCCCCCGAGGAACCTTTCTTCCAGTGCTTCTGCCCCACGAACTTCAACGGCCTCTTCTGCCACATCTTGGATTACGGCTTCATCGGAGGCCTGGGCAAGAACATCACCCCTCCCGACAACGAGGAAATCTGCGAGAATGAGCAGTGCGCCGAGCTGGCCGACAACAAGATCTGCAACGCCAACTGCAACAACCACGCCTGCGGGTGGGACGGCGGCGACTGCTCGCTCAACTTCAACGACCCCTGGAAGAACTGCACCCAGTCGCTGCAGTGCTGGAAATACTTCAACGACGGCAAATGCGACTCGCAGTGCAACAACTCCGGCTGCCTGTACGACGGCTTCGACTGCCAGAAAGTGGAGGTTCAGTGCAACCCTTTGTACGACCAGTATTGCAGGGATCACTTTCAAGACGGCCATTGCGACCAAGGCTGTAACAACGCANAGTGCGAATGGGACGGCCTGGACTGTGACAACATGCCGGAGAACCTGGCCGAAGGCACCCTGTTGATAGTCGTCCTGATGCCC
  5   1   2       ext Tbd1      in                        CBXT11858.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTTTCAAAACGCTTACCCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTAATTTTTTTTGTTTCCCGGAAACTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAGTGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTGTATATCCTGATTTATATTGCGTAGAACTGGGATAGATGGACGGAGTGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAAC
  3   1   2       ext Tbd1      in                        CBXT11858.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAGTGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTTTACATTTTTGTAAATATTTATGGTGGATTTTGTTTAAAAAATCTATTTGTATATCCTGATTTATATTGCGTAGAACTGGGATAGATGGACGGAGTGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTTTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAAAAAAAAAAAA
  3   1   4      seed Gas8      in                         st116o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNGNACGGNNAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTNTCCTAAAGGNCGCNGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGNTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGC
  5   1   2  SIG                                    Xt7.1-TEgg042h02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAGCCGCCGCCGCCGCTTTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCGTCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTT
                                                  Xt7.1-CHK-1008279914                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCGCCGCCGCTTTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCGTCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTTTGTT
  5   1   2       add Te4       in                         CAAN7210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTGCTGGAAATACTTCAACGACGGCAAATGCGACTCGCAGTGCAACAACTCCGGCTGCCTGTACGACGGCTTCGACTGCCAGAAAGTGGAGGTTCAGTGCAACCCTTTGTACGACCAGTATTGCAGGGATCACTTTCAAGACGGCCATTGCGACCAAGGCTGTAACAACGCAGAGTGCGAATGGGACGGCCTGGACTGTGACAACATGCCGGAGAACCTGGCCGAAGGCACCCTGTTGATAGTCGTCCTGATGCCCCCCGAAAAGCTGAAGAACAACTCCGTCAACTTCCTCCGAGAGCTGAGCCGAGTGCTCCACACCAACGTGGTGTTCAAGAAAGACAGCAAAGGCGAATACAAGATCTACCCTTACTATGGCAACGAGGAGGAGCTGAAGAAACATCACATCAAGAAGAGGTCGGCGGCTTCCTGGTCGGATGCTCCTACCGCCATCTTCAGTACCATGAAGGAGTCCGTCTTACCAGGAAGGCGCCGTAGGGAGTTGGACCAAATGGAAGTCAGGGGGTCAATCGTATACTTAGAAATAGACAACCGCCAGTGCTACAAATCCTCCTCCCAGTGCTTCACCAGCGCCACCGACGTGGCCGCCTTCCTCGGGGCTTTGGCCACCCATGGCAATCTGAACATCCCCTATAAGATCGAGGCTGTGAAAAGTGAGATAGTCGAGACCGCCAAGCCGCCGCCGCCGCTTTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAAGCTTCATTCCGAAAGAGCCCCAGCA
  3   1   0       add Gas8      in                          st21i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAAAGGNNTTTTNTTATGCNGTTTTTTTTANGNGGGGGNNGGNTCCTTTGNGCCAATAATAAGCCATTNCCCCCCCCCCCACAGGTCAATCGTATACTTAGAAATAGACAACCGCCAGTGCTACAAATCCTCCTCCCAGTGCTTCACCAGCGCCACCGACGTGGCCGCCTTCCTCGGGGCTTTGGCCACCCATGGCAATCTGAACATCCCCTATAAGATCGAGGCTGTGAAAAGTAAGTGCTCGTTTGTCCTCCCATAATCCTCCATTTCGGGGGCAACCTTGATCGTATTCAGTTTAACTTTATAAATAAACAGCATTACCCCCCCTCCTCAT
  3   1   2       add Te4       in                         CAAN7210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATCCTCCTCCCAGTGTTTCACCAGCGCCACGGAGGTGGCCGCTTTCTTGGGGGTTTTGGCCACCCATGGCAATTTGAACATCCCCTATAAGATCGAGGCTGTGAAAAGTGAGATAGTGGAGACCGCCAAGCCGCCGCCGCCGCTTTATCCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATTTTGGTCATCATGGGGGTCATCGGGAATAAGAAGGGGCGCCGGGAACACGGGCAGTTGTGTTTCCCCGAAGGTTTCTTTCCGAAAGACCCCACCAAGAAGAAGCGGCGAGACCCCTTCGGGGAGGATTCCTTCGGTTTAAAACCCTTAAAGAACTTGACGGAGGGTTTTTTTATGGACGCCAATCAGAATGAATGGGGAGACGAGGAGCCCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAATTGACCCCCGACAGTGGACGCAGCAGCACTTGGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATTTTCGTGGCCCTGAGGGTTTCCCCCCCCCTGAAAACC
  5   1   2       ext Gas6      in                         ANBT1942.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGCTCGAGTTAACCGAGCGCACTCTGTTCCTTCCGCAGGTGAGATAGTCGAGACCGCCAAGCCGCCGCCGCCGCTTTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACACAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGGTCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCTTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCANGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTT
  5   1   2       ext Te1       in                        CBWN17520.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAGCCGCCGCCGCCGCTCTATGCCATGTTTTCCATGTTGGTCATCCCGTTGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACCGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCTTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCA
  5   1   3        nb Neu                            TNeu094g14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTGATCATCTTCGTCATCATGGTGGTCATCGTGAATAAGAAGCGGCGCCGCGAACACGGGCAGCTGTGGTTCCCCGAAGGCTTCATTCCGAAAGAGCCCAGCAAGAAGAAGCGGCGAGAGCCCCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTTGACGGACGGCTCTTTTATGGACGACAATCAGAACGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACACAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCCCGTGCCGAC
  5   1   3        nb Neu                            TNeu133d23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTCGGGGAGGATTCCGTCGGCTTAAAACCCCTAAAGAACTGGACGGACGGCTCTTTTATGGACGACAATCAGAATGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGAGGGCGGCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGG
  5   1   2       add Int1      ?                         CAAP12083.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCGATTCGAATTGGCCGAGGCTTTTATGGACGACAATCAGAATGAATGGGGAGACGAGGAGACCCTGGAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGTAAGTTTTCCCTTTGGGTTAGACGGTGTGCGTTGGTATAGATCTACCGCGTGTGCGAGGGGACGGGCCTAACGCTGTGTTGCCTTTGTCTGCGCAGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCA
  5   1   3        nb Neu                            TNeu041j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTATGGACGACAATCAGAATGAATGGGGAGACGAGGAGACCCTGGNAAAACAAGAGGTTCAGGTTTGAAGAGCAAGTGATGCTCCCGGAGCTTGTTGATGACCAAACTGACCACCGACAGTGGACGCAGCAGCACCTCGACGCCGCCGACCTGCGCATTCCATCCATGGCCCCCACACCGCCGCAGGGAGAGATTGATGCTGACTGCATGGACGTCAATGTTCGTGGCCCTGATGGTTTCACCCCGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAA
  5   1   4      seed Brn2      in                        CAAJ20122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCTTATGATCGCTGCCTGCAGCGGAGGAGGACTGGAGACCGGAAACAGCGAAGAGGAAGAGGACGCCTCGGCCAACATGATTTCCGACTTCATCGGGCAGGGCGCCCAACTGCATAACCAAACCGACCGCACCGGCGAGACGGCGCTTCACCTGGCCGCCCGATACGCTCGTGCCGACGCAGCCAAGCGCCTCTTGGAGTCCAGTGCGGACGCCAACGTCCCGGACAACATGGGCAGGACCCCTCTCCATGCAGCGGTGGCCGCCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGT
  5   1   2       ext Spl1      in                        CABK10792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGACGCTCAGGGTGTATTCCAGATTCTCATTCGGAACCGAGCGACCGACTTAGACGCCCGAATGTGCGACGGCACGACCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACGCAGATGTCAATGCTGTCGATGAATTCGGGAAATCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCGATGCTGCGGCCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCATCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAAACACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCACAGA
  5   1   2       ext TbA       in                   TTbA048j16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTTAGACGCCCGAATGTGCGAACGGCACGACCCCCTCTGATCCTGGCCGCGCGTCTGGCCGTGGAAGGGATGGTGGAGGAGTTAATCAACGCTCACCCAGATGTCCATGGCTGTCGATGAATTCCGGGAAATCCTGCTTTGCATTGGGCTGCGGCCGTGAATAACGTCCATGCTGCCGGCCGTGCTCCTCCAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAAGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCTCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCGTCAAGGGCAACGGCTGCAAAGAAGC
  5   1   2       add HdA       in                  THdA013k16.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGTGCTCCTCAAGAGTAGTGCTAATAAGGATATGCAGAACAACAAGGAAGAGACACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCATCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAAGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAGTGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATG
  5   1   3        nb Gas8      ?                           st33e02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCTCTGTTCTTGGCCGCGAGAGAAGGCAGCTACGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCATCAAGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCG
  5   1   2       ext Egg       in                   TEgg069d23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGAGACTGCCAAAGTCCTTCTGGACCACTACGCCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCGTCAAGGGCAACGGCTGCAAAGAAGCCAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACC
  5   1   3        nb Gas                            TGas029k07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAACCGCGACATCACGGACCACATGGACCGTCTGCCCCGCGACATCGCCCAGGAACGCATGCACCACGACATCGTCCACTTGCTGGATGAACACAACCTAGTGAAGAGCCCGACGCTGCACGGCGGCCCGTTGGGCGCCCCGACTTTATCTCCTCCCATCTGCTCCCCTAACGGTTACATGGGGAACATGAAGCCTTCCGTCCAGAGCAAGAAAGCCCGTAAGCCCAGCGTCAAGGGCAACGGCTGCAAAGAAGCCAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGG
  5   1   3        nb Neu                            TNeu082b09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGGCAACGGCTGCAAAGAAGCGAAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCCCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCA
  5   1   2       ext HdA                            THdA003b13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACGGCTGCAAGAAGCCAGGAGCTGAAAGCCAGGAGGAAAAAATCTCAAGACGGAAAAACGAGTCTATTGGATTCGGGCAGCTCCGGGGTGTTGTCCCCGGTGGACTCGCTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGCATGCAGGATTCCCACCTCGGCCTGAATCACATGACCATGGCCAACAAGCAGGAAATGGCTTCCAACAGAATGGCTTTCGACGGCATGACGCCACGCCTGACCCATCTCAACGTCTCCAGCCCCAATACCATCATGACCAACGGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCTACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGGCACTTCTACTCATATC
  5   1   2       ext HeRe                              EC2CAA3DF09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGTCCATGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATCCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACGCAGATATTTACGACTTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAG
  5   1   2       ext Neu       in                   TNeu099e13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCATTTTACCGTGGGAGGAGCTCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGA
  3   1   2       ext Te1       in                        CBWN17520.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCGGCGATGAACGGCCAATGCGACTGGTTTGCACGGCTGCAAAATGGGATGGTCCAGAACCAGTACAACCCAATCAGAAATGGCATCCAACAAGGCAACGCCCAGCAAGCTCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATCCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACGCAGATATTTACGACTTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATAAAAAAAAAAAAAAA
  3   1   2       ext Gas6      in                         ANBT1942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTCAGCATGGCCTTATGAGCTCGCTCCATAACGGTTTGCCGGCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAA
  5   1   2       ext Thy1      in                       CBST13218.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGACGACTCTGTCCCAGATGATGACCTATCAGGCCATGCCCAACACGAGGATGGCCAATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAGTTTTCTAGTATTTATTTATATACGTTCGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTT
  5   1   3        nb Gas8      in                          st36d17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATCAGCCTCATCTGATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAAC
  3   1   3        nb Te3       out                        CAAM7497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATGCAAGCCCAGCAAATGCAACAGCAGCAGAACCTACAGTTGCACCAGAGCGTCCAGCAGCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGCAACGAACCACTGGAATGTTTATTTAGCAG
  5   1   3        nb HeRe                              EC2CAA3DB07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAACCTACATTTGCACCACAGCGTCCAGCAGCAGCAACATCAAAATCCCAACGCAACTTCTACTCATATCTGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGAACACGCAGATATTTACGACTTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCA
  3   1   2       ext Thy1      in                       CBST13218.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAGCAACATCAAAATTCCAACGCAACTTCTACTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAGTTTTCTAGTATTTATTTATATACGTTCGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCTTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGC
  5   1   3        nb Neu                            TNeu011c16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCATATCGGCTCCCCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAA
  5   1   2       add HdA       in                  THdA014l13.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCACTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTCAAAAATG
  5   1   2       ext Tad5      in                         XZT19553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCA
  5   1   2       ext Gas7      in                         XZG62576.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGGTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTT
  5   1   2       ext Egg       in                   TEgg042h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATG
  5   1   2       add HdA                            THdA024k02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGAGTCGCCCCACGGATACTTATCAGACGTGGCCTCTCCTCCGTTGATGACATCTCCGTTCCAGCAGTCCCCCTCCATGCCTCTGAACCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAACNGAAGAC
  5   1   3        nb Gas                            TGas040l15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAGTTTTCTAGTATTTATTTATATACGTTCGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAA
  3   1   2       ext Egg       in                    TEgg042h02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAGAGACATGTAACCGTTTTTAAGTTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTCAGAAATGTCCAGTCAAATTTGGAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAGNGACTATCACCCTGTGACAACNAACATTTTTGTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Egg       in                    TEgg069d23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTCAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTTAAGAAAAAAAAAAAAAAAAA
  3   1   2       ext Spl1      in                        CABK10792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGT
  3   1   3        nb TpA       out                   TTpA036c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCCTTTTATTTATAAGCTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTCAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTGAAAAAAAAAAAAAAAAA
  5   1   2       ext Tad5      in                         XZT26930.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGNNCGTCCGCCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGG
  3   1   3        nb TbA  5g3  out                   TTbA049h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTGGGAGTTTTCTAGTATTTATTTATATACGTTCGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATATTGCCCCAATAGATATTTTTTTTGTACAAATTTTAGGAAATTGTTCCTGATATTGAAAATGACAACGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTTGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACAGGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTTCAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTATGACGCATTCTCAATCAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGCCAACAACATTTTGAAAAAAAAAAAAAAAAAAGCGCC
  5   1   3        nb Egg       in                   TEgg013g23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTC
  3   1   4      seed Brn2      in                        CAAJ20122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTCAAAGATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAG
  3   1   2       ext Tad5      in                         XZT26930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGCCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTAAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGT
  3   1   2       ext Gas7      in                         XZG62576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGGTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGT
  5   1   3        nb HdA                           THdA029c12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTTATGTACGGTTGACCTAAAACACTGCCCTTTGATTTGTAGACTTTTTTTTTAAAAAGAGGTGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTGTGAAGTTGTTCCTGATATTGGAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTGACAGAGGAACCAAAAAAATTAGAAATTTTGAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGGACTAAAAACTATTGTTTTTCCCAGTATTAATGTTGAATCATGTTTAAAATATTTC
  5   1   3        nb Egg                            TEgg122i07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAGCGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACA
  3   1   2       ext Neu       in                    TNeu099e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAAAAAAAAAAAA
  3   1   3        nb Te3  FL   out                         CAAM604.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAG
  3  -1   3        nb Neu       in                    TNeu053k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACCCCTACTGGAAATTGTTCCTGATATTGAAAATGACAATGTATCTTTTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTCAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTG
  3  -1   2       add Gas       in                    TGas108o18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTGAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTGGAAAGTGTCCAATCAAGTTTAGGGACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTAT
  5   1   2       ext HdA       in                   THdA007h06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTG
  3   1   3        nb Egg       in                    TEgg013g23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTTAAGAAAAAAAAAAAAAAAAAA
  3   1   2       ext Tad5      in                         XZT19553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATATGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAGATGTCCAATTAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGT
  5  -1   3        nb Neu       in                   TNeu053k06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTCAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAACCCGGG
  5   1   3        nb Sto1      in                         CABG2380.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATATTTCAACGTTTTTTTCAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGG
  3   1   3        nb Egg                             TEgg008c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATTTGACTTGAAATTTTAAAAACATGTAGCCGTTTTTAAATTTGATGGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAGATGTCCAATCAAATTTAAAAACGGCGAAACATGTTTAAAATTTTAAATCACGCGTCATTTTTTTTTGTTTCCCGGAAACTCTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGTTTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAATCAAAAATCTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCACGCAATCTTTGGTACAAGACCCGTGGCATATTTTCTACATTTTTGTAAATATATATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTCTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTACGCGATTGGACGGTGAGAGGCTCTGCACGAGAAAAAAAAAAAAAAAAAA
  5   1   3        nb HdA                            THdA006c12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGTTTTTAATTTGATTGAAAATTTTCAAAACGNCTTAACCNGTTTATTAAAAAATGTCCAATCAAATTTAGAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGG
  3   1   3        nb Sto1      in                         CABG2380.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTGTTTGTTTGTAATAAAATTGTAC
  3   1   2       add HdA       in                    THdA013k16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGCCAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCCAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCTTATGCCGGAAATGGAGCAAAGATCTGTAGAATGTAGTTTTTTCAACAAAAAAAAAAAAAAAAGCG
  3   1   2       ext TbA       in                    TTbA048j16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTTTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTTGTTTGTTTGTAATAAAATTGTACCAAAATAAAAAAAAAAAAAAAAA
  3   1   3        nb Gas8      in                          st36d17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNCCNTTTTTTTGNTTCCCNGGAANNTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACCAGGGGGACGTACGTTTGGGTCTGACGCATTCT
  5   1   2       add Gas                            TGas110d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATG
  3   1   3        nb Gas8                                  st34e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTNTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATNTAGGAGGCACAAAATAGAACNTTTTAAGTGAAAAAAAACGTTTTTAAGCTNCAAGACGAAAGTGCAAAATATCAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACCAGGGATAAA
  3   1   2       ext HdA       in                   THdA007h06.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATTAATTTTTTTTGTTTGTTTGTAATAAAATTTACAAAATAAAAAAAAAAAAAAAAAAGCG
  3  -1   3        nb Egg       in                    TEgg067n01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTCCCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAATTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGG
  3  -1   3        nb TpA       out                   TTpA058l22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAACCCTGAAAAAAAAGACTATCGCCTGTTGAGA
  3   1   3        nb Gas7      in                         XZG44282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGCAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAAC
  5  -1   3        nb Neu                            TNeu119i05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAAAAAAAAAAAAAAAG
  3   1   2       add HdA       out                   THdA052l22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACACGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAATTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCCCCCAAGAGATACGACTATGCGATTGGACGTTGAGAGACTTTGCACGAGAAAAACGATAAAAACTATTATATAAATATAATTTTATCCTAAAGGACGCCGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGCACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAAAAAAAAAAAAAAAAGC
  5   1   3        nb Gas7      in                         XZG44282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAAAAGG
  5  -1   3        nb Egg       in                   TEgg067n01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAATTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTTTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCCCGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAACCAAAAAAAAAAAAAAAAAAGCGGCCGCGTCGACACTA
  3   1   2       add HdA       in                   THdA014l13.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAACAAATGTTTT
  5   1   2       add Neu                            TNeu011d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAACGTTTTTAAGCTACAANACGAAGTGCAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGNATNNAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAG
  3  -1   2       add Limb                                CBSU6220.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNNCGAAAAAAAACTACATTCTACAGATCTTTGTACAGTTCCGGCATAGGGAGCGAGCGGCCCGACCGCCCATCGCAGAAGACGTAGTGGAACTACAGCCAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTGTATATCCTGATTTATATTGCGTAGAACTGGGATAGATGGACGGACTGCCGCCCAAGATATACTACTATGCGATTGGACGGTGAGAGACTTTGTACGAGAA
  5   1   3        nb Neu                            TNeu100l17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGG
  5   1   3        nb HeRe                             EC2CAA33CA10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTATGGCCAGGAACACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAAATATCTATGGTGGATTTTGTTTAAAAAAATCTATTTGTATATCCTGATTTATATTGCGTAGAACTGGG
  5  -1   2       add Gas       in                   TGas108o18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATTTTTTTTTTTGTTTGTTTAAAAAAAA
  3   1   2       ext HdA                             THdA032e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAGGGGGAGGGGGGGGGTTGGCCGTAGTTCCAATAAGTTTTCTTCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATTTGTGGAATGTAGTTTTTTTTTGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTTTGTTTGTTTGTAATAAAAGTTGTACAAAATAAAAATTTTTTNNAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-XZG42085.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTGTTTGTTTGTTTGTAATAAAATT
                                                  Xt7.1-CHK-1008279920                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCCATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTGTTTGTTTGTTTGTAAT
  5   1   4      seed Eye       in                         CCAX6025.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTTTTGTAGCAATGACATAAGCCAGACGGACCTGCAACAAATGTCGGGCAACAACATTCATTCTGTGATGCCCCAGGACACTCAGATATTTACGAATTCCCTGCCTCCCACTCTTACGCAGTCTATGGCCACCACCCAGTTTTTAACCCCGCCTTCTCAGCATAGTTACTCCTCCCCGATGGACAACACGCCGAGCCATCAACTACAAGTACCAGACCACCCATTTTTGACGCCTTCTCCCGAGTCACCTGACCAGTGGTCAAGCTCCTCCCCTCATTCGAACATGTCTGATTGGTCGGAAGGAATATCAAGCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAAT
  5   1   3        nb Neu       in                   TNeu098i08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAATATCAAGTCCCGCCCACGAGTATGCAGCCTCAGCGCACCCACATACCCGAAGCTTTCAAATAAAAGAAAAATGTCAAATATTTGCTTTTGAAATTTTAAAGACACTGAGAGACTTTTTAAGAGACTGAAGGAAATTTTTATACCGTTTTTATACGTAAAATAACAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTT
  5   1   2       ext Gas7      in                         XZG42085.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAACTTTTGAATTTTCTAGTATTTATTTATATACGTTTGACCTAAAACACTGCCCTTTTATTTATAAGCTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCACTGGAATGTTTATTTAGCAGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTTCAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTG
  3   1   3        nb Neu       in                    TNeu098i08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTTGCCTTAATAGATATTTTTTTTGTACAAATTTTATGAAATTGTTCCTGATATTGAAAATGACAATGTATTTATTTTCTATTGCCCCTAAATAATATGCAGGAACGAACCCCTGGAATGTTTATTTTGCCGAAGAACAAAAAAAATTAGAAATTTTTAAGATTTTCTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTATAGCACTAAAAACTATTTTTTTTCCCAGTATTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAATGTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTTGATTGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTTTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Neu5      in                         ANHP2986.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAACC
  5   1   2       ext Neu5      in                         ANHP2986.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCAAATTTAAAAACGGTGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas7      in                         XZG42085.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTTCAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGCAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTGTTTGTTTGTTTGTAATAAAATTGTAC
  3   1   4      seed Eye       in                         CCAX6025.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTAAGCTACAGGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAAGGGATAAAATCCTGAAAAAAAAGACTATCCCCTGCAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATTTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCCCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCCCGAGAAAAACGATAAAAAATTTTTTATAAATATAATTCTTTCCTAAAGGCCGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCCCTACGTTTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAATGTAACGTATCAATTGGAAATGTTGTAGTTTACACAAAGACATTTTGTTGTTGTTAACACTTCTGTAAACAAATGTTTTTTTTTTTGTTTGTTTGTAATAAAATTGTAC
  5   1   2                                         Xt7.1-TNeu102n20.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACTAGTGTCGACGCGGCCGCTTTTTTTTTTAACCTTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTGGCCTTAATAAATATTTTTTTTGTCCAAATTTTATGAAATTGTTCCTGATTTTGAAAATGACAATGTTTTTATTTTCTATGGCCCCTAAATAATATGCAGGACCAAACCACTGGATTGTTTTTTTACCAAAAAACCAAAAAAATTTAAAATTTTTTAAAATTTTTTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTTTAGCACTAAAAACTATTTTTTTTCCCAGTTTTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAAGGTTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTGGATGGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGGGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGGTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAA
                                                  Xt7.1-CHK-1008279912                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTGTCGACGCGGCCGCTTTTTTTTTTAACCTTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTGGCCTTAATAAATATTTTTTTTGTCCAAATTTTATGAAATTGTTCCTGATTTTGAAAATGACAATGTTTTTATTTTCTATGGCCCCTAAATAATATGCAGGACCAAACCACTGGATTGTTTTTTTACCAAAAAACCAAAAAAATTTAAAATTTTTTAAAATTTTTTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTTTAGCACTAAAAACTATTTTTTTTCCCAGTTTTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAAGGTTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTGGATGGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGGGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGGTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAAAAAAA
  5   1   4      seed Neu       in                   TNeu102n20.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACTAGTGTCGACGCGGCCGCTTTTTTTTTTAACCTTTTTTTTTTAAAAAAAAATGTAACTTTTTTTTTTTATCTGGCCTTAATAAATATTTTTTTTGTCCAAATTTTATGAAATTGTTCCTGATTTTGAAAATGACAATGTTTTTATTTTCTATGGCCCCTAAATAATATGCAGGACCAAACCACTGGATTGTTTTTTTACCAAAAAACCAAAAAAATTTAAAATTTTTTAAAATTTTTTATAAAATGACATCTTGTTCCGTTCCGGGATTTCATTTTTAGCACTAAAAACTATTTTTTTTCCCAGTTTTAATGTTAAATCATGTTTAAAATATTTCAACGTTTTTTTCAAAAGGTTTTTTAAATTTGACTTAAAATTTTAAAAACATGTAACCGTTTTTAAATTGGATGGAAAATTTTCAAAACGCTTAACCGTTTATTAAAAAATGTCCAATCAAATTTAAAAACGGGGAAACATGTTTAAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGT
  3   1   4      seed Neu       in                    TNeu102n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATTTTAAATCACGTGTCATTTTTTTTTGTTTCCCGGAAACTTTTTTTTTTTTTGTTATTTCACCTGGAAATTGGACAAAAGGCGTGAAAAGATGCTCCGAGTGCCTCCCGCTATCTAGGAGGCACAAAATAGAACTTTTTAAGTGAAAAAAAACGTTTTTAAGCTACAAGACGAAAGTGCAAAATACAGGGGGACGTACGTTTGGGTCTGACGCATTCTCAACAGGGATAAAATCCTGAAAAAAAAGACTATCACCTGTGACAACAACATTTTTGTAAGAAAAAAAACAAAAAACTGGCATTTGGAACCCCCTGCGTCGGCATTGGTCAGAAAATGCATGCAATCTTTGGTACAAGCCCGTGGCATATTTTCTACATTTTTGTAAATATCTATGGTGGATTTTGTTTAAAAAATCTATTTTGTATATCCTGATTTATATTGCGTAGAACTGGGGTAGATGGACGGAGCGCCGCCCAAGAGATACGACTATGCGATTGGACGGTGAGAGACTTTGCACGAGAAAAACGATAAAAAATATTATATAAATATAATTCTATCCTAAAGGACGCTGAACAAAAAGGGGGAGGGGGGGGGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Tbd1      in                        CBXT13438.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTGGCTGTAGTTCCACTACGTCTTCTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGGTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAAAAAAAAAAAA
  3   1   2       ext Tbd1      in                        CBXT13438.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTTGGCTGTAGTTCCACTACGTTTTTTGCGATGGGCGGTCGGGCCGCTCGCTCCCTATGCCGGAACTGTACAAAGATCTGTAGAATGTAGTTTTTTTTCGAACAAAAACAAAAAAAAAAAAAATGTAACGTATCAATTGGAAATGTAGTTTACACAAAGACATTTTGTTGTTGTTGTTAACACTTCTGTAAACAAATGGTTTTTTTTTGTTTGTTTGTAATAAAATTGTACAAAATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)