Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 05 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 545.0    0Xt7.1-CABJ9003.3.5                          9 PI      83        101      677                Unknown (protein for MGC:121554) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012154021 Xt7.1-XZG45277.5.5 - 45 ESTs
                                                                       ...-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZG45277.5.5                                                                                                                                                                                                                                                                                                                          GCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAACTAAGCCTGTTGTTCTTTTCTTGCCTCCATGAGGGAGAAATTATAAATAAGACGACCACATCTAGTGGAAATTCAGGGATCTACTTTCTAACGCAAATCATTAAAACTTCCCCTGAGATCTCGGCGAAAGATGAGAATTAGCTCTGCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGAAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTCTCTGTGAGCCCCAACCATCTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTCTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGCGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGCGCAGTCTATCTGCTCCTCAACAATATATGAAAATTGCTGCTATTCTGCACCGCTCGTCGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAACGAACTCAATT
                                                  Xt7.1-CHK-1008265912                                                                                                                                                                                                                                                                                                                                ACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAxxAxxGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAACTAAGCCTNxTxxTCTTTTCTTGCCTCCATGAGGGAGAAATTATAAATAAGACGACCACATCTAGTGGAAATTCAGGGATCTACTTTCTAACGCAAATCATTAAAACTTCCCCTGAGATCTCGGCGAAAGATGAGAATTAGCTCTGCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGAAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTCTCTGTGAGCCCCAACCATCTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTCTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGCGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGCGCAGTCTATCTGCTCCTCAACAATATATGAAAATTGCTGCTATTCTGCACCGCTCGTCGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAAxxxAxTCAATTCATGTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                               8     9     9    10    12    13    13    14    13    14    14    16    14    16    14    16    14    16    15    16    15    16    16    17    16    17    17    18    18    18    18    18    19    19    19    19    19    19    19    19    20    20    20    20    20    20    20    20    19    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    22    22    22    22    22    22    22    22    20    22    20    22    20    22    20    23    20    23    21    23    21    25    17    23    15    19    17    21    18    21    20    21    23    24    23    24    24    26    23    25    22    25    22    25    20    23    20    22    20    22    20    22    22    24    21    22    21    22    21    22    21    23    20    21    20    21    20    21    18    20    18    19    16    18    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    13    16     9    16     9    16     9    16     8    15     8    15     8    15     8    15     8    15     8    15     8    15     7    13     7    10     8    11     8    10     2     3     1     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     2     4
  5   1   2      ests                                 Xt7.1-XZG45277.5                                                                                                                                                                                                                                                                                                                          GCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAAC
  5   1   2      ests                                 Xt7.1-XZT66878.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGGGATCTACTTTCTAACGCAAATCATTAAAACTTCCCCTGAGATCTCGGCGAAAGATGAGAATTAGCTCTGCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGTAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTCTCTGTGAGCCCCAACCATCTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTCTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGCGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGCGCAGTCTATCTGTTCCTCAACAATATATGAAAATTGCTGTTATTTTGCACCGCTCGTGGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAAACGAACTCACTTGGTAGAGCCCAGCCCGGCAAAAAAAAAAAAAAGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                               BLH ATG     101     749                                                                                                                                                                                                                                                                                                                          
                                               BLH MIN      92     155                                                                                                                                                                                                                                                                                                                          
                                               BLH OVR     101      56                                                                                                                                                                                                                                                                                                                          
                                               EST CLI      -7      25                                                                                                                                                                                                                                                                                                                          
                                               ORF LNG     101       3                                                                                                                                                                                                                                                                                                                          
                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 2e-007     NP_011419.1 Target of SBF; Tos8p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Bf ---- 3e-008     AAM18882.1 unknown [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 8e-065     NP_504420.1 C.Elegans Homeobox (ceh-33) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN --- Dm ---- 2e-097     NP_476733.1 sine oculis CG11121-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 5e-099     BAE06687.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 1e-106     XP_781551.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 5e-151     NP_001038150.1 sine oculis homeobox homolog 1 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 2e-155     NP_033215.1 sine oculis homeobox homolog 1 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 8e-157     NP_005973.1 sine oculis homeobox homolog 1 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 9e-158     NP_996978.1 sine oculis homeobox homolog 1 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 2e-164     AAF91422.1 homeobox protein SIX1 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 2e-166     AAI35609.1 Unknown (protein for MGC:121568) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 2e-166     NP_001093693.1 SIX homeobox 1 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-XZG45277.5.5                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------TGA---ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------ATG------------------------------------------------ATG---------------------------------------------------------------------TGAATG------------------------------------------------------------------------------------------TAA------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------TAATAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------TAG------------------------------------TAA------ATG------------------------------------------------------TAG---TAA---------------------TAA---------------------ATG---------------------------------------------------------------------------------------TAATAA------ATG------------------------------------------------------------------------------------TGA---------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------TAA------------TGA------------------ATG---------------------------ATG---------TAG------------TGA------------------------------------TAATAATAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Tad5 FL                          XZT44146.FL-MGC                                                                                                                                                                                                                                                                                                                          GCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-XZG45277.5                                                                                                                                                                                                                                                                                                                          GCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAAC
                                                  Xt7.1-CHK-1008226707                                                                                                                                                                                                                                                                                                                                ACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAxxAxxGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAACTAAGCC
  5   1   2       bld Gas8 5g3  in                         st113e15.5p                                                                                                                                                                                                                                                                                                  CGGGCTGCAGCATCCCCCAGACAAGCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGAGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGANGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAA
  5   1   2       bld Neu  5g3  in                   TNeu098p21.p1cSP6                                                                                                                                                                                                                                                                                                              CATCCCCCAGACAAGCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCACAGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATG
  3   1   2       bld HeRe      in                      EC2CAA5AB09.b1                                                                                                                                                                                                                                                                                                                  GGAGACAAGCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACGCTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTCAAGAACAGGAGG
  5   1   2       bld HeRe      in                     EC2CAA35CC11.g1                                                                                                                                                                                                                                                                                                                   GAGACAAGCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGGGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGA
  5   1   2       bld HeRe      in                     EC2CAA39AF05.g1                                                                                                                                                                                                                                                                                                                   GAGACAATCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAAGCAAAGGGAC
  5   1   2       bld HeRe      in                      EC2CAA5AB09.g1                                                                                                                                                                                                                                                                                                                   GAGACAAGCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACGCTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGG
  5   1   2       bld 1030 5g                         IMAGE:7093416.5p                                                                                                                                                                                                                                                                                                                    AGACAAGCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGA
  5   1   2       bld Tad5 FL   in                         XZT44146.5p                                                                                                                                                                                                                                                                                                                          GCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGGCATGGCCTACAGGGGCACCCAGCACAGCTGCAGGACTCTCTGCTTGGGCCCT
  5   1   2   12  bld Tad5 5g3  in                         XZT71577.5p .........................................................................................................................................................................................................................................................................................................................GCCAGTACTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCACGAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTC
  5   1   2   12  bld Tad5 5g3  in                         XZT66878.5p ................................................................................................................................................................................................................................................................................................................................CTTTCCCTGCGCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTC
  5   1   2   12  bld Gas7 5g3  in                         XZG45277.5p ..........................................................................................................................................................................................................................................................................................................................................GCTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACTTCCACAAGAATGAGAGTGTTCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGGCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGC
  5   1   2       bld Gas                            TGas043i21.p1kSP6                                                                                                                                                                                                                                                                                                                                            CTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCC
  5   1   2   10 seed Mus1 5g3  in                          CABH389.5p ...........................................................................................................................................................................................................................................................................................................................................CTCAGAGCCGTGGATATAGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCTTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCA
  5   1   2   10  bld Tail 5g3  in                          CBSW636.b1 ............................................................................................................................................................................................................................................................................................................................................................AGCGTGTGCTCCCCGTGTATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGC
  5   1   2       bld Gas8      in                          st18c15.5p                                                                                                                                                                                                                                                                                                                                                                              TATGCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAGCCATGTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCANAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCANAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGANCGCTCTCANCGCCTCCCAGGGCGGCCATGGNCNTACAGGGGCAC
  5   1   2       bld Gas8 5g3  in                          st24e04.5p                                                                                                                                                                                                                                                                                                                                                                               GCCTTTACGTGTGCGCTGTGGGCCCCTGGCTGTGCCACACTGAAGCCATGTTCTATGCTGCCTTCCTTTGGCTTCACTCAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGA
  3   1   2       bld HeRe      in                     EC2CAA35CC11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGAGCAAGTGGCCTGTGTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGGGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTCAAGAACAGGAGG
  5   1   2       bld Gas8      in                          st46f18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTGCGAGGTGCTGCAGCAGGGAGGCAACCTGGAGAGACTGGGCAGGTTCCTATGGTCCTTGCCAGCCTGTGATCACCTCCACAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCA
  5   1   2       bld Gas8                                  st19c15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGACTGGGCAGGTTCCTATGGTCCTTGNCAGCCTGTGATCACCTCCNCAATAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCNNANAACTGTATAANATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGANAAGTCCCGAGGGGTGCTGAGAGAATGGGAAAATACAGAAAACAATAACACATCTA
  5   1   2       bld Tad5                                 XZT24501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGAATGAGAGTGTGCTGAAGGCAAAGGCCGTGGTGGCATTTCACAGGGGCAACTTCAGAGAACTGTATAAGATACTGGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTATACT
  3   1   2       bld HeRe      in                     EC2CAA39AF05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGAGCCATCAGTTCTCCCCGCACAACCACCCCAAACTGCAGCAACTCTGGCTCAAGGCTCACTATGTGGAAGCAGAGAAACTGAGGGGGAGACCGCTGGGGGCAGTGGGCAAGTACAGGGTCAGAAGGAAATTCCCCCTGCCCAGGACAATCTGGGATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTG
  5   1   2       bld Limb      in                        CBSU9138.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATGGAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTG
  5   1   2       bld Neu       in                   TNeu053f02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGAAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGTATGCCCATAACCCTTACCCGTCTCCCAGGGAGAAGCGGGAGCTGGCTGAGGCCACTGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCA
  3   1   2       chi Gas8      in                          st18c15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGGGCAGGGGCNAGTACAGGGTCAGAAGGAATTNCCCCTGCCCAGGACAATNNGGATGAGNAGAGACCAGTTACTGCTTTAAGGAGAAGTCCCGAGGGGTGCTGAGAGAATGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTGAAAGAAGATGC
  5   1   2       bld TpA       in                   TTpA041l12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGAAGCGGGAGCTGGCTGAGGCCACTGGGACTAACCACCACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAACTAAGCCTGTTGTCT
  3   1   2       bld Tad5 FL   in                         XZT44146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACC
  3   1   2       bld Gas8 5g3  in                         st113e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCCAGGTCAGCAATTGGTTCAAGAACAGGAGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTGAAAGAAGATGC
  3   1   2       bld Mus1 5g3  in                          CABH389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCAGGTCAGCAATTGGTTCAAGAACAGAGGGCAAAGGGACAGAGCGGCGGAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTAC
  3   1   2       bld Gas8 5g3  in                          st24e04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGCAAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTGAAAGAAGATGCAAAG
  3   1   2       bld Gas7 5g3  in                         XZG45277.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGGGACAGAGCGGCGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAG
  3   1   2       bld Gas8      in                          st46f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGGGACAGAGCGGGGGAAGCAAAAGAGAGGGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTGAAAGAAGAT
  3   1   2       bld Tail 5g3  in                          CBSW636.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAAATACAGAAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCCGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTAAAAAAAAAAAAAAA
  3   1   2       bld Gas8      in                          st47f18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACAGAAAACAATAACACATNTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTT
  3   1   2       bld Limb      in                        CBSU9138.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAACAATAACACATCTAGCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCAAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGT
  5   1   2       bld Gas8      in                          st47f18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAACAAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGC
  3   1   2       bld Gas8                                  st75a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACAGAATCAGCTGTCACCCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCTTGTTGGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCNTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTAGGGCCCCTCACCTCCAGCNTGGTGGATCTGGGATNGTAAGAGCGACCGCCGGANTCAGCCATGGACTGCACTNTTATTGTACATAGCAAGGCACTCATCTCATGGTANTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTGTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTNTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCAAAAAACAACTGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTNTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTGAAAGAAGAT
  3   1   2       bld Neu  5g3  in                    TNeu098p21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTAGATGGAGGAAAGTCGCTAATGTCCAGTTCAGAAGAGGAATTCTCCCCCCCCCACAGAGCCCGGATCAGAACTCTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCCAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Bone      in                        CBTC5151.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCCTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCCAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACC
  3   1   2       bld Bone      in                        CBTC5151.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTGCTCCTGTTGCAGGGCAGCCTCACCCACCCCGGCGGCTCTTCTTATTCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGTTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCCAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACC
  3   1   2       bld Tad5 5g3  in                         XZT71577.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCCTGAGCGCTCTCAGCGCCTCCCAGGGCGGCCATGGCCTACAGGGGCACCAGCACCAGCTGCAGGACTCTCTGCTTGGGCCCCTCACCTCCAGCCTGGTGGATCTGGGATCGTAAGAGCGACCGCCGGACTCAGCCATGGACTGCACTCTTATTGTACATAGCAAGGCACTCATCTCATGGTACTTAATGTGGAAAGGAAACTGGGACTTTTTATACTTTTCTTCGGTACAATCAATCCCACACAGCACCCCGCACCGCTGAATGCTCTTACGTTACGGCCTCCTGTGGCACTCATATACCCTCTTCCCCCAAATTGCTGTAACAAAATACTGTATAGGAGATACCACAAGGATATAACTGTGTCTTATTTATGAACACCCCTCCCCCCCCAAAAACAATGTGGTTAAACATGGGAAATCTGGAGAGAATTGCTGTTTGCTCCCACTGTGACACCTAGAATAATTGCCCAGCTATTTGGAGGCGCTAAGTTTACATTTCCCCCCACATTTAGTGTTGAAAGAAGATTGCAAAGTAGTTTATAATAAAATACAGTATTAGAAAGT
  3   1   2       bld TpA       in                    TTpA041l12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAGTTTATAATAAAATACAGTATTAGAAAGTACAAACCAACTAAGCCTNGTTGTCTTTTCTTGCCTCCATGAGGGAGAAATTATAAATAAGACGACCACATCTAGTGGAAATTCAGGGATCTACTTTCTAACGCAAATCATTAAAACTTCCCCTGAGATCTCGGCGAAAGATGAGAATTAGCTCTGCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGAAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTCTCTGTGAGCCCCAACCATCTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTCTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGCGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGCGCAGTCTATCTGCTCCTCAACAATATATGAAAATTGCTGCTATTCTGCACCGCTCGTCGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAACGAACTCAATTCATGTGTTACCAGCACAGCAAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-XZT66878.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGGGATCTACTTTCTAACGCAAATCATTAAAACTTCCCCTGAGATCTCGGCGAAAGATGAGAATTAGCTCTGCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGTAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTCTCTGTGAGCCCCAACCATCTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTCTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGCGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGCGCAGTCTATCTGTTCCTCAACAATATATGAAAATTGCTGTTATTTTGCACCGCTCGTGGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAAACGAACTCACTTGGTAGAGCCCAGCCCGGCAAAAAAAAAAAAAAGG
                                                  Xt7.1-CHK-1008246384                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTACTTTCTAACGCAAATCATTAAAACTTCCCCTGAGATCTCGGCGAAAGATGAGAATTAGCTCTGCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGTAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTCTCTGTGAGCCCCAACCATCTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTCTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGCGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGCGCAGTCTATCTGCTCCTCAACAATATATGAAAATTGCTGTTATTTTGCACCGCTCGTGGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAAACGAACTCACTTGGTAGAGCCCAGCCCGGCAAAAAAAAAA
  3   1   2      seed Tad5 5g3  in                         XZT66878.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGGGATCTACTTTCTAACGCAAATCATTAAAACTTCCCCTGAGATCTCGGCGAAAGATGAGAATTAGCTCTGCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGTAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTCTCTGTGAGCCCCAACCATCTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTCTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGCGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGCGCAGTCTATCTGCTCCTCAACAATATATGAAAATTGCTGCTATTCTGCACCGCTCGTCGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAAACGAACTCAATTCGTGTGTTACCAGC
  3   1   2       bld Neu       in                    TNeu053f02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAGCAAAGAATATTAGATCCGATGTTGTTTGTTACATTCATGCACTAGAAAATAATTGGAAATGAAGCGATATTCATTAGTAAGCAGAGCCTTTTTTGTGAGCCCCAACCATTTGGGATAGCGCTAAGCGCAAAGAGATGGGTTAAGATAACGCAGAGCTGGAAGTTTGCACATGGAATATACACAAATCCGAGTCATAGTAGGGATTAGCTGGGCATGCAGTCCTGTAACTAGCGATAAATGTGGCACATTTCTCCTTATTTAATAAAATAGAATGTGCAGTCAAGTTTGTGGGCAGAGACCATCAGCCCTGCATACCAATTTGCGCCCTGGGGCAGTTTATTTGTTCCTCAACAATATATGAAAATTGCTGTTATTTTGCACCGCTCGTGGTCTATTTATAGCTATCGTTATTAGAATTATGAACTCAAAGCGAATTATGCTTTGTACTTTGTATGTCATTCTCAAACTTTTAGTTTATTTGGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGTATAAAGAATTGTGTAATAATAATAAAAAAAACGAACTCACTTGGTAGAGCCCAGCCCGGCAAAAAAAAAAAAAAGGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HeRe      in                     EC2CAA16AD06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTACCGGTCCGGAATTCCGCCATTATGGCCGGGATTCTCAAACTTTTAGTTTATTTCCAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGTGTAATAATAATAAAAAAACGAACTCAATTCATTGTTACCAGCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA16AD06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATTCTCAAACTTTTAGTTTATTTCGAAGCTTATAATTGCCTTATATCTACATAAGCAAATATACACTGATTGTGTGAATCTAGAAACATGCACACACATACATATGAGTATACTTATATGCAGATTGCTTAGATTTGCAACCAGTGAATCAGAGATACGAATAAAATAGGATTAAAAATTGGTAATAATAATAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)