Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT31775.5                            6 END     3           3       60                Unknown (protein for MGC:121400) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012154099 Xt7.1-CAAK12697.3.5 - 77 ESTs
                                                                       ..-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050......6060......6070......6080......6090......6100......6110......6120......6130......6140......6150......6160......6170......6180......6190......6200......6210......6220......6230......6240......6250......6260......6270......6280......6290......6300......6310......6320......6330......6340......6350......6360......6370......6380......6390......6400......6410......6420......6430......6440......6450......6460......6470......6480......6490......6500......6510......6520......6530......6540......6550......6560......6570......6580......6590......6600......6610......6620......6630......6640......6650......6660......6670......6680......6690......6700......6710......6720......6730......6740......6750......6760......6770......6780......6790......6800......6810......6820......6830
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAK12697.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGACCCTTCACATTGACAAGGTGCAAGATGAGGATGATGGGGACTATCAGTGCATTGCCAAGAACACCCAGGGCAGCTCCAGCCATACCTTCACAGTGGTTGTTGAGTCTGCCCCTTACTGGATTAATAAACCAGAGGATGGAATCTATGCACCGGGTGAGGATATTATACTGCACTGTGAAGTCGGAGGGAAACCCAAACCTAAGGTCACATGGAAGATTAACGGTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAATTCATTATCGAGTATGAGGAAGACAGCTTTGAACCAGGAGTATGGCATGAACTCACTAGAGTGGACGGGGATATGTTTAATGTTGATTTGGATCTCTCTCCCTATGTCAACTACCAGTTCCGAGTGATTGCAGTGAATGAGGTTGGACCTAGCAATGGAAGCAACCCATCAGATCGTTATGAGACTCCTGCATTTGCTCCAGCAAAGAATCCCAGAGAGGTGAAAGGGGAGGGCACAGAGCCACAAAACATGTACATTTCCTGGAAGCCATTGAAAGGCATCGACTGGAATGGCCCTGGCTTCAAATATCTTGTAAAATGGAGGCAACTTGGTAAAGAAGAGTGGAAGGAAGTGGTAGCAGATAGCCCCCCTGTCCTTGTGTCAGGCACTAGCATATTTGAGCCTTATGAGATCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTTAGAAGCTATGAACGAGAGTGCAATCAAGGTTGCATGGTTGCCTGTGCAGAAGAATGGGTTAAACGGTCATTTGAAGGGATTTATGGTATACTATACCAGACATAACGGGCACAACAGGCACCCTGGCAAGTTACTGGTCCATGGTAACACAACACATGCTTTAATTACCGGGCTAAAACCTTACAGCAACTACTCAGTGGAAGTCGCCATCATAAACGGAAAGGGGGAGGGGGAGCATAGCGAGTCACGCATGATACGCACTGATGAAGGAGTGCCAAGTCCACCTTCATTTTTACGGCTGGAGCGCCAATCTGACACATCACTGACACTCATATGGGGCCCCCCCGAAACTCCCAATGGAATTCTGACAGGATACGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACACTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCCCCACCTGTTGGGGCCATTTTGAGGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTGCAGTAACCCATAGCAGCCAATCAGCAGGTAGCATTTACTGATCACCTTATTAGTTGCTATGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGA
                                                  Xt7.1-CHK-1008265028                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTTCACATTGACAAGGTGCAAGATGAGGATGATGGGGACTATCAGTGCATTGCCAAGAACACCCAGGGCAGCTCCAGCCATACCTTCACAGTGGTTGTTGAGTCTGCCCCTTACTGGATTAATAAACCAGAGGATGGAATCTATGCACCGGGTGAGGATATTATACTGCACTGTGAAGTCGGAGGGAAACCCAAACCTAAGGTCACATGGAAGATTAACGGTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAATTCATTATCGAGTATGAGGAAGACAGCTTTGAACCAGGAGTATGGCATGAACTCACTAGAGTGGACGGGGATATGTTTAATGTTGATTTGGATCTCTCTCCCTATGTCAACTACCAGTTCCGAGTGATTGCAGTGAATGAGGTTGGACCTAGCAATGGAAGCAACCCATCAGATCGTTATGAGACTCCTGCATTTGCTCCAGCAAAGAATCCCAGAGAGGTGAAAGGGGAGGGCACAGAGCCACAAAACATGTACATTTCCTGGAAGCCATTGAAAGGCATCGACTGGAATGGCCCTGGCTTCAAATATCTTGTAAAATGGAGGCAACTTGGTAAAGAAGAGTGGAAGGAAGTGGTAGCAGATAGCCCCCCTGTCCTTGTGTCAGGCACTAGCATATTTGAGCCTTATGAGATCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTTAGAAGCTATGAACGAGAGTGCAATCAAGGTTGCATGGTTGCCTGTGCAGAAGAATGGGTTAAACGGTCATTTGAAGGGATTTATGGTATACTATACCAGACATAACGGGCACAACAGGCACCCTGGCAAGTTACTGGTCCATGGTAACACAACACATGCTTTAATTACCGGGCTAAAACCTTACAGCAACTACTCAGTGGAAGTCGCCATCATAAACGGAAAGGGGGAGGGGGAGCATAGCGAGTCACGCATGATACGCACTGATGAAGGAGTGCCAAGTCCACCTTCATTTTTACGGCTGGAGCGCCAATCTGACACATCACTGACACTCATATGGGGCCCCCCCGAAACTCCCAATGGAATTCTGACAGGATACGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACACTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACxxxxxxCCCACCTGTTGGxGxCxxTTTxxxGCCGTGACACTTAATGTATGGGATTCTTCCxGxxxxAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTGCAGTAACCCATAGCAGCCAATCAGCAGGTAGCATTTACTGATCACCTTATTAGTTGCTATGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     4     3     4     3     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     4     5     6     5     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9    11    11    11    11    11    11    11    11    10    11    11    11    12    12    13    13    13    13    15    15    14    15    16    16    10    16    10    15    10    15    10    15    10    15    11    16    11    16    11    16    11    16    11    16    12    17    12    17    12    17    12    17    12    16    12    16    12    16    14    19    14    19    14    19    14    19    14    19    13    18    13    18    14    19    14    19    14    19    14    19    14    19    14    19    14    19    14    19    14    19    14    19    14    19    14    19    14    19    13    18    13    18    12    17    11    17    11    17    11    16    11    15    11    15    11    15    11    15    11    16    11    16    11    16    11    17    11    17    10    16     8    15     7    13     7    12     8    11     8    11     9    11     9    11     8    10     8    10     8    10     8    11     8    11     9    11    10    11    12    13    13    14    13    14    13    14    12    14    11    13     9    12     7    11     7    11     7    11     7    11     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     7    11     8    12     8    12     7    12     7    12     7    12     6    11     6    11     6    11     6    11     6    11     6    12     7    12     8    12     8    12     8    12     7    12     8    12     9    13     9    13     9    13     8    12     8    12     8    12     8    12     9    13     9    13     9    13     9    13     9    13     9    12     9    12     8    12     9    11     8    10     8    10     5     9     4     8     4     9     4     8     4     9     4     9     4     8     4     8     4     8     5     8     4     8     2     8     2     8     2     8     2     8     2     8     2     8     2     8     2     8     2     8     3     9     3     9     3     9     3     9     4     9     4     8     4     8     4     8     4     8     4     8     3     8     3     8     3     8     3     8     3     8     3     8     3     8     3     8     4     9     4    10     4    10     4    10     4    10     6    10     6    10     6    10     5     8     5     8     5     7     5     7     5     7     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     6     4     6     5     7     5     7     5     6     5     6     5     7     5     7     4     6     6     6     6     6     6     6     8     9    10    11    12    13    12    13    12    13    12    15    13    16    16    19    16    19    17    20    17    20    17    20    17    20    17    20    17    20    17    20    17    20    17    20    19    22    19    22    19    22    19    22    19    22    20    23    19    23    20    23    20    23    20    23    20    23    20    23    20    23    20    23    20    23    20    23    20    23    20    23    20    23    21    24    21    24    21    24    21    24    21    24    21    24    20    23    22    25    21    25    22    25    20    24    20    24    20    24    20    23    19    23    20    23    20    23    20    23    18    21    18    21    17    21    17    21    17    21    17    21    17    21    17    21    17    21    17    21    17    21    17    21    16    19    16    19
  5   1   2                                            Xt7.1-CAAN698.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATGAGCGCATTCAATTTGATGACTTTAAGAAGACCCTTCACATTGACAAGGTGCAAGATGAGGATGATGGGGACTATCAGTGCATTGCCAAGAACACCCAGGGCAGCTCCAGCCATACCTTCACAGTGGTTGTTGAGTCTGCCCCTTACTGGATTAATAAACCAGAGGATGGAATCTATGCACCGGGTGAGGATATTATACTGCACTGTGAAGTCGGAGGGAAACCCAAACCTAAGGTCACATGGAAGATTAACGGTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAAATCATTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAA
  5   1   2                                           Xt7.1-CAAK1585.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAAAGGTGGAAATGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAATTCATTATCGAGTATGAGGAAGACAGCTTTGAACCAGGAGTATGGCATGAACTCACTAGAGTGGACGGGGATATGTTTAATGTTGATTTGGATCTCTCTCCCTATGTCAACTACCAGTTCCGAGTGATTGCAGTGAATGAGGTTGGACCTAGCAATGGAAGCAACCCATCAGATCGTTATGAGACTCCTGCATTTGCTCCAGCAAAGAATCCCAGAGAGGTGAAAGGGGAGGGCACAGAGCCACAAAACATGTACATTTCCTGGAAGCCATTGAAAGGCATCGACTGGAATGGCCCTGGCTTCAAATATCTTGTAAAATGGAGGCAACTTGGTAAAGAAGAGTGGAAGGAAGTGGTAGCAGATAGCCCCCCTGTCCTTGTGTCAGGCACTAGCATATTTGAGCCTTATGAGATCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTTAGAAGCTATGAACGAGAGTGCAATCAAGGTTGCATGGTTGCCTGTGCAGAAGAATGGGTTAAACGGTCATTTGAAGGGATTTATGGTATACTATACCAGACATAACGGGCACAACAGGCACCCTGGCAAGTTACTGGTCCATGGTAACACAACACATGCTTTAATTACCGGGCTAAAACCTTACAGCAACTACTCAGTGGAAGTCGCCATCATN------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGCGGCCTGCTCCCCGGGACTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTGAAAATCTGGAGTGATATGGTACAAACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAA
  5   1   2  SIG                                     Xt7.1-CAAK12697.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCATAGCGAGTCACGCATGATACGCACTGATGAAGGAGTGCCAAGTCCACCTTCATTTTTACGGCTGGAGCGCCAATCTGACACATCACTGACACTCATATGGGGCCCCCCCGAAACTCCCAATGGAATTCTGACAGGATACGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACACTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTCCCCGGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCGACAGAGGTGCTTGTATATATAAAGGATATCATTATCGTCCACTGTCTAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTGCAGTAACCCATAGCAGCCAATCAGCAGGTAGCATTTACTGATCACCTTATTAGTTGCTATGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAA
  5   1   2                                           Xt7.1-XZT38665.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACGCTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCTTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCGCGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGTCTATATCCAAGAACCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATAC
  5   1   2  SIG                                     Xt7.1-CABD12497.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCAGGCACCTTATCCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTATTCCACCCCAGCACTATCTCCCTGGGCCTGGGGGATCCTGTTATAGGTTTGTCTCCTGTGAAACGAGCAGCAGCAGGTCCCGCCTCAAACGAGTGCTGTATATAAAGGATACATTCGTCCTGTCTGAATACCACTCCTGTCTCCATCGTGGATGGGTTAGTTATTCTTCTAGGGCGGAGAATACTGATGCCAACCTAAGGACCATGCCGAACAGACTGTTAACTAAGTCATTCCGAATGCTAGGTACCACAGAGAATCCTGGAGCGGAAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTATGTAACTGCGATCACGTTGTAAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -A----------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Br ---- 9e-007     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 8e-013     CAI61931.1 FGF receptor-like protein precursor [Branchiostoma floridae] -----------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bb ---- 1e-013     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 3e-094     NP_001033394.1 Sensory AXon guidance family member (sax-7) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED - Sp ---- 6e-114     XP_784933.2 PREDICTED: similar to Nr-CAM protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN --- Dm ---- 1e-116     NP_727274.1 Neuroglian CG1634-PB [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- ?? ---- 1e-161     NP_001085487.1 MGC80200 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                PROTEIN --- Dr ---- 0          NP_571436.1 neural adhesion molecule L1.2 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PROTEIN --- Gg ---- 0          NP_990597.1 Nr-CAM protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                          PROTEIN --- Hs ---- 0          NP_076493.1 L1 cell adhesion molecule isoform 2 precursor; neural cell adhesion molecule L1;antigen identified by monoclonal antibody R1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                             PROTEIN --- Mm ---- 0          NP_032504.3 L1 cell adhesion molecule [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Xl ---- 0          AAH73282.1 Unknown (protein for MGC:80658) [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN --- Xt ---- 0          AAI35443.1 Unknown (protein for MGC:121400) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAK12697.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------TGA------------------------------TAA------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------TAA---------------------------TGA------------------------------------------TAA------------------------------------------------------------------------------------------------------------TGA------------ATG------------------------------------------------------------------------------TGATAA---------------------------------------ATG------TAAATG---TGAATG------TGA---------------------------------------ATG------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------TGA------------------------TAA------------------------------------------------------ATG------------------------------------TAA------------------------------------------------------------------------------------------TAG------------------ATG------------------------------TAG------------------TGA---------------------------------------------------------TAG---------TAATAA---------------------------------------------------------------------------------------------------------TAA---------------TGA---------------------TAA------------------------------------TAG---------ATG---------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------ATG------------------------------------ATG------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TGA------------------------------------------------------------TGA---------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------ATG------------TAG---------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------ATG---------------TAA---------------------------------------------------TAAATG---------------------TGAATG---------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------ATG---------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------TAA------TGA---------------TGA------------TGA---------------------------------------------TAG------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  3   1   1         - Gas7      in                         XZG15574.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCATACTGATGGCCCGAAAGAAGGGAACAACAAAAACCCGCCCATACTGTGTATGGCGGTTTGTAAAGGTTCTGTCCGTTTGACCCCCAGGCCAATAGATCAGATACCAAACATTGTATGGCCACTTTAAACGGATTCTGTCACGATTTTTATGGTGTACTttacacggtttacattgcaaataattcacactaccatttaaacttttattcttgacccaacaaaagtattatttttagcagtaatattggcgggtaggcgccatttcagtgcattgtgcccgagtctgagctttctgaaggagccaccgctacacattagaacagctttcaggtaacctattgtttttcctactcccC
  5   1   2                                            Xt7.1-CAAN698.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATGAGCGCATTCAATTTGATGACTTTAAGAAGACCCTTCACATTGACAAGGTGCAAGATGAGGATGATGGGGACTATCAGTGCATTGCCAAGAACACCCAGGGCAGCTCCAGCCATACCTTCACAGTGGTTGTTGAGTCTGCCCCTTACTGGATTAATAAACCAGAGGATGGAATCTATGCACCGGGTGAGGATATTATACTGCACTGTGAAGTCGGAGGGAAACCCAAACCTAAGGTCACATGGAAGATTAACGGTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAAATCATTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAA
                                                  Xt7.1-CHK-1008282974                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGCATTCAATTTGATGACTTTAAGAAGACCCTTCACATTGACAAGGTGCAAGATGAGGATGATGGGGACTATCAGTGCATTGCCAAGAACACCCAGGGCAGCTCCAGCCATACCTTCACAGTGGTTGTTGAGTCTGCCCCTTACTGGATTAATAAACCAGAGGATGGAATCTATGCACCGGGTGAGGATATTATACTGCACTGTGAAGTCGGAGGGAAACCCAAACCTAAGGTCACATGGAAGATTAACGGTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAAATCATTATCGAGTA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAA
  5   1   2       ext Brn4      in                        CAAL19071.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATGAGCGCATTCAATTTGATGACTTTAAGAAGACCCTTCACATTGACAAGGTGCAAGATGAGGATGATGGGGACTATCAGTGCATTGCCAAGAACACCCAGGGCAGCTCCAGCCATACCTTCACAGTGGTTGTTGAGTCTGCCCCTTACTGGATTAATAAACCAGAGGATGGAATCTATGCACCGGGTGAGGATATTATACTGCACTGTGAAGTCGGAGGGAAACCCAAACCTAAGGTCACATGGAAGATTAACGGTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGAA
  3   1   2       ext Brn4      in                        CAAL19071.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGACCCTTCACATTGACAAGGTGCAAGATGAGGATGATGGGGACTATCAGTGCATTGCCAAGAACACCCAGGGCAGCTCCAGCCATACCTTCACAGTGGTTGTTGAGTCTGCCCCTTACTGGATTAATAAACCAGAGGATGGAATCTATGCACCGGGTGAGGATATTATACTGCACTGTGAAGTCGGAGGGAAACCCAAACCTAAGGTCACATGGAAGATTAACGGTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAG
  5   1   4      seed Te4       in                          CAAN698.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTAAATCTTTGAAAGACTCAGATCTATACCACAACTGGAAGCTGATAGATGGAAGTCTGGTCTTAAACAACATGCAACTCAACGACACGTCTGTTGTTCAATGCGAAGCCCGCAACAAACATGGAAACCTCCTCGCCAATGCTTTTGTCTATGTAGTTGAACTGCCCCCACAGATCCTCACCAGAAACGATGAGCAGTACATTGTAGTCGAAAAGACAAATGTCTCAATGGACTGTAGAGCTTTTGGGACTCCTTTTCCAACGATCCAATGGGAGAGTGATCTGGAAGACAACCTGTTTGCCCTTGATCAGTTTTCCATGCACACTAATGGGACACTGACCATAACGGGAGTGGCGAAGGAAGATGAAGGAATATATCGGTGCACTGCCAGCAACAACCAGGGAAATGTCAGCATCTCTGCCTACTTAGATGTCAGAAACGCTACTAAGATCATTACTCCCCCTATGGAGCAGCATGCAAGAAAAGGTGGAAAAGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAAATCATTATCGAGTATG
  3   1   4      seed Te4       in                          CAAN698.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGT
  5   1   2                                           Xt7.1-CAAK1585.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAAAGGTGGAAATGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAATTCATTATCGAGTATGAGGAAGACAGCTTTGAACCAGGAGTATGGCATGAACTCACTAGAGTGGACGGGGATATGTTTAATGTTGATTTGGATCTCTCTCCCTATGTCAACTACCAGTTCCGAGTGATTGCAGTGAATGAGGTTGGACCTAGCAATGGAAGCAACCCATCAGATCGTTATGAGACTCCTGCATTTGCTCCAGCAAAGAATCCCAGAGAGGTGAAAGGGGAGGGCACAGAGCCACAAAACATGTACATTTCCTGGAAGCCATTGAAAGGCATCGACTGGAATGGCCCTGGCTTCAAATATCTTGTAAAATGGAGGCAACTTGGTAAAGAAGAGTGGAAGGAAGTGGTAGCAGATAGCCCCCCTGTCCTTGTGTCAGGCACTAGCATATTTGAGCCTTATGAGATCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTTAGAAGCTATGAACGAGAGTGCAATCAAGGTTGCATGGTTGCCTGTGCAGAAGAATGGGTTAAACGGTCATTTGAAGGGATTTATGGTATACTATACCAGACATAACGGGCACAACAGGCACCCTGGCAAGTTACTGGTCCATGGTAACACAACACATGCTTTAATTACCGGGCTAAAACCTTACAGCAACTACTCAGTGGAAGTCGCCATCATN------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGCGGCCTGCTCCCCGGGACTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTGAAAATCTGGAGTGATATGGTACAAACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAA
                                                  Xt7.1-CHK-1008282970                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGGAAATGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAATTCATTATCGAGTATGAGGAAGACAGCTTTGAACCAGGAGTATGGCATGAACTCACTAGAGTGGACGGGGATATGTTTAATGTTGATTTGGATCTCTCTCCCTATGTCAACTACCAGTTCCGAGTGATTGCAGTGAATGAGGTTGGACCTAGCAATGGAAGCAACCCATCAGATCGTTATGAGACTCCTGCATTTGCTCCAGCAAAGAATCCCAGAGAGGTGAAAGGGGAGGGCACAGAGCCACAAAACATGTACATTTCCTGGAAGCCATTGAAAGGCATCGACTGGAATGGCCCTGGCTTCAAATATCTTGTAAAATGGAGGCAACTTGGTAAAGAAGAGTGGAAGGAAGTGGTAGCAGATAGCCCCCCTGTCCTTGTGTCAGGCACTAGCATATTTGAGCCTTATGAGATCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTTAGAAGCTATGAACGAGAGTGCAATCAAGGTTGCATGGTTGCCTGTGCAGAAGAATGGGTTAAACGGTCATTTGAAGGGATTTATGGTATACTATACCAGACATAACGGGCACAACAGGCACCCTGGCAAGTTACTGGTCCATGGTAACACAACACATGCTTTAATTACCGGGCTAAAACCTTACAGCAACTACTCAGTGGAAGTCGCCATCATNAACGGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGCTGAGCGGCCTGCTCCCCGGGACTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTGAAAATCTGGAGTGATATGGTACAAACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCA
  5   1   2       ext Brn3      in                         CAAK1585.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAAAGGTGGAAATGCGATTTTTCAGTGCAAAGTGGAATTTGATCCCAAAATGAGTGATAAAATAATACAGTGGAGGAAAAATGGCAATGAGATAAAAGAAGATGCCGACAATGATAAGTACTTCATTGAGGACTACACCCTAAGTATCTCCAATGTACAAGAGAGCGACCATGGGATGTATACCTGTGCGGCCCACACTGAACTGGATGCCGTAGAACTGACTGCCGAACTGGTGGTGATTGATCTTCCCGAAGCTCCTTTTGATTTGGAGCTTTCTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAATTCATTATCGAGTATGAGGAAGACAGCTTTGAACCAGGAGTATGGCATGAACTCACTAGAGTGGACGGGGATATGTTTAATGTTGATTTGGATCTCTCTCCCTATGTCAACTACCAGTTCCGAGTGATTGCAGTGAATGAGGTTGGACCTAGCAATGGAAGCAACCCATCAGATCGTTATGAGACTCCTGCATTTGCTCCAGCAAAGAATCCCAGAGAGGTGAAAGGGGAGGGCACAGAGCCACAAAACATGTACATTTCCTGGAAGCCATTGAAAGGCATCGACTGGAATGGCCCTGGCTTCAAATATCTTGTAAAATGGAGGCAACTTGGTAAAGAAGAGTGGAAGGAAGTGGTAGCAGATAGCCCCCCTGTCCTTGTGTCAGGCACTAGCATATTTGAGCCTTATGAGATCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTT
  5   1   4      seed Brn4      in                        CAAL12280.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTAACGCACAGGAAACCAGTATAACGCTCACCTGGACCCCAGGCAACGATAACAACAGTCCCATTGAGGAATTCATTATCGAGTATGAGGAAGACAGCTTTGAACCAGGAGTATGGCATGAACTCACTAGAGTGGACGGGGATATGTTTAATGTTGATTTGGATCTCTCTCCCTATGTCAACTACCAGTTCCGAGTGATTGCAGTGAATGAGGTTGGACCTAGCAATGGAAGCAACCCATCAGATCGTTATGAGACTCCTGCATTTGCTCCAGCAAAGAATCCCAGAGAGGTGAAAGGGGAGGGCACAGAGCCACAAAACATGTACATTTCCTGGAAGCCATTGAAAGGCATCGACTGGAATGGCCCTGGCTTCAAATATCTTGTAAAATGGAGGCAACTTGGTAAAGAAGAGTGGAAGGAAGTGGTAGCAGATAGCCCCCCTGTCCTTGTGTCAGGCACTAGCATATTTGAGCCTTATGAGATCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTTAGAAGCTATGAACGAGAGTGCAATCAAGGTTGCATGGTTGCCTGTGCAGAAGAATGGGTTAAACGGTCATTTGAAGGGATTTATGGTATACTATACCAGACATAACGGGCACAACAGGCACCCTGGCAAGTTACTGGTCCATGGTAACACAACACATGCTTTAATTACCGGGCTAAAACCTTACAGCAACTACTCAGTGGAAGTCGCCATCATNAACGGAAAG
  3   1   4      seed Brn4      in                        CAAL12280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAGCTGAGCGGCCTGCTCCCCGGGACTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTGAAAATCTGGAGTGATATGGTACAAACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGG
  3   1   2       ext Brn3      in                         CAAK1585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGT
  5   1   2  SIG                                     Xt7.1-CAAK12697.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCATAGCGAGTCACGCATGATACGCACTGATGAAGGAGTGCCAAGTCCACCTTCATTTTTACGGCTGGAGCGCCAATCTGACACATCACTGACACTCATATGGGGCCCCCCCGAAACTCCCAATGGAATTCTGACAGGATACGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACACTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTCCCCGGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCGACAGAGGTGCTTGTATATATAAAGGATATCATTATCGTCCACTGTCTAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTGCAGTAACCCATAGCAGCCAATCAGCAGGTAGCATTTACTGATCACCTTATTAGTTGCTATGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAA
                                                  Xt7.1-CHK-1008282966                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGAGTCACGCATGATACGCACTGATGAAGGAGTGCCAAGTCCACCTTCATTTTTACGGCTGGAGCGCCAATCTGACACATCACTGACACTCATATGGGGCCCCCCCGAAACTCCCAATGGAATTCTGACAGGATACGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACACTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTCCCCGGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACxxxxxxGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGxxxxxxxxTxTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCxxCxxxGACAGAxGxxxxTGTATATATAAAGGATATCATTATCGTCCACTGTCTxxxxAxCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTGCAGTAACCCATAGCAGCCAATCAGCAGGTAGCATTTACTGATCACCTTATTAGTTGCTATGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCAT
  5   1   2       ext Brn3      in                        CAAK11937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATAGTCCAGTCTGTCAATGATATCGGCAGAGCTACTGAACCCAAACCCGTCATTGGCCATTCCGGGGAAGACATGCCTGACATTACCCCTGAGAATGTTGGCTTAGAAGCTATGAACGAGAGTGCAATCAAGGTTGCATGGTTGCCTGTGCAGAAGAATGGGTTAAACGGTCATTTGAAGGGATTTATGGTATACTATACCAGACATAACGGGCACAACAGGCACCCTGGCAAGTTACTGGTCCATGGTAACACAACACATGCTTTAATTACCGGGCTAAAACCTTACAGCAACTACTCAGTGGAAGTCGCCATCATAAACGGAAAGGGGGAGGGGGAGCATAGCGAGTCACGCATGATACGCACTGATGAAGGAGTGCCAAGTCCACCTTCATTTTTACGGCTGGAGCGCCAATCTGACACATCACTGACACTCATATGGGGCCCCCCCGAAACTCCCAATGGAATTCTGACAGGATACGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACACTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTG
  5   1   2       ext Brn3      in                        CAAK11565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGCATAGCGAGTCACGCATGATACGCACTGATGAAGGAGTGCCAAGTCCACCTTCATTTTTACGGCTGGAGCGCCAATCTGACACATCACTGACACTCATATGGGGCCCCCCCGAAACTCCCAATGGAATTCTGACAGGATACGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACACTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTCCCCGGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATNCAGCGCAGCANAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGNGACTCTGAAGCACGGCCAAATGAAGATGAAACTTTGGGGAATACAGTGACAATGACG
  5   1   2       ext BrSp      in                     EC2BBA15DH10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATCGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCTTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCGCTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAAGGTCATCGG
  5   1   2       ext Ova1      in                         CABE5249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAGGGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTCCCCGGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAAACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAAATCAGAAAAATAAAACAGGGACCATACAGGAAAAAAACATGGA
  3   1   2       ext BrSp      in                     EC2BBA15DH10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCTTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCGCTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAG
  3   1   3        nb Brn3      out                        CAAK1533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAAACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAG
  3   1   2       ext Brn3      in                        CAAK11937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTTTTTATTTCATACGCCTTATGGCCCTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGG
  3   1   2       ext Brn3      in                        CAAK11565.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCACTGATCACTGCCATGGTAGTCNTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGT
  5   1   4      seed Brn3      in                         CAAK9080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCGCGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGA
  5   1   3        nb Brn3      in                         CAAK6188.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCGCGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCCTTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCAC
  3   1   3        nb Te3  5g3  out                       CAAM14984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAAGCACGGCCAATGAAGGATGAAACCTTTGGGGAATACAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACATTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAG
  5   1   2       ext Brn3      in                         CAAK2419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGGTATTACTATCTTACGTGCAGC
  3   1   3        nb Thy1      out                       CBST5597.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATAC
  3   1   2       ext Ova1      in                         CABE5249.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATAC
  3   1   3        nb Tad5 FL   out                        XZT31775.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGATGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGAC
  5   1   2       ext Brn3      in                         CAAK5160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCCTGTCT
  5   1   3        nb Brn3      in                        CAAK10487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCA
  5   1   3        nb Brn3      in                        CAAK12697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAATGAAAAACCAAAGTAAAAAGACAAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGT
  5   1   2       add Brn3      in                         CAAK9641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGGTGCTA
  5   1   3        nb Brn3      in                         CAAK7310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGATGCCATTTCTAGCACCTTATCCCTACAGAAAAGACCTGCATAAGC
  5   1   3        nb Brn3      in                         CAAK3098.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATT
  5   1   3        nb TpA       out                  TTpA015k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAACCCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAA
  5   1   2       ext Brn3      in                         CAAK5905.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAGTGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAATAACANAGATTTAATTTTTAACAAAGAACACCATTTTGCC
  5   1   3        nb In62                            IMAGE:8953149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAATAAACAAAGATTTTATTTTTAACAAAAGAACACCATTTTTGCCAAATTTTGCCCTATTTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTTTTGGGGGGCTGCTTGCTTTGCCAGATATATGCACCCCTTTATTACAACTTACTGTTTTTTGTTGAACAGACTCCCAAACCATAAAAAAGTAATGAATCCCAACAGACCACCTGTTGCCGGCATTTGAGCGTGACACCTAAATCATGGGATCCTCCAGGTGCCAGGACCGAATGCAGTTAG
  5   1   3        nb Tad5                                  XZT8509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTATATGCTGCAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGNGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACACCTTCGCTGTCTCCCATCCCGTTGACATGGTTGTAAAGTCTACA
  5   1   2       ext Brn4      in                        CAAL11868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGGAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCTACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAATAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTTGGGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGNGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACAT
  5   1   3        nb Tad5      in                         XZT53517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGNGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTG
  5   1   3        nb Brn3                                 CAAK2674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAATAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTTGGGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGGATAACCACTGGAAAATGTCCAAACACT
  5   1   2       add Brn4      in                        CAAL18132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACAAAAGAACANCCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTTGGGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAA
  5   1   3        nb Tad5      in                          XZT7386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAA
  5   1   2       add Tad5                                 XZT57337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCGGCCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTAATTCCACCCCAGCCACCTTAATCTCCCTGGGCCTTGGGGGAACCCTGTTATTAGGTATTGTCCCCCCTGTGAAAAACCGAGCAGCAGCAGGGTCCCCGCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGAATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGNNGGGTTATGTAATAAAACATTATTTGCCCTTTTGCAGTAACCCATAGCAGCCAATCAGCAGGTAGCATTTACTGATCATNNCTATTAGTGCTATGGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATA
  5   1   3        nb Tad5                                 XZT61597.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTCAGACAGAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTAACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTgcagtaacccatagcagccaatcagcaggtagcatttactgatcaccttattagttgctatgggttactgcagctgggcaaacttagtgcctttTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCCTGTACTGTGCCACGCTCTCCCCCTCACT
  5   1   2       ext Spl2      in                        CBSS8238.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGTGCTGTATATATAAAGGATATCATTATCGTCCACTGTCTGAGTACCACCTTCGCTGTCTCCCATCCCGTTGACATGGGTGTAAAGTCTACATCTTATCCTTAGGGGGGTCTGAGGGAATAACCACTGGAAAATGTCCAAACACTAAGAGGAAGCAGCATTGCCAGGAAACACAGACAGACTTGTGTATTAAGCTGGATAAAGGGGGTTCCCACTTTTCCATGGCAACCCCCAAGTGATCCACAGCGAAGGATATACCTGGATGCCAAGGTAGGAATATCGTGTCTGTGACGAATTGGTGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTGCAGTAACCCATAGCAGCCAATCAGCAGGTAGCATTTACTGATCACCTTATTAGTTGCTATGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCC
  5   1   3        nb Gas                            TGas050c18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  NAATTCGTGTCTGTGACGAATTGGTNGAAAATCCAACATTCTGTAGGGTAGCTCTGGGGCACTGTGCTTCATTGCAGAGGGCAGGTTGTATATACACATCATTTATACACCTGCAAAATGCCAATGTTTTGACCACTGTTGTGAGCTTCTTCATGTCACAACCAGTAGATCCCCCTTGCAAAGGTTCAAGCTAGACCTATGTCAGTATTGTGGGCTGGAACTGTAACCTACCAACCCTTTCAGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTgcagtaacccatagcagccagtcagcaggtagcatttactgatcaccttattggttgctatgggttactgcagctgggcaaacttagtgcctttTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAAGAAATATGACAAGTTGGTACAGCG
  5   1   2       ext Tad5      in                          XZT5353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCTACCAACCCTTTCGCTGCTTTCCTACATCTACAGGTTGCCCACACTGGGGGTTATGTAATAAAACATTATTTGCCCTTTTgcagtaacccatagcagccaatcagcaggtagcatttactgatcaccttattagttgctatgggttactgcagctgggcaaacttagtgcctttTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAATGGCGTATTC
  3   1   2       add Brn4      in                        CAAL18132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGGGTTACTGCAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCCAAACAGCCCTTTTAGCCAAGATCCCAGACATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAT
  5   1   2       add Gas7      in                         XZG15574.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCTGGGCAAACTTAGTGCCTTTTATTGCATATGGCAGCAAGAGCTTTACCTGGCCCTTGTGACTGGTTCTGAACAGCCCTTTTAGCCCAGAAATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCCTCAGCGGG
  3   1   2       add Brn3      in                         CAAK9641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGCCCTTGTGACTGGTCCCAAACAGCCCTTTTAGCCAAGATCCCAGACATTTGGGAATGAAAGCCTCCCATTAGGACACAACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAAT
  3   1   4      seed Brn3      in                         CAAK9080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACACAACCCGTAGAACATGCGGAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   3        nb Brn3      in                        CAAK12697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACCCGTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   3        nb Brn3      in                         CAAK6188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGTAGAACATGCGGAGGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   3        nb Brn3      in                         CAAK3098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   3        nb Brn3      in                        CAAK10487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAACATGCGGAAGGTGCAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTGTTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   3        nb Tad5      in                         XZT53517.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGATGACTATGTAACTGCGATCACGTTGTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   2       ext Brn3      in                         CAAK2419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGAT
  3   1   2       ext Brn3      in                         CAAK5160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCTCACTGTATAATATCCAGATGTGGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTNTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   2       ext Brn3      in                         CAAK5905.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   2       ext Tad5      in                          XZT5353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGAAAACCC
  3   1   2       ext Brn4      in                        CAAL11868.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCACTGTATAATATCCAGATGTGGGAGAAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCCAC
  3   1   3        nb Brn3      in                         CAAK7310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGGAAATATGACAAGTTGGTACAGGGCAGATGGCAAAAGAATAATTCTATGTATTTTTTTAGGCTCTAATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATATCTCCCCGGCCATGAATGTGCTGCTGTTCGACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATTTTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGAT
  3   1   2       ext Spl2      in                        CBSS8238.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   3        nb Tad5      in                          XZT7386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGGGCTGCTGTTCAACAAGTCGGAATACATAGGGCAAGCGGGAATTTTTAGCCCCAAATAGCAGGGAAGCTTTACACCAACCCAGGCAATTTTGTACATTGCCCACGGAATCAGTGGCCCCCAAAGGCACTTATTTGTTTTACTGTCCCTCCCAGGTTGGTTTTTGCCAATATTACTCCGGAATAGGCCCATTTTTGTCTATAATAGTGTTGCCCGGGCTGATATAAAACTCCCTGAATAGGAGTCCCCCATGCAGGGTCCCCCTAGGGGCATATAATAGTGTATTCCGGGCAATGCGGGCAGACATATCAGGGGGGTTTTCCCTCCAGCCCTCAGGGGGGTGGATGGATTATTTTTGCACCCAGGGGTGTGGGCTGCAGGCCCTTCTGGTGGGGAGGGGGTTAAATTAAAAAAAATGAACCAAAAGCTGCCCCTGATGGGTGCCCCCCTGACCCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTTTCTCCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTGGGTATTGTTAAAGAAAAATAC
  5   1   2       ext Tad5      in                         XZT11523.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCCAAAAAAAAAAAAAAAGG
  5   1   0       chi Gas7      in                         XZG62287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTCAACAAGTCTGAATACATAGGGCAACCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTACGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCCAACCTGCATCATGTGCTTCTGTGGGGAAATGGGGGGCCTCGACGGGATGCCGGGGGCAGTATGCTCCTAATTCTCTTTCTGCGGTTCCAATCATTCATACTGATGGCCCGAATGAAGGGAACAACAAAAACCTGCCCATACTGTGTATGGCGGTTTGTAAAGGTTCTGTCCGTTTGACCCCCAGGCCAATAGATCAGATACCAAACATTGTATGGCCAC
  3   1   2       ext Tad5      in                         XZT11523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGGGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAATGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAA
  3   1   0       chi Gas7      in                         XZG62287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGCAGGGTCACCCTACGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGGGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCCAACCTGCATCATGTGCTTCTGTGGGGAAATGGGGGGCCTCGACGGGATGCCGGGGGCAGTATGCTCCTAATTCTCTTTCTGCGGTTCCAATCATTCATACTGATGGCCCGAATGAAGGGAACAACAAAAACCTGCCCATACTGTGTATGGCGGTTTGTAAAGGTTCTGTCCGTTTGACCCCCAGGCCAATAGATCAGATACCAAACATTGTATGGCCACTTTAAATGGATTCTGTCATGATTTTTATGGTGTACTttacactgtttacattgcaaataattcacactaccatttaaacttttattcttgacccaacaaatgtTAAAAAAAAATAAAAAAAAAAAAAAAAAATAAAG
  5   1   2                                           Xt7.1-XZT38665.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACGCTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCTTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCGCGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGTCTATATCCAAGAACCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATAC
                                                  Xt7.1-CHK-1008282976                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACGCTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCTTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCGCGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGTCTATATCCAAGAACCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAG
  5   1   4      seed Tad5      in                         XZT38665.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGATTTATCATCAGATAGTGAACAAAACTCACACTGGAGCAAAGTACTTCTCTGAAACCATCAATGATCCCACGCAGCAAAACTGGACACTTTCAAATATCAGCTCCAAAGACACCTACCGGTTCTATTTGTATGCCACTACCTCAGTGGGACAGAGTGAAGCTGTTATGGTGGAGGGCAGCACTATGCAGGAGATAGAGGTTCCTCCTGTGCTGAATGTCAGTATCGAGACTGGGGACAACGTGGTCACGCTAAACTGGATGCAACTGGAGGGGCCCAGTAATGCAGAGATCAGAGTGGAGATCAGGAACAAATCCAGTGAACTATTGTGGCGCCACTATGGTTCAGTGAACACCACCGACTCGACCTTCCAGCTGAGCGGCCTGCTTCCTGGGACTTTTTATTTCATACGCCTTATGGCCTTCAATCACACTCAGCATGTTGAAATCTGGAGTGATATGGTACAGACCAGTGGAACAGCAATTCCCACAAAACAGGGAGGATTTCCCAATGAAGGCTGGTTTATTGCACTGATCACTGCCATTGTAGTCCTGCTGCTCATCCTGCTCATCCTGTGCTTTATCAAGCGCAGCAAAGGAGGAAAGTACTCTGTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCGCGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGG
  3   1   4      seed Tad5      in                         XZT38665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGAAGGATAAAGAAGATACTCAAGGGGACTCTGAAGCGCGGCCAATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCTTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAAATGAAAAACCAAAGTAAAAGGCC
  5   1   2       ext Tbd1      in                         CBXT8822.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGAAGGATGAAACCTTTGGGGAATACAGATCTCTAGAAAGTGACAATGACGAGAAGCCCTTTACTAGCAGTCAGCCCTCCCTCAATGGGGAGATCAAGCAACTAGGCAGTGACGACAGCCTGGCCGACTATGGTGGTAGCGTGGATGTCCAGTTCAATGAAGATGGCTCGTTCATTGGCCAGTACAGTGGCAAAAAGGAGAAGGAGCCAACAGGGGGCAATGAGAGCTCTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATCTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTCTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTCTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAAAAGACAAAAAAA
  3   1   2       ext Tbd1      in                         CBXT8822.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTGGAGCAACCTCTCCGGTCAACCCCAACGTTGCAGTTGAATAGAGTGTGTCATGGGGACCAAGAAGGGTCATCGGGGAAGTTTTAGGTTGAATATCGGGGTGGCAGGAGAAACTGGATGGATAAGGAGAATTTATTTTTTGCTTGCACGCCATCTAACTAATTTGGTGCCAGAGGGGGTATTTAGCCCATAACCTTTATAGACTCTCTAGCACCAAAGTGGTTGAACTGCTACATTTTCTTTGGACTGCAGCTCAGTGCCATGTGTGTAAATGGAAATCAAGAAAAAATAAAACAAGGACCATAACAGGAAAAAAAACATGGATGGGTGGCTTCAAATGCCATCTGCCCAGGATGTGTGCCAGTGTTTTCATTTTTATTCAAAAATAAAATAGTAACGAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGTCTATATCCAAGAACCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CABD12497.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCAGGCACCTTATCCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTATTCCACCCCAGCACTATCTCCCTGGGCCTGGGGGATCCTGTTATAGGTTTGTCTCCTGTGAAACGAGCAGCAGCAGGTCCCGCCTCAAACGAGTGCTGTATATAAAGGATACATTCGTCCTGTCTGAATACCACTCCTGTCTCCATCGTGGATGGGTTAGTTATTCTTCTAGGGCGGAGAATACTGATGCCAACCTAAGGACCATGCCGAACAGACTGTTAACTAAGTCATTCCGAATGCTAGGTACCACAGAGAATCCTGGAGCGGAAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTATGTAACTGCGATCACGTTGTAAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAA
                                                  Xt7.1-CHK-1008282980                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCxxTxxAGGCACCTTATCCxxxxAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTATTCCACCCCAGCACTATCTCCCTGGGCCTGGGGGATCCTGTTATAGGTTTGTCTCCTGTGAAACGAGCAGCAGCAGGTCCCGCCTCAAACGAGTGCTGTATATAAAGGATACATTCGTCCTGTCTGAATACCACTCCTGTCTCCATCGTGGATGGGTTAGTTATTCTTCTAGGGCGGAGAATACTGATGCCAACCTAAGGACCATGCCGAACAGACTGTTAACTAAGTCATTCCGAATGCTAGGTACCACAGAGAATCCTGGAGC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAACTGCGATCACGTTGTAAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCA
  5   1   4      seed Tad5      in                         XZT54747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACGGACAAAAAAGGACTGAGGAGAAAACCACGAGGAGAGAAAAAAAAACGAAAAACCAAAGTAAAAAGACAAAAAAAAGACAAAAAAATGCATTTCTCTCTTTCACGCCAAGTTCTGCTTTCACGTTTGCCACAGAAGAGGTGTGTTCCTTTTCTATGTTGTCTTTTATTTGTGATGTTCTCTTCCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTG
  5   1   3        nb Tad5                                  XZT8332.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTTGTCTTTTATTTGTGATGTTCTCTTCCATGACGTTGGGGGGGGGTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAAGCATTTCGTTTTTCCGGGTGCATTCTAGGCACCTTATCCTACAAGAA
  5   1   3        nb Brn3      in                         CAAK2786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGTTCTATATCCAAGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTT
  5   1   2       ext Lun1      in                        CABD12497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAACCCCCACTCCTTTCCATTGGTTATTACTATCTTACGTGCAGCCGGCCAAATGATAAAGACATACAAAAAAAAAAACAACAACAAAAAAAAATCGAACAAATGTGTACGTAAATGTGCTGAATGCAAAAATGAGCAAAGATAACAAAAAACCTTGCGCTTCTCGTTGCGGTAATGACCCCTTTTATTTTCAACCTACTCAATGTTAGGCTGAAACCAGGGGTCCCTCTGCTCTCCTACAGCTCTACAGGCCAATGGCAATAGGGGTTCTCTACATGCACCCCTTGTCTGCCTGTAAGGGTGTTGGTATTAACCCTTTTGCAACTGGGTGGGTTCCAGCAGGCCCCTCTGGTACAACGAGCGAAAGAATGACTATGGCTTTGGTGGTTGCCGCATTAACCCATTGACACTCATCTAGCTCACCAGGATCAATGGACACCATTTCCAGTCTTTATGGTCCAGAATTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAC
  5   1   2       ext In62                            IMAGE:8955200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCATGATTTTCATGGCAGGGCCAAACGCAAGAGCAGTAATTCTATATTTTTGCTGTAAGATACGATGCAGGATTCATTCTCAGGATCTGTAAAGGTCACCTATATGCTGCAAACAGAGCTAGGAAATGCTAGCCTGAGAGATGTAGTCTCATGTCTCCTAGCAACAAGGCTGGAAAACCTCCTTAGGACCAGATTGGGGTGCAATGAAGTCTATTGCTCCCCCTGGTGCTTAAGGTGGGGTTCCACGTGGTAATAACAGGGTTTTAGCATGATGCATAATAAAACAAGGGGGTCGGTTCACAAAAACTGCAGGCGAATGAGGCATTTCGTTTTTCCGGTTGCCATTCTAGGCACCTTATCCTACAAGAAAAGACCTGCATAAGCAGATAATATGAGTGGGCCATCTGAAAACAACAAAGATTTAATTTTTAACAAAAGAACACCATTTTGCCAAATTTTGCCCTATTTTAGCCTATAAAAATGTATAAAAATGGGGTTCTTCCCTGAAAGGACACAAATGTTTTTTTTTTTGGGGCTGCTTGCTTTGCCAGATATATTGCACCCCTTTATTTACAACTTTCTGTTTTTTGTAAACAGACCCCAAACAGAAAGAGTTATGATTCCCACACAGACCCACCTGTTGGCGGCATTTTGAGCCGTGACACTTAATGTATGGGATTCTTCCAGGTGTCAGACCAAATGTCAGTATGTTTTCCTACAGTCTTTTTCCTCAGGAGCTGGTGCATTGTGAAGCTCATTATTCCACCCCAGCACTATCTCCCTGGGCCTGGGGGATCCTGTTATAGGTTTGTCTCCTGTGAAACGAGCAGCAGCAGGTCCCGCCTCAAACGAGTGCTGTATATAAAGGATACATTCGTCCTGTCTGAATACCACTCCTGTCTCCATCGTGGATGGGTTAGTTATTCTTCTAGGGCGGAGAATACTGATGCCAACCTAAGGACCATGCCGAACAGACTGTTAACTAAGTCATTCCGAATGCTAGGTACCACAGAGAATCCTGGAGCGGAAATCTCGA
  3   1   2       ext Lun1      in                        CABD12497.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATGACTATGTAACTGCGATCACGTTGTAAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCTAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGAGAAACCC
  3   1   3        nb Brn3      in                         CAAK2786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTAAGCCTGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCC
  3   1   4      seed Tad5      in                         XZT54747.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTAACTGTGCCACGCTCTCCCCCTCACTGTATAATATCCAGATTGTGGAGAAGGAAATATGACAAGTTGGTACAGCGCAGATGGCAAAGGAATAATTCTATGTATTTTTTTAGGCTCTTATCTTCCAAAAATAACCCAAAAGCATGTGAGGATGCTGTAAGAAGTATTGTGTAAATGCTTAATATAGCTCCCCGGCCATGAATGTGCTGCTGTTCAACAAGTCTGAATACATAGGGCAAGCTGGAATCTCTAGCACCAAATAGCAAGGAAGCTTTACACCAACACAGGCAATCTTGTACATTGCACACTGAATCAGTGGCCCCCAAATGCACTTATTTGTTTTACTGTCCCTCACAGGTTAGTATTTGCCAATATTACTACAGAATATGCACATTTTTGTCTATAATAGTGTTGCACAGGCTGATATAAAACTCACTGAATATGAGTACACCATGCAGGGTCACCCTATGGGCATATAATAGTGTATTCCTGGCAATGCTGGCAGACATATCAGTGGCGTATTCCCTCCAGCCCTCAGCGGGGTCGATGGATTATATTTGCAGCCAGGGGTGTAGGCTGCAGGCACTTCTGGTGGCGAAGGGGTTAAAATAAAAAAAATGAAACAAAAGCTGCGCCTGATGGGTGCCGCACTGAACCTTTTTGAATGTAAATAGTGTTTCTGAAGTTTGTATCTGCCGGTAGTGTATAGGCCTCTGTAAGTCCCTGTCTACAGCTTGGTATTGTTAAAGAAAAATACAACTATATCATGATAAACCCAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)