Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAR6348.5                           11 END     8          15       72                DIP2 disco-interacting protein 2 homolog C [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAJ13805.5                           7 END     6          11       85                hypothetical protein LOC57609 [Homo sapiens]
     3   2.0    0Xt7.1-CAAJ23411.5                           5 END     3           5       60                PREDICTED: similar to DIP2 disco-interacting protein 2 homolog B [Gallus gallus]
     4   2.0    0Xt7.1-CAAK7522.5                            3 END     3           5      100                hypothetical protein LOC239667 [Mus musculus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     5 212.0    0Xt7.1-CAAP10790.3                           4 PI      82       1721     1956                PREDICTED: similar to Alpha adducin (Erythrocyte adducin alpha subunit) [Danio rerio]
     6 208.0    0Xt7.1-CABG12094.3                           2 PI      79       1718     1983                PREDICTED: similar to predicted CDS, polyprotein family member (4B673) [Danio rerio]

 This cluster: approximate FL confidence score = 0%

 1012154140 Xt7.1-CABI4803.3.5 - 51 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          4     6     5     7     5     7     5     8     5     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     9     9    10    10    10    10    12    12    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    16    15    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    14    17    16    17    16    17    16    17     4     8     4     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     3     5     3     5     3     5     3     5     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     5     2     3     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     3     5     3     5     2     5     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     3     6     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     3     5     3     5     3     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     4     5     4     5     4     5     3     5     4     5     3     5     3     5     2     3     2     4     4     4     4     4     4     4     5     5     8     8     8     8    10    10    10    11    14    14    17    18    19    20    19    20    20    21    21    22    21    22    21    22    21    22    21    22    21    22    22    23    22    23    22    23    22    23    22    23    22    24    22    24    22    24    22    24    22    24    22    24    22    24    24    26    24    26    24    26    17    26    17    26    17    27    16    26    16    26    16    26    16    25    16    25    16    25    16    25    16    25    16    25    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24    15    24     9    13     9    13     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4
  5   1   2  SIG                                      Xt7.1-CAAM4222.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACGTCGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGTGATGTTATTGCTAAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTATCTATCGATTTCTATCGATGTAGCTGAGCATTAGTATATATTTTTTGCAGTAAATGTCATTTGTTTTATTTTTTAAGGGACAAAACAAGGGCAAAAATAATAGAAAATATATATAAAGTGATTTTTTTTTTTTTTTTTTTACATATTTAAAATTGGCGTTTTATTGAATTTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAAAAAAACCAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACACGCAGCTTAAATTTACACCATTTTGGTGATTTTCTTACAAATTTAGAGATCCTTGCCCCCCTGCTGATTATAATAAGATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACATATTAATAAAAAAAAAACAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G-A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------A--
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED < Sp <<<< 2e-007     XP_001186458.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED < Dr <<<< 7e-011     XP_683128.1 PREDICTED: similar to Alpha adducin (Erythrocyte adducin alpha subunit) [Danio rerio] <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
                                                    Xt7.1-CABI4803.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------ATG---------------------------------------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------ATG---------TGA------TAATAA---------------------TGA---------------TAA---------TAA------------------------------------------TAA------------------------------ATG------------------------------------------TAA------------------------------------------------------------------------TAA------------------------------------------------TAG------------------------ATG---ATG---------------------------------------------------TAA------TAG---------------------------------------------TGA------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TAG------TGA------------------------------------------------------------------TGA---------TAG---------------------TGA------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TGA------------------------------------------------------------------------------TAA------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGA------TAGTGA------------------------------------------------------TAA---TAA---------------------------------------------------------------------ATGTAG---------------------------TAAATG---------------------------------------------------------TAA------------------------------------------TGA---------ATG------------------------------------------------------------------TAG---------------------------------------------------------------------------ATG------------------TAA---------------------TGATGA------------TAA------------------------------------------TAA------------------------------------------TGAATG------------ATGTGA------------------------------------TAA---TAA------------------------------------------------------------------TAA---------ATG------------------------------------------------TAA------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------TGA---------------------TGA---------------ATG---TGATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                  ]
  5   1   2       add Tad5                                 XZT72578.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCGGGGCGGCACTACTAGCCTAGGAAGGGGCCACACTGATGTATAGGGAGAGATACTATCATAGGGCTGCTGTAGCACCAGCCTGGAAAAGCCACAAACAATTGGACAACATTTGCTGTAGAGTCACTTGCTATAGGATATTAAGTGCCATTTAAGTGAATTTACACACTAAAGTATTATCCCCCCCAGATATGGCACTGTATTTGCACCTGAACGTGGACATAAATGGGGGAAATGTAATAAGGGAGGCAACGTTTGCTACAGGTCGCCCTTTAGCGACCAATCAGCAGCAAGCATTAGCTGAACACCTGTTTCAAAGCAAAATTTCAATTTGTTTGCTGTGGGGGCAGACTCCTAGCAGCTGCACAATACAATAATCAGGATTCTGATGGAGGCAGCTCTTCCTGGTTACAGATATTGGTAAGACTGTTGCACGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGCGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTATACCATTCCTGTTCTTCTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCTTGaaananaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaN
  3   1   3        nb Brn3 5g3  out                        CAAK6498.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTACTAGCCTAGGAAGGGGCCACACTGATGTATAGGGAGAGATACTATCATAGGGCTGCTGTAGCACCAGCCTGGAAAAGCCACAAACAATTGGACAACATTTGCTGTAGAGTCACTTGCTATAGGATATTAAGTGCCATTTAAGTGAATTTACACACTAAAGTATTATCCCCCCCAGATATGGCACTGTATTTGCACCTGAACGTGGACATAAATGGGGGAAATGTAATAAGGGAGGCAACGTTTGCTACAGGTCGCCCTTTAGCGGCCAATCAGCAGCAAGCATTAGCTGAACACCTGTTTCAAAGCAAAATTTCAATTTGTTTGCTGTGGGGGCAGACTCCTAGCAGCTGCCCAATACAATAATCAGGATTTTGATGGAGGCAGCTCTTCCTGGTTACAGATATTGGTAAGACTGTTGCCCGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGGGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTATACCATTCCTGTTTTTTTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCCTG
  3   1   3        nb Brn2 5g3  out                       CAAJ17949.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGTATAGGGAGAGATACTATCATAGGGCTGCTGTAGCCCCAGCCTGGAAAAGCCACAAACAATTGGACAACATTTGCTGTAGAGTCACTTGCTATAGGATATTAAGTGCCATTTAAGTGAATTTACACCCTAAAGTATTATCCCCCCCAGATATGGCACTGTATTTGCACCTGAACGTGGACATAAATGGGGGAAATGTAATAAGGGAGGCAACGTTTGCTACAGGTCGCCCTTTAGCGGCCAATCAGCAGCAAGCATTAGCTGAACACCTGTTTCAAAGCAAAATTTCAATTTGTTTGCTGTGGGGGCAGACTCCTAGCAGCTGCCCAATACAATAATCAGGATTTTGATGGAGGCAGCTCTTCCTGGTTACAGATATTGGTAAGACTGTTGCCCGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGGGGAACGTAATAACTGGGGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTATACCATTCCTGTTTTTCTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCCCGG
  3   1   3        nb Tad5      out                        XZT31323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGATGTATAGGGAGAGATACTATCATAGGGCTGCTGTAGCACCAGCCTGGAAAAGCCACAAACAATTGGACAACATTTGCTGTAGAGTCACTTGCTATAGGATATTAAGTGCCATTTAAGTGAATTTACACACTAAAGTATTATCCCCCCCAGATATGGCACTGTATTTGCACCTGAACGTGGACATAAATGGGGGAAATGTAATAAGGGAGGCAACGTTTGCTACAGGTCGCCCTTTAGCGGCCAATCAGCAGCAAGCATTAGCTGAACACCTGTTTCAAAGCAAACTGTAAATTTGTTTGCTGTGGGGGCAGACTCCTAGCAGCTGCCCAATACAATAATCAGGATTTTGATGGAGGCAGCTCTTCCTGGTTACAGATATTGGTAAGACTGTTGCCCGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGGGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTGTACCATTCCTGTTCTTTTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCTTGG
  3   1   3        nb Egg0      out                        dad68c03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAGGGAGAGATACTATCATAGGGCTGCTGTAGCACCAGCCTGGAAAAGCCACAAACAATTGGACAACATTTGCTGTAGAGTCACTTGCTATAGGATATTAAGTGCCATTTAAGTGAATTTACACACTAAAGTATTATCCCCCCCAGATATGGCACTGTATTTGCACCTGAACGTGGACATAAATGGGGGAAATGTAATAAGGGAGGCAACGTTTGCTACAGGTCGCCCTTTAGCGACCAATCAGCAGCAAGCATTAGCTGAACACCTGTTTCAAAGCAAAATTTCAATTTGTTTGCTGTGGGGGCAGACTCCTAGCAGCTGCACAATACAATAATCAGGATTCTGATGGAGGCAGCTCTTCCTGGTTACAGATATTGGTAAGACTGTTGCACGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGCGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTATACCATTCCTGTTCTTCTCNAAAGAAGACTTCAACATTTGCATTAAATATTTTATTTTTGCCCTTGAAAAAAA
  3   1   3        nb Brn3      out                        CAAK7522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATAGGGCTGCTGTAGCCCCAGCCTGGAAAAGCCACAAACAATTGGACAACATTTGCTGTAGAGTCACTTGCTATAGGATATTAAGTGCCATTTAAGTGAATTTACCCCCTAAAGTATTATCCCCCCCAGATATGGCACTGTATTTGCACCTGAACGTGGACATAAATGGGGGAAATGTAATAAGGGAGGCAACGTTTGCTACAGGTCGCCCTTTAGCGGCCAATCAGCAGCAAGCATTAGCTGAACACCTGTTTCAAAGCAAACTGTAAATTTGTTTGCTGTGGGGGCAGACTCCTAGCAGCTGCCCAATACAATAATCAGGATTTTGATGGAGGCAGCTCTTCCTGGTTACAGATATTGGTAAGACTGTTGCCCGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGGGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTGTACCATTCCTGTTCTTTTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCTTGG
  5   1   2       ext Brn2      in                         CAAJ6408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATATGGCACTGTATTTGCACCTGAACGTGGACATAAATGGGGGAAATGTAATAAGGGAGGCAACGTTTGCTACAGGTCGCCCTTTAGCGACCAATCAGCAGCAAGCATTAGCTGAACACCTGTTTCAAAGCAAACTGTAAATTTGTTTGCTGTGGGGGCAGACTCCTAGCAGCTGCACAATACAATAATCAGGATTCTGATGGAGGCAGCTCTTCCTGGTTACAGATATTGGTAAGACTGTTGCACGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGCGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTGTACCATTCCTGTTCTTCTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCTTGATTCCTGGTTTCCATGTGTTCCATTATATGCTATTAAGAATGAACTTTTTATGACTAGTCTAATAAGGCCAAGCAGTCTGTACGTGGTGATTGGTAAGCAGTGTGTAAAGGTGGCCATAAACAGGCAGATATATACTGCCAATTCAGGCCCTTCAGACTGATTAAGCAGCTTATCTGGCTGTGTGGGGCCCTCCGATGGGCCGTCCCAACTCATATCTGGCTAAAATCAACCAATGTCGATAAGACAGGTTTGATTTTCCCATTGGATCTAGGACCACATGGACTCGTTGTTGTGGTCCTTGGCCCAAAGCCTGTAATCCCTAGGGTCAAATTGGCATACTAGGGAAAGATCAAATGAGCAGGTTTAGTGTCTAAATACTATGTACCTCCAATGGGAATGTGCTCCGTAGAGACTG
  5   1   3        nb Brn3      in                        CAAK12132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGCACGACTTGCTTTTGTTGGTTGCCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGCGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTGTACCATTCCTGTTCTTCTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCTTGATTCCTGGTTTCCATGTGTTCCATTATATGCTATTAAGAATGAACTTTTTATGACTAGTCTAATAAGGCCAAGCAGTCTGTACGTGGTGATTGGTAAGCAGTGTGTAAAGGTGGCCATAAACAGGCAGATATATACTGCCAATTCAGGCCCTTCAGACTGATTAAGCAGCTTATCTGGCTGTGTGGGGCCCTCCGATGGGCCGTCCCAACTCATATCTGGCTAAAATCAACCAATGTCGATAAGACAGGTTTGATTTTCCCATTGGATCTAGGACCACATGGACTCGTTGTTGTGGTCCTTGGCCCAAAGGCCTGTAATCCCTAGGGTCAAATTGGCATACTAGGGAAAGATCAAATGAGCAGGTTTAGTGTCTAAATTACTATGTACCTCCAATGAAAATGTGCTCCGTAGAGACTGATGGGGAATATTTTCATTTGGAGGTATTTGGTACATAATTTGGCTAGGCCAACTGGCAAGTTGACACGCAGCTTANATTTACACCATTTTGGTGATTTTCTTACAAATTTAGAGATCCTTGCCCCCCTGCTGATTATAATAAGATGATTATGTTGTGCACTGAAGCCCTGGGGCCATTACAGGNGCCACATCCA
  5   1   3        nb Ovi1      in                         CABI4803.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGCGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTGTACCATTCCTGTTCTTCTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCTTGATTCCTGGTTTCCATGTGTTCCATTATATGCTATTAAGAATGAACTTTTTATGACTAGTCTAATAAGGCCAAGCAGTCTGTACGTGGTGATTGGTAAGCAGTGTGTAAAGGTGGCCATAAACAGGCAGATATATACTGCCAATTCAGGCCCTTCAGACTGATTAAGCAGCTTATCTGGCTGTGTGGGGCCCTCCGATGGGCCGTCCCAACTCATATCTGGCTAAAATCAACCAATGTCGATAAGACAGGTTTGATTTTCCCATTGGATCTAGGACCACATGGACTCGTTGTTGTGGTCCTTGGCCCAAAGGCCTGTAATCCCTAGGGTCAAATTGGCATACTAGGGAAAGATCAAATGAGCAGGTTTAGTGTCTAAATTACTATGTACCTCCAATGAAAATGTGCTCCGTAGAGACTGATGGGGAATATTTTCATTTGGAGGTATTTGGTACATAATTTGGCTAGGCCAACTGGCAAGTTGACACGCAGCTTAAATTTACACCATTTTGGTGATTTTCTTACAAATTTAGAGATCCTTGCCCCCCTGCTGATTATAATAAGATGATTATGTTGTGCACTGAAGCCCTG
  5   1   4      seed Brn2      in                        CAAJ15079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATATATACTGCCAATTCAGGCCCTTCAGACTGATTAAGCAGCTTATCTGGCTGTGTGGGGCCCTCCGATGGGCCGTCCCAACTCATATCTGGCTAAAATCAACCAATGTCGATAAGACAGGTTTGATTTTCCCATTGGATCTAGGACCACATGGACTCGTTGTTGTGGTCCTTGGCCCAAAGGCCTGTAATCCCTAGGGTCAAATTGGCATACTAGGGAAAGATCAAATGAGCAGGTTTAGTGTCTAAATTACTATGTACCTCCAATGAAAATGTGCTCCGTAGAGACTGATGGGGAATATTTTCATTTGGAGGTATTTGGTACATAATTTGGCTAGGCCAACTGGCAAGTTGACACGCAGCTTAAATTTACACCATTTTGGTGATTTTCTTACAAATTTAGAGATCCTTGCCCCCCTGCTGATTATAATAAGATGATTATGTTGTGCACTGAAGCCCTGGGGCCATTACAGGGGCCACATCCAGCCTGGGGGCCTCCAGTTGGACAGCCTTATTTTAGTGGTATATACAGTTGTGTTCACAATAATAGCAGTGTATTTTATAGAAGTGAATAAAGCTCAAAATCCTTATAATCGCTTTTATTTCCACACACACAAATGCATTCGGAACACTGCACATTCTATTCCAAATCAAAACATAAAGAAAAATGTATCAACTGTGTGTTATTTCTTTAGAGAAAGTGAAGAAAAGGGAATATTAGGCTGGATAAACTGAAAAATGTTTCAAGATTTTGCTTTCCTTTGAATCACTGAAGTAATATTTAGTTGTATAAGCACCAACTTCTGTGAGCAGCTATTCCAGCCCAGGATGATTGGCCTATATTACACA
  5   1   2       ext Spl1      in                         CABK5697.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGGGGGCCTCCAGTTGGACAGCCTTATTTTAGTGGTATATACAGTTGTGTTCACAATAATAGCAGTGTATTTTATAGAAGTGAATAAAGCTCAAAATCCTTATAATCGCTTTTATTTCCACACACACAAATGCATTCGGAACACTGCACATTCTATTCCAAATCAAAACATAAAGAAAAATGTATCAACTGTGTGTTATTTCTTTAGAGAAAGTGAAGAAAAGGGAATATTAGGCTGGATAAACTGAAAAATGTTTCAAGATTTTGCTTTCCTTTGAATCACTGAAGTAATATTTAGTTGTATAAGCACCAACTTCTGTGAGCAGCTATTCCAGCCCAGGATGATTGGCCTATATTACACAATTCTTCTGCATTTCTTGGTTTTGTCTCAGAAACAGTATTTTTGATGTCACCACACAAGTTTTCTATTGGATTAAGGTCGGGGCATTGGGCTGGCCACTCCATAACGTCAATCTTGTTGGTATGAAAACAAGAAGTTGCTCGTTTATGGGTGTGTTTGGGGGTCTTGTTGAAACAATACATTTCAAGGGCATTTCCTCTTGCATAAGGCAAACATAACCTTTTCATTTTGGCTCTTCTATCCATTCGAATGGTAGTTTTTCATTTTCTTCCACATCTTTCAGGTTTCAGGACACAGAATCAGCAGAATCTATTACTCTACTTACACCTACTAGTAGATTATTTGCCCTGTAGAAATGGCAAAAACAGTGACTGATCAGGTTAGTGACGTCGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGTGTGGTTATTGCTAAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTTTACTTGTAAAATTTCTATCGAT
  5   1   3        nb AbdN                               IMAGE:7006780                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCAAATCCTTATAATCGCTTTTATTTCCCACACACAAATGCATTCGGAACACTGCACATTCTATTCCAAATCAAAACATAAAGAAAAATGTATCAACTGTGTGTTATTTCTTTAGAGAAAGTGAAGAAAAGGGAATATTAGGCTGGATAAACTGAAAAATGTTTCAAGATTTTGCTTTCCTTTGAATCACTGAAGTAATATTTAGTTGTATAAGCACCAACTTCTGTGAGCAGCTATTCCAGCCCAGGATGATTGGCCTATATTACACAATTCTTCTGCATTTCTTGGTTTTGTCTCAGAAACAGTATTTTTGATGTCACCACACAAGTTTTCTATTGGATTAAGGTCGGGGCATTGGGCTGGCCACTCCATAACGTCAATCTTGTTGGTATGAAAACAAGAAGTTGCTCGTTTATGGGTGTGTTTGGGGGTCTTGTTGAAACAATACATTTCAAGGGCATTTCCTCTTGCATAAGGCAAACATAACCTTTTCATTTTGGCTCTTCTATCCATTCGAATGGTAGTTTTTCATTTTCTTCCACATCTTTCAGGTTTCAGGACACAGAATCAGCAGAATCTATTACTCTACTTACACCTACTAGTAGATTATTTGCCCTGTAGAAATGGCAAAAACAGTGACTGATCAGGTTAGTGACGTCGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGGTGTGGTTATTGCCTAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTTTACTTGTAAAATTTCTATCGATGTAGCTGAGCATTAGTATAAATTTTTTGCAGTAAAAGGTCATTTGTTTTATTTTTTAAGGGGACAAACAAGGGGCAAAAATAATTGAAAAT
  5   1   3        nb Tad5                                 XZT63301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAAATGCATTCGGAACACTGCACATTCTATTCCAAATCAAAACATAAAGAAAAATGTATCAACTGTGTGTTATTTCTTTAGAGAAAGTGAAGAAAAGGGAATATTAGGCTGGATAAACTGAAAAATGTTTCAAGATTTTGCTTTCCTTTGAATCACTGAAGTAATATTTAGTTGTATAAGCACCAACTTCTGTGAGCAGCTATTCCAGCCCAGGATGATTGGCCTATATTACACAATTCTTCTGCATTTCTTGGTTTTGTCTCAGAAACAGTATTTTTGATGTCACCACACAAGTTTTCTATTGGATTAAGGTCGGGGCATTGGGCTGGCCACTCCATAACGTCAATCTTGTTGGTATGAAAACAAGAAGTTGCTCGTTTATGGGTGTGTTTGGGGGTCTTGTTGAAACAATACATTTCAAGGGCATTTCCTCTTGCATAAGGCAAACATAACCTTTTCATTTTGGCTCTTCTATCCATTCGAATGGTAGTTTTTCATTTTCTTCCACATCTTTCAGGTTTCAGGACACAGAATCAGCAGAATCTATTACTCTACTTACACCTACTAGTAGATTATTTGCCCTGTAGAAATGGCAAAAACAGTGACTGATCAGGTTAGTGACGTCGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGTGTGGTTATTGCTAAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTTTACTTGTAAAATTTCTATCGATGTAGCTGAGCATTAGTATATATTTTTTGCAGTAAATGTCATTTGTTTTATTTTTTAAGGGACAAAACAGGGGCAAAAAATATA
  5   1   2       ext Thy1      in                        CBST1811.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTCGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGTGTGGTTATTGCTAAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTTTACTTGTAAAATTTCTATCGATGTAGCTGAGCATTAGTATATATTTTTTGCAGTAAATGTCATTTGTTTTATTTTTTAAGGGACAAAACAAGGGCAAAAATAATAGAAAATATATATAAAGTGATTTTTTTTTTTTTACATATTTAAAATTGGCGTTTTATTGAATTTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAG
  5   1   3        nb Te5                                   CAAO398.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTTTACTTGTAAAATTTCTATCGATGTAGCTGAGCATTAGTATATATTTTTTGCAGTAAATGTCATTTGTTTTATTTTTTAAGGGACAAAACAAGGGCAAAAATAATAGAAAATATATATAAAGTGATTTTTTTTTTTTTACATATTTAAAATTGGCGTTTTATTGAATTTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCANAACTTGATCTCACCAATA
  3   1   3        nb Brn2 5g3  out                       CAAJ13805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTGAATTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCNCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Ovi1      in                         CABI4803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn2      out                        CAAJ6261.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   2       ext Spl1      in                         CABK5697.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn3      in                        CAAK12132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTNTATTTAATTCTCTGTCTTACAGACTTTCNCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn2 5g3  out                       CAAJ15558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATTCTCTGTCTANCAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCNCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn2      out                       CAAJ14067.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn2      out                       CAAJ17008.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   4      seed Brn2      in                        CAAJ15079.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   2       ext Brn2      in                         CAAJ6408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCNCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   2       ext Thy1      in                        CBST1811.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCTGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn2 PIPE out                       CAAJ12136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAGGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAACAAAACAAACTTGAACCTTTTTGTATACTGCAAGTGAATTTGCGGCAGACCTGCCACTTGAAAGTGTTCCATAACTATGTTTTGATAAGCGGGGGGCAATGGAAGCCATTGTTATATTGTCAAGCTGTCTTTTTACAAATTATATGTGTGTGTAAAACT
  5   1   2       ext Tbd1      in                         CBXT3766.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAACAAAACAAACTTGAACCTTTTTGTATACTGCAAGTGAATTTGCGGCAGACCTGCCACTTGAAAGTGTTCCATAACTATGTTTTGATAAGCGGGGGGCAATGGAAGCCATTGTTATATTGTCAAGCTGTCTTTTTACAAATTATATGTGTGTGTAAAACTAAAAAAAAAAAAAAA
  3   1   2       ext Tbd1      in                         CBXT3766.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATAGGATACATATTATGTTACAGCAAAGTACAGTAAGACTAAAGGGCAGATGTATCAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAACAAAACAAACTTGAACCTTTTTGTATACTGCAAGTGAATTTGCGGCAGACCTGCCACTTGAAAGTGTTCCATAACTATGTTTTGATAAGCGGGGGGCAATGGAAGCCATTGTTATATTGTCAAGCTGTCTTTTTACAAATTATATGTGTGTGTAAAACTAAAAAAAAAAAAAAA
  5   1   2       ext Tad5                                 XZT70049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAACTTGATCTCACCAATAAGAAATCCCAGTTCTGCTTCTTACTAGTGAGTTAATTTCTGAAGATGCCAGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGTATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTCAGTTCATTCTGTTCCATATAGGAGAAAAGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAACAAAACAAACTTGAACCTTTTTGTATACTGCAAGTGAATTTGCGGCAGACCTGCCACTTGAAAGTGTTCCATAACTATGTTTTGATAAGCGGGGGGCAATGGAAGCCATTGTTATATTGTCAAGCTGTCTTTTTACAAATTATATGTGTGTGTNAAACTAANNaaaaaaaaaaaaaaaaaaaaaaaaaaanaaaaaaaaaaaaaaaaaaaaa
  5   1   2       ext Tad5                                 XZT57108.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCGATTCAATTCGTCGACCCACGCGTCCGGCGTACAATGTCTTTACACTGATTTTATTTATCATTTACTTTTATACTGTGGAACGTAATAACTGGCGGTTACATGCAGCCGCCTCCCGCACAGGAGAAAATGTCATTGCCATGTATACCATTCCTGTTCTTCTCAAAGAAGACTTCAACATTTGCATTAAATTTTTATTTTTGCCCTTGATTCCTGGTTTCCATGTGTTCCATTATATGCTATTAAGAATGAACTTTTTATGACTAGTCTAATAAGGCCAAGCAGTCTGTACGTGGTGATTGGTAAGCAGTGTGTAAAGGTGGCCATAAACAGGCAGATATATACTGACAATTCAGGCCCTTCAGACTGATTAAGCAGCTTATCTGGCTGTGTGGGGCCCTCCGATGGGCCGTCCCAACTCATATCTGGCTAAAATCAACCAATGTCGATAAGACAGGTTTGATTTTCCCATTGGATCTAGGACCACATGGACTCGTTGTTGTGGTCCTTGGCCCAAAGGCCTGTAATCCCTAGGGTCAAATTGGCATACTGGGGAAAGATCAAATGAGCAAATCTTGTTTATGGCCAGGTTTAGTGTCTAAATTACTATGTACCTCCAATGAAAATGTGCTCCGTAGAGACTGATGGGGAATATTTTCATTTGGAGGTATTTGGTACATAATTTGGCTAGGCCAACTGGCAAGTTGACACGCAGCTTAAATTTACACCATTTTGGTGATTTTCTTACAAATTTAGAGATCCTTGCCCCCCTGCTGATTATAATAAGATGATTATGTTGTGCACTGAAGCCCTGGGGCCATTACA
  5   1   4      seed Fat1      in                        CABC10952.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGAGGGTACATAATTTGGCTAGGCCAACTGGCAAGTTGACACGCAGCTTAAATTTACACCATTTTGGTGATTTTCTTACAAATTTAGAGATCCTTGCCCCCCTGCTGATTATAATAAGATGATTATGTTGTGCACTGAAGCCCTGGGGCCATTACAGGGGCCACATCCAGCCTGGGGGCCTCCAGTTGGACAGCCTTATTTTAGTGGTATATACAGTTGTGTTCACAATAATAGCAGTGTATTTTATAGAAGTGAATAAAGCTCAAAATCCTTATAATAGCTTTTATTTCCACACACACAAATGCATTCGGAACACTGCACATTCTATTCCAAATCAAAACATAAAGAAAAATGTATCAACTGTGTGTTATTTCTTTAGAGAAAGTGAAGAAAAGGGAATATTAGGCTGGATAAACTGAAAAATGTTTCAAGATTTTGCTTTCCTTTGAATCACTGAAGTAATATTTAGTTGTATAAGCACCAACTTCTGTGAGCAGCTATTCCAGCCCAGGATGATTGGCCTATATTACACAATTCTTCTGCATTTCTTGGTTTTGTCTCAGAAACAGTATTTTTGATGTCACCAGACAAGTTTTCTATTGGATTAAGGTCGGGGCATTGGGCTGGCCACTCCATTACGTCAATCTTGTTGGTATGAAACCAAGAAGTTGTTCGTTTATGGGTGTGTTTGGGGGTCTTTGTCTTGTTGAAACAATACATTTCAAGGGCATTTCCTCTTGCATAAGGCAAACATAACCTCTTCATTTTGGCTCTTCTATCCATT
  5   1   2       ext Brn4      in                        CAAL20424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGCAAGTTGACACGCAGCTTAAATTTACACCATTTTGGTGATTTTCTTACAAATTTAGAGATCCTTGCCCCCCTGCTGATTATAATAAGATGATTATGTTGTGCACTGAAGCCCTGGGGCCATTACAGGGGCCACATCCAGCCTGGGGGCCTCCAGTTGGACAGCCTTATTTTAGTGGTATATACAGTTGTGTTCACAATAATAGCAGTGTATTTTATAGAAGTGAATAAAGCTCAAAATCCTTATAATAGCTTTTATTTCCACACACACAAATGCATTCGGAACACTGCACATTCTATTCCAAATCAAAACATAAAGAAAAATGTATCAACTGTGTGTTATTTCTTTAGAGAAAGTGAAGAAAAGGGAATATTAGGCTGGATAAACTGAAAAATGTTTCAAGATTTTGCTTTCCTTTGAATCACTGAAGTAATATTTAGTTGTATAAGCACCAACTTCTGTGAGCAGCTATTCCAGCCCAGGATGATTGGCCTATATTACACAATTCTTCTGCATTTCTTGGTTTTGTCTCAGAAACAGTATTTTTGATGTCACCAGACAAGTTTTCTATTGGATTAAGGTCGGGGCATTGGGCTGGCCACTCCATTACGTCAATCTTGTTGGTATGAAACCAAGAAGTTGTTCGTTTATGGGTGTGTTTGGGGGTCTTTGTCTTGTTGAAACAATACATTTCAAGGGCATTTCCTCTTGCATAAGGCAAACATAACCTCTTCATTTTGGCTCTTCTATCCATTCGAATGG
  3   1   4      seed Fat1      in                        CABC10952.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTTTTTGGTTTTTTTTTTTTTTACATATTTAAAATTGGCGTTTTATTGAATTTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTANCAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAA
  3   1   2       ext Brn4      in                        CAAL20424.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  5   1   2  SIG                                      Xt7.1-CAAM4222.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACGTCGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGTGATGTTATTGCTAAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTATCTATCGATTTCTATCGATGTAGCTGAGCATTAGTATATATTTTTTGCAGTAAATGTCATTTGTTTTATTTTTTAAGGGACAAAACAAGGGCAAAAATAATAGAAAATATATATAAAGTGATTTTTTTTTTTTTTTTTTTACATATTTAAAATTGGCGTTTTATTGAATTTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAAAAAAACCAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008288498                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGTGATGTTATTGCTAAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTATCTATCGATTTCTATCGATGTAGCTGAGCATTAGTATATATTTTTTGCAGTAAATGTCATTTGTTTTATTTTTTAAGGGACAAAACAAGGGCAAAAATAATAGAAAATATATATAAAGTGATTTTTTTTTTTTTTTTTTTACATATTTAAAATTGGCGTTTTATTGAATTTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAAAAAAACCAAAAAA
  5   1   4      seed Spl2      in                        CBSS9495.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACGTCGTACTGCTATTGTTCTGAACACAACTGTATGTCTGTGGTGATGTTATTGCTAAATATAAAGAGCTATAGATGTAAAGCAGAGGGAATCCTGGGTAGGGACAGTCAGTATCTATCGATTTCTATCGATGTAGCTGAGCATTAGTATATATTTTTTGCAGTAAATGTCATTTGTTTTATTTTTTAAGGGACAAAACAAGGGCAAAAATAATAGAAAATATATATAAAGTGATTTTTTTTTTTTTTTTTTTACATATTTAAAATTGGCGTTTTATTGAATTTTGTTCATGCTATGTCTTATACCCCGTGCGGTTTTATTTAATTCTCTGTCTTACAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTC
  3   1   2       ext Te3       out                        CAAM4222.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGCGGTTTTATTTAATTCTCGGTCTACCAGACTTTCCCACTGTTCACTATAGTACTGGCAGACATCCCAACCCAGTCCATATGTAATACTCTGGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCNCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn2      out                       CAAJ19164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Te3       out                        CAAM3757.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGTTCACTATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Te3       out                       CAAM14231.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATAGTACTGGCAGACATCACAACCCAGTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   3        nb Brn3      out                       CAAK11540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTCCATATGTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  3   1   4      seed Spl2      in                        CBSS9495.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTAATACTCTTGCTTCTGCCACAACCTATTCCTGTGCTGTTGCGGATGCCCCTGTTGTGTTTACTGTAACCCTCTGATAGGCTGAAATTCTGATGATGGATCAGTCACTAACTGCATAAAATATACTGTAACTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAAT
  5   1   2       ext Sto1                                 CABG6269.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGAAAGTCCATAAGGCATTCTAATATAAAGGAAGTTTTAATGCTGAAAATGACCTTGCACTTATATGAATGGCATATTATACCATGTGACCAATAGGATACATATTATGTTACAGCAAAGTACAGTATAGACTAAAGGGCAGATGTATCAAAAAAAAGTTTTTTTTTTACTTGATCTCACCAGTAAGAAATCCCAGTTGTGCTTCTTACTTTTGAGTTAATTTCTGAAGATGCCCGAGAACATTCCCATTGCACAAGGTTCCCATAGATGCCTATGGTGTTAACACAAGAGGAGTGACAGATATAATCCATTGCAAGCCCAAGCTGGTGTACCTAGTGGTTTGCATGGACCCCTGAGCTCCTGAAATGTTTCGGCAACAAAATGCTGGTTATGGGAAATTTCAACCATTGCTAAATCTTCCCTTGAGTGTATTAGGCACAAACATCTTCAGCCTCTGCCTGTTCAGTTGGCCTGTTACTTCCCTTCCCACCATCTGTTGCAGGTGAATGTGCAGCAGTGGCCGGAGATCTACGTTCATTCCGTTCCATATAGGAGAAACGTCAGTTTGAGCATTACTGTTCCTTTAAAATGTAACTTGTTTACATATTAATAAAAAAAAAAAAAAACCAAAAAAAAAAAAAAAAA

In case of problems mail me! (