Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABG7267.3                           95 END     1           1        1                nmd3 homolog (s. cerevisiae) [Xenopus tropicalis]
     2   2.0    0Xt7.1-TGas097m24.3                         74 END     1           1        1                (no blast hit)
     3   2.0    0Xt7.1-XZT70789.5                           24 END     1           1        4                Prc1-prov protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012154182 Xt7.1-TEgg038g12.3.5 - 51 ESTs
                                                                       ......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg038g12.3.5                                                                                       CCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGGCCAATTTGAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGCGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTT
                                                  Xt7.1-CHK-1008265048                                                                                             GCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGGCCAxTTxxAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAA
                                                      consensus depths                                                                                            2     7     2     7     2     7     2     7     2     7     2     7     2     7     2     7     7     9     8     9     9     9    10    10    10    10    10    10    10    10     8     8     9     9    10    10     8     9     9    10     9     9     9     9     9     9     8     8     7     8     8     9     8     9     8     9     7     8     8     9     7     7     3     4     3     4     4     5     4     5     3     4     4     5     3     4     4     4     3     3     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     3     3     3     3     3     2     2     2     2     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     5     6     6     7     7     7     7     7     7     7     7     7     7     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     6     6     6     6     5     5     4     6     4     6     4     6     4     6     4     6     4     6     3     6     3     6     4     7     4     7     5     7     6     8     6     8     7     8     8     9     8     9     8     9     8     9     8     9     7     8     7     7     7     7     7     7     7     8     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     6     6     6     6     7     7     6     6     6     6     6     6     6     6     7     7     7     7     8     8     9     9     9     9     8     8     9     9     8     9     9    10     8     9     8     9    11    11    11    11    11    11    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    15    15    16    16    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    17    19    18    19    18    18    18    18    18    18    17    18    17    18    18    18    17    18    18    18    18    18    18    18    18    18    18    18    17    18    18    18    18    18    18    18    18    18    18    19    17    19    19    20    19    20    18    19    18    19    18    19    19    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    18    20    16    20    13    20    11    20    10    20
  5   1   2      ests                               Xt7.1-TEgg089j20.5                                                                                       CCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGGCCAATTTGAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGCGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCG
  5   1   2      ests                               Xt7.1-TEgg038g12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----------G-
                                               BLH ATG     611    1255                                                                                       
                                               BLH MIN     608     252                                                                                       
                                               BLH MPR     383     252                                                                                       
                                               BLH OVR     611     613                                                                                       
                                               CDS MIN     611     252                                                                                       
                                               ORF LNG     611     174                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Xl ---- 2e-012     AAH73496.1 MGC81025 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 8e-018     BAB00632.1 Not6 [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 8e-140     NP_001021640.2 SQuashed Vulva family member (sqv-5) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 3e-169     NP_996440.2 CG9220-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 0          XP_784554.2 PREDICTED: similar to chondroitin synthase [Strongylocentrotus purpuratus] -----------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 0          NP_997843.1 carbohydrate (chondroitin) synthase 1; wu:fc27h05 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Gg ==== 0          XP_413889.2 PREDICTED: similar to Carbohydrate (chondroitin) synthase 1 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Mm ---- 0          XP_912569.2 PREDICTED: similar to Chondroitin sulfate synthase 1 (Glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase) (Chondroitin sulfate synthase 1) (N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase) (Chondroi [Mus musculus]  ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 0          NP_055733.2 carbohydrate (chondroitin) synthase 1; chondroitin synthase [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 0          AAI27294.1 Unknown (protein for MGC:145548) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 0          NP_001090724.1 hypothetical protein LOC100036707 [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg038g12.3.5                                                                                                                                                           TGA------------TAA---------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------TAG---------------------------------------------------------------TGA---------------------TAG------------------------------------------------------TAGATG---------------------------------------------TGA------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------ATG------ATG---ATG------------------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------TAATAA---------------------------------------TAA---------------------TAATAG---------TAG---------------ATG------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Te4  FL                          CAAN3575.FL-MGC                                                                                                                                                                                        GGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                               Xt7.1-TEgg089j20.5                                                                                       CCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGGCCAATTTGAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGCGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCG
                                                  Xt7.1-CHK-1008237615                                                                                             GCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGGCCAxTTxxAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGCGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCGAGCTGC
  5   1   2       bld Neu       in                   TNeu132m20.p1cSP6 AGAGACCGGGCCGGGCGGCAGCCGTGGGGCTTGGAGCCGCAGACTCATTGGGAGAAAGAAAAGGAAACGCTGGAGGGACGGGGAAGTGCCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCATATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGCCAATTTCAGGAGGGGGGGGCTGAAACGGGGAGAAACGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCCGCGGCAAAACCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATTGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGAGG
  5   1   2       bld Te4       in                         CAAN5151.5p   CCGGGCCGGGCGGCAGCCGTGGGGCTTGGAGCCGCAACTCATTGGGAGAAAGAAAAGGAAACGCTGGAGGGACGGGGAAGTGCCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGGCCAGATTTGCAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGGGGCAGCTGATACAGCCGGNCAGGGAGCA
  5   1   2       bld Neu       in                   TNeu124h15.p1cSP6      CGGGCCGGGCGGCAGCCGTGGGGCTTGGAGCCGCAACTCATTGGGAGAAAGAAAAGGAAACGCTGGAGGGACGGGGAAGTGCCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGGCCAATTTGCAGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGAGGCTGCA
  5   1   2       bld Egg                            TEgg084n16.p1kSP6           CCGGGCGGCAGCCGTGGGGCTTGGAGCCGCAACTCATTGGGAGAAAGAAAAGGAAACGCTGGAGGGACGGGGAAGTGCCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGCCAATTTGCAGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGGAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGTTAGGGTTCGCACGGTGCTGCTATTGTGCGGG
  5   1   1       add Egg                            TEgg094o20.p1kSP6                 CCGGGCGGCATCCGTGGGGCTTGGAGCCGCAACTCATTGGGAGAAAGAAAAGGAAACGCTGGAGGGACGGGGAAGTGCCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTTGCATTTGCGGAGTGGGGGTTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCG
  5   1   2       add Egg       in                   TEgg038g12.p1kSP6                                                              AAACGCTGGAGGGACGGGGAAGTGCCGGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGTGTGGGGTGAGAGGAGGGGGTGTAAGGCCAATTTGCAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAACACTCACACCCGGGCGGGGCGGCGGCCTCTCATGTGCTGCTACGGCTCGCACCGTGCTGCTATTGTG
  5   1   2       bld Egg                            TEgg082j21.p1kSP6                                                                                 TAATTCGCCGGGGCCGAGCCGTGACACGGAGACCCCTCACCAGGCCCAAGCTCAGATGGGAAAGGGGGTTGGGGTGAGAGGAGGGGGTGTAAGCCAATTTGCAGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGC
  5   1   2      seed Egg  5g                        TEgg089j20.p1kSP6                                                                                                                                                                                       AGGAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTACTGCTATTGTGCGGGGGGGCGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCGAGCTGC
  5   1   2       bld Egg  5g                        TEgg083c12.p1kSP6                                                                                                                                                                                                                                                                                             CGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGCGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGG
  5   1   2      ests                               Xt7.1-TEgg038g12.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTC
                                                  Xt7.1-CHK-1008226570                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGxCxTTxCTAAAG
  5   1   0       add Neu       in                   TNeu081h12.p1cSP6                                                                                                                                                                               AGATTTGCAGGAGTGAGGGGCTGATAGCGGGGAGAAGCGAGGTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGATCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACATCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTGTATGGGCTGAGATATACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTATGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGAGGCTGCAAGGTATCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAAGGTATCGGGCCCCGGTAGATGCTGAGATGGCTCGGAGGCTGCATGGTATCGGGCCCCGGTAGATGCT
  5   1   2       bld Te4  FL                              CAAN3575.5p                                                                                                                                                                                         GAGTGAGGGGCTGAGAGCGGGGAGAAGCGAGTTGGGCTGCCGGGCTGGAGTTATGTGGGGGCTGCACGCTGTGAGGGGGGCCGGCGGCAGAGCCTGAGTGCGGACTATGTGCCGGGGCAGCTGATACAGCCGGCAGGGAGCACACAATGCCGCTACTCGTGTAGGGACTTCCATGGGCACTGACTCTATGGGCTGAGAGAGACTGACACCCGGACACAGCGGCGGCCTCTCATGTGCTGCTAGGGCTCGCACGGTGCTGCTATTGTGCGGGGGGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCAGGGTAGCGGGCCCCGGTAGATGCTGAGAGGGCTCGGAGGCTGCTTTGGATGCTGATTTCAGCCTGACACAGTCGCAGCAGGAGATCGCACCCCGAGGGATGGCTGCCAGAAGTCGCCACTCGTTGCTCAGTGTCCTGCTGGGGCTGGTCCTGGGCTTCCTCCTCGCCTCCAGGTTTATCTTGCCCAGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGNGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTC
  5   1   2       bld Egg                            TEgg129j21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGGCTTGCCCAGAGCGGCCGAGCTGCAGAGAGCCAGCCGTAGGAGAGCGGGCGGTGGGGGGGTATCAGGGGGGCAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCGATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAG
  5   1   2       bld Egg                            TEgg116h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGCTGGGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACC
  5   1   2       bld Egg                            TEgg096i12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGCTGTGGCCGACAATCTGCCTTAAGGAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCGATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTC
  5   1   2       bld Egg                            TEgg113d19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACGATTACAGCGGGGTGCTGGGCTGGCAACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCGATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCC
  5   1   2       bld Gas1                               IMAGE:6988527                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGCACAGCGGCTACACACGGACACCGGGGCTCTGAGCCCGGCCAGCGAGGAAGACATCCCCACGGACAAGAACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCGATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAATAACAAG
  5   1   2       bld HdA                            THdA019m14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACTTCCTTTTTGTTGGGGTCATGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAGTTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCC
  5   1   2       bld Tad5      in                         XZT56353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCACGCGTCCGGACAGCTCAGAAGTACCTGGAAACCAGAGCAGTGGCCGCTTATGGGACTTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAGTTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAA
  3   1   2       bld Neu       in                    TNeu103k02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGGGCAAACTCCATTCNCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGTTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGATTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGGTAAATTCTGTTTAGCTTGTCAAACTTTGATTGAAAAGCCTGGCTTCTTAAAGAAATTGTGCATCTAGCATTTGAATATACTTTCTGGCCTAGAAGCATGATCCCTACACACATGCCATAGTAATATTTTTTTTACAGGTCAGCGGTTGAGTGCTCTGTGAGAAATTAGTGTTATTTGGCAAATGCGTATGTGCTCCTGACATTTTTCTGACTGCCAAAGCTTAGGGTAAAAAAAAATACAACAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu103k02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGGGCAAACTCCATTCCTGGTAAAGTTGAATTTTTCTCCAGTGAAGGCTCAGATACATCTATACCAATTCCAATTGTGCCACTGCAAGGTGTGGATGACTCCTATCCACCACAGAAGAAGTCCTTCATGATGCTCAAGTACATGCATGATCACTACTTGGATCAATATGAGTGGTTTATGCGAGCAGATGATGATGTTTACATCAAAGGGGATCGCTTGGAGAACTTTTTGAGGAGCCTCAACAGCAGCGAACCACTGTTCCTTGGCCAGACTGGCCTTGGCACCACAGAGGAAATGGGCAAATTGGCACTGGAGCCCGGAGAGAATTTCTGTATGGGTGGCCCTGGTGTGATCATGAGCAGAGAAGTCCTTCGTAGGGTGGTGCCCCACATTGGCGAGTGTCTAAGGCAGATGTTTACCACCCATGAGGATGTGGAGATTGGCAGATGTGTCAGAAGATTTGCCGGAGTGCAGTGTGTCTGGTCCTATGAGGTAAATTCTGTTTAGCTTGTCAAACTTTGATTGAAAAGCCTGGCTTCTTAAAGAAATTGTGCATCTAGCATTTGAATATACTTTCTGGCCTAGAAGCATGATCCCTACACACATGCCATAG
  5   1   2       bld TpA       in                   TTpA059h22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGAGATGCAGCAGTTGTTCTATGAGAATTATGAACAGAACAAGAAGGGCTACATCCGAGATCTTCATAACAGCAAAATTCACAGAGCCATCACTTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGNGCGATTNGATATGTTTGCCAGGTTTAT
  5   1   2       bld Egg       in                   TEgg035f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTACATCCCAATAAAAACCCTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTG
  5   1   2       bld Gas7      in                         XZG50034.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCCCTACCAGTACCGCTTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCA
  5   1   2       bld Egg                            TEgg114o03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTGCACAGCTACATGCTGAGTCGCAAAATAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAA
  5   1   2       bld Gas0                                 dad25b06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGCAAAAAGCAGAGCTCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGA
  5   1   2       bld Egg                            TEgg090m06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCGGTATCGTACGATCCAGCTGCACCGGGAGATTGTTCTTATGAGCAAGTACAGTAATGCAGAAATCCATAAAGATGATATGCAACTGGGGATTGCTCCATCTTTCATGCGGTTCCAACCACGCCAAAGAGAGGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTG
  5   1   2       bld Neu                            TNeu009l08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    NAATCCCCGGGCCCCGGGACGCCAAAGAGAGAGATTCTGGAGTGGGAATTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATC
  5   1   2       bld Egg       in                   TEgg062o20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCTCACTGGCAAGTATCTGTATTCAACTGCTGATGGACAACCTCCTAGACGAGGAATGGATTCTTCCCAAAAGGAGGCTCTTGATGACATTGTAATGCAAGTTATGGAGATGATAAATGCCAATGCCAAGGTTCGAGGTCGTATTATTGACTTTAAAGAAATCCAGTACGGATACCGTAGAGTTAATCCAATGTATGGTGCAGAATATGTCTTGGATCTGCTTCTTCTCTACAAAAAGCACAAGGGTAAGAAAATGACTGTTCCTGTCAGGAGACATGCCTACCTCCAACAGACATTCAGCAAAATTCAGTTCATGGAACATGAGGAGATTGATGCTAAAGCGCTGGCGAATAAAATAAATCAGGAATCTGGTTCCTTCTACTTTTTGTCAAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCATCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACC
  5   1   2       bld Neu       in                   TNeu088h14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATTCTCTTAAGATGTTTGTTCCCTTTCATCTCACTGCAGCGAAGACTGAACATAAAGAGCCCAAAGAAACCAAGGTGAACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAAAGACTGGATTTTGGAGAAACTAT
  3   1   2       bld Egg       in                    TEgg038g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACATCCTGGTTCCCCTCTCTGGCCGATTTGATATGTTTGCCAGGTTTATGGCCAACTTTGAGAAAACTTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       ?                     TGas115g06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGTTTATGGCCAACTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Tad5      in                         XZT56353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTGAGAAAACCTGCCTCATCCCAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCT
  3   1   2       bld Neu       in                    TNeu124h15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATCAAAATGTGAAGTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu132m20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTAGTCATTCTACTTTTCAATTCTGACTCCAATCCTGACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATACATGCCTTTCTAAAGAAAAAAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg062o20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAAAACCAGGCAAGTTGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGACAGGAGCTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Egg                             TEgg023l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGCAAGTTGAACTCTTGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATTGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTAGGATCGAGATTCCCCGG
  5   1   2       bld HdA                           THdA016m03.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAACTCATGAGAGATTACCGTGTTAAATATCCCAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGGTAGTGGTCTGATANGAAATCATGCCNTTTCTAAAGAAAAAAAAAACAAAAAAAAAAACATGTGATTCAGTATTTTGCCTTTCAGCCGTTGCAATATG
  3   1   2       bld Neu       in                    TNeu081h12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAANGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu088h14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAAGCAGATATGCAGATCTTACCAGTGTCTGGAGAGTTCTCCAGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCANAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg035f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCANAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA059h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGCTTTGGCTTTAGAAGTTGGATCCTCGCAGTTTCGAAATGACTCTCTGCTCTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGANCTGTAGTGTTTGATAGAAATCATGCCTTTCTAAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5x3  out                  TEgg058p13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCTTTTGTGATGTGGATTTAGTTTTCTCCACTGAGTTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAC
  3   1   2       chi TbA       out                   TTbA005d24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTATACAACGATGCAGGGCAAACACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAAACCCCCCCCCTTCCTGAAGCTTATTGGAGGGGGCTGAAAAGTTCTGACAGCAGGAGGGTTGTCATTTGAGCTTTATTATAATTTGTGCCGAGCATTCTTACAGGGCAAGAATTGTGGTCGTTGTACATTCAGCTATGTGTCAAACCAGGATCCCTATTAGCAGACCCCCTATCTATTATGTAACTTTTGTCAGAAAGTCTCCTCCTAGGGGGTAGAATAATTTCAATAAAAATCCTTGTACATTCAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG18836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCACGCGTCCGCACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAG
  5   1   2       bld Gas7      in                         XZG18836.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACCATTTTAGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Te4       in                         CAAN5151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGGGCAGCAAATATACTTTCCAATTATATTTAGCCAATATGACCCCAAGATTGTTTATGCTGGAAAAGTCCCCAGTGATAACCATTATGCTTTTACTCAGAAGACTGGATTTTGGAGAAACTATGGCTTTGGCATCACCTGTGTTTATAAGGGAGATCTTTTACGTGCTGGTGGCTTTGATGTTTCCATTCAAGGATGGGGACTAGAGGATGTTGACCTTTTCAACAAAGTGGTACAAGTAGGTTTAAAGACCTTTAGGAGTCAGGAGGTTGGAGTCGTTCACATCCACCATCCGGTGTTCTGTGACCCAAATCTCGATCCTAAACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCT
  3   1   2       bld Gas7      in                         XZG50034.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCAATTTTTTTTGGCCAATAGGCCCCCAAGTTTGTTTTTGCGGGAAAAGTCCCCGGGGATAACCTTTTTGTTTTTTCTCGGAGGGCGGGTTTTGGGGGAAACTAGGGTTTGGGCATCCCCGGGGTTTATAAGGGGGATTTTTTCCGGGGGGGGGGCTTGGGGGTTTCCCTTCAGGGGGGGGGGCTGGGGGGTGTTGCCCTTTTCACCAAAGGGGTCCAAGTGGGTTTAAAGCCCTTTGGGGGTCGGGGGGTGGGGGTGGTTCCCATCCCCCCTCCGGGGTTTTGGGGCCCAAATTTGGTTCCTAAACAGTACAAAAGGGGTTGGGGTTCCAAAGCCTCTCCATAGGGGTCAACTCAGCC
  3   1   2       bld Gas                             TGas064c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGTACAAAATGTGTTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTANNGTGTTTGATAGAAATCANTGCCTTTCTAAAGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu124e09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       in                   TNeu124e09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGGTTCCAAAGCCTCTACATATGGGTCAACTCAGCGCCTGGCTGAGTTATGGCTTGAGAAGAATGACCCAATGTTTGGCAGAACCACTCACACAAATGAATCTGTGAGGACAGCCTAATAATCCAGCACTGCTGGGGGACCTTTGAACTGTTTCATAATCTAATTTATTTTTTCAAAATTATTTTAATAGTCAAGACTGTAGTGTTTGATAGAAATCATGCCTTTCTAAAG
  3   1   2       bld Egg       out                   TEgg021p14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGTCCCAATGTCTGGCAGAGCCATTCACTCAAATGAATGGGGGAGGACAGCCTAATAATCCAGCAGTGTTGGGGGGCCTGTGAAGTGTTTCATAATATAATATATTTGTTCACAAATTATTTTAATAGTCAAGACAGTAGTGTTTGATAGAAATCACGCCTTCTAAGAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)