Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas097m24.3                         74 END     1           2        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 419.0    0Xt7.1-CAAJ23345.5                           2 PI      76       1724     2462                like-glycosyltransferase [Gallus gallus]

 This cluster: approximate FL confidence score = 99%

 1012154186 Xt7.1-TNeu113i15.3.5 - 46 ESTs
                                                                       .........-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TNeu113i15.3.5                                                                                          CGAGATCATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCGCAACGTGGCCCTGAAGAACTCGCAGACCCCTTACGTCTTCCTGTCGGATATTGATTTCCTGCCCATGTACGGACTCTATGAATACTTACGGAAATCCATATCCCAGCAGGACCTGACCGGCCCCCCCAAGGCTCTTATCGTTCCCGCCTTTGAGACTCTCCGTTACCGGCTTTCTTTCCCCAAGTCCAAGACAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008266411                                                                                                CATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCGCAACGTGGCCCTGAAGAACTCGCAGACCCCTTACGTCTTCCTGTCGGATATTGATTTCCTGCCCATGTACGGACTCTATGAATACTTACGGAAATCCATATCCCAGCAGGACCTGACCGGCCCCCCCAAGGCTCTTATCGTTCCCGCCTTTGAGACTCTCCGTTACCGGCTTTCTTTCCCCAAGTCCAAGGCAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGAAAAAAAAA
                                                      consensus depths                                                                                               3     3     4     4     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9     9     9     9    10    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    10    12    10    12    10    12     9    11     9    11     9    11     8    11     8    11     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     3     4     4     4     4     4     5     5     5     5     5     5     5     6     5     6     5     6     6     6     6     6     7     7     7     7     7     7     7     7     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     6     6     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     5     4     4     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     1     3     3     5     3     6     5     8     6     8     7     8     7    10     9    13    10    13    11    14    12    15    12    15    13    15    14    16    14    16    15    17    15    17    15    17    16    18    16    18    16    18    17    19    18    20    19    20    19    20    19    20    19    20    18    19    16    19    19    20    21    22    21    22    21    22    22    22    23    23    22    23    21    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    23    24    23    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    22    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    22    23    22    22    22    22    19    21    17    18    18    18    16    16     9     9     3     6     3     3
  5   1   2      ests                                Xt7.1-CAAK10831.5                                                                                          CGAGATCATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCG
  5   1   2      ests                               Xt7.1-TNeu113i15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTTTCCCCAAGTCCAAGACAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------T-----
                                               BLH ATG     403    2328                                                                                          
                                               BLH MIN     403     260                                                                                          
                                               BLH MPR     403     260                                                                                          
                                               BLH OVR     403     856                                                                                          
                                               CDS MIN     403     260                                                                                          
                                               ORF LNG     403     191                                                                                          
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 2e-018     NP_611886.1 CG3253-PA [Drosophila melanogaster] --------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 4e-096     NP_509833.2 LARGE (mouse dystroglycan glycosylation) homolog family member (lge-1) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Sp ---- 0          XP_781563.2 PREDICTED: similar to mKIAA0609 protein [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ==== 0          NP_034817.1 like-glycosyltransferase; myodystrophy [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ==== 0          NP_004728.1 like-glycosyltransferase; acetylglucosaminyltransferase-like protein [Homosapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dr ==== 0          NP_001004538.1 glycosyltransferase-like 1B [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Gg ==== 0          NP_001004404.1 acetylglucosaminyltransferase-like protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xl ==== 0          AAH60410.1 Unknown (protein for MGC:68636) [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 0          NP_001083457.1 hypothetical protein LOC398936 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          AAI36205.1 Unknown (protein for MGC:122763) [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TNeu113i15.3.5                                                                                                                                                                                                 ATG---------------------ATG------TAG---------------------------------------------------------------------------TGA---------------------------------------------ATG------TAG---------------------------------------TAA------TAG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------TAATAG---------------------------------------------ATG---------------------------------------------------TGA---------------------------------------------------------------------TAA------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Brn3 FL                         CAAK10831.FL-MGC                                                                                                             GTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAAATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATATTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCGCAACGTGGCCCTGAAGAACTCACAGACCCCTTACGTCTTCCTGTCGGATATTGATTTCCTGCCCATGTACGGACTCTATGAATACCTACGGAAATCCATATCCCAGCAGGACCTGACCGGCCCCCCCAAGGCTCTTATCGTTCCCGCCTTTGAGACTCTCCGTTACCGGCTTTCTTTCCCCAAGTCCAAGGCAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAATGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGTTAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                Xt7.1-CAAK10831.5                                                                                          CGAGATCATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCG
                                                  Xt7.1-CHK-1008230168                                                                                                CATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCGCAACGT
  5   1   2       bld Egg  5g3  in                   TEgg015b20.p1kSP6 CCTTCCCTAGGCTATCACGTGATGCGCTGATGTCACAGGCGGCTTGGCTAGGGCCCTACCAGGGCTGAGAAGGAAACACAATCGATTGTCGAGATCATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGT
  5   1   2       bld Tbd0 5g3  in                       IMAGE:6976587                                                                                          CGAGATCATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAATGTGAACTGATCCACGTGGGCATAGTCTGCGCCCGCCATAACAGCAGCCCCAAATGTGGTGACCCCTGGTGAAGTCCATTCCGGTTCCCAGGGAGAAACCCTTTCATCTGGCCCTGGATTACGGAAGCCCGGGGCTCTGCGCCTGTC
  5   1   2   14  bld Te4  5g3  in                          CAAN442.5p .........................................................................................CGAGATCATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGC
  5   1   2       bld HdA  5g3  in                   THdA051g13.p1kSP6                                                                                            AGATCATCGAAGACAGTGTGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACANGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGC
  5   1   2      seed Brn3 FL   in                        CAAK10831.5p                                                                                                              TGGGATTTAACCAGTGTTATGGTGGAACCAGTGCCCCAGGCAGGGGGATACAGGAGCCGATCCTCCGGCTGGCTGGAGTCAAAATGTGGGGCTGCCTGGTGCCTCTGATGCCGGAATAGAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGG
  5   1   2   24  bld Te4  5g                              CAAN2730.5p ...............................................................................................................................................AACTGCGGCTAAAGCAGGATTTCCGCCCTGCCTGAATGTCAGAGTTTGCGGTGCTTTGTAGTGCAGAGGTTGGTGGGTGTGGGAAAGTGAGTTTGGAGCATTAACCAGCACTAAACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACA
  5   1   2       bld Gas8 5g3  in                         st104a18.5p                                                                                                                                                                                                                                                                 AACCCTCCCCCAGCAATCTGGAGACTGCCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTG
  5   1   2       bld Gas8      in                          st64i24.5p                                                                                                                                                                                                                                                                                            CCCGAGAGACTGCCCGGGTCTGAAGTTACCTGCAACCGCTGGATGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGAC
  5   1   2       bld Egg  5g3  in                   TEgg068d14.p1kSP6                                                                                                                                                                                                                                                                                                                                       TGTGCCCTATATAAACCGCCGCTGGATGGAAACTTAGCAGACACTTCGCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCA
  5   1   2       bld Gas8 5g3  in                           st7i24.5p                                                                                                                                                                                                                                                                                                                                                                              ATTATACAGCACGGGCCTCATTCACCTCTGTGTGTTTTGCAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGC
  5   1   2       bld Neu  5g                        TNeu061o04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                      GCCTGCTTCTGGGCATTGTGGTGCCACTTTAAAGCTTATAGGATGTTGCCGGCAGTAATACCAGACTTTCCCACTTGACGGCCCCCCAACGACGCAGTCCAGGACAGTGTGGACCCATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGA
  5   1   2       bld Neu  5g3  in                   TNeu073p19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCATGCACCTCTCCTGTCGCAGCAAAGCCAAGTTCCTGGCCCTCGCTTTACTGCTGCTGTCTGCTGCAACCTGGTTGTACCTGTCTGTGGGGGAGACAGAATATGGTCCATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGA
  5   1   2       bld Gas8      in                          st71j19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCCCTGGGGCCGGTAGCCCCTCATTTTTCGGCCACACCGTCCCTCCAGTTAGAGCTGGAGAGCCGCCTGCGGGTAGCTGAGGAGGAGAATCGGAGACTGCGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTT
  5   1   2       bld Egg                            TEgg133p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCAGCAACTGGGCGAGATGAGGAATGAGGAGCAAAGCACCGGAGTAGGGACGGAAGGGGACAACAGCAGCCATTGTGAGCACAGGAGCCTGACTGAGAAGTGTGAACTGATCCACGTGGCCATAGTCTGCGCCGGCCATAACAGCAGCCGAGATGTGGTGACCCTGGTGAAGTCCATTCTGTTCCACAGGAGAAACCCCTTACATCTGCACCTGATCACGGACGCCGTGGCTCTGCGCGTGCTGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAAATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATATTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTC
  5   1   2       bld In62                            IMAGE:8955778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTTTTTGGAGGTTTTTTATTAAAATTAATCTCCGGGGAACCTGTTCAAGACCTGGATGGTGCCGTCCCTACAGATCAGCTTCTATAACGCAAGTGAGCTGAAGCCGGACGTTGCGTGGATCCCAAACAAACATTACTCGGGGATATATGGGTTACTGAAGCTCACACTGACCAAGGCGCTGCCCTCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTTCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAGACCCATGCTATGATTTCCGGAGGAGAGCCTTGCATCCCACCGCGTTCACTGTCTCTGCCGCACGTACCCGCCTCGACCTATGATGTCACGCTGGTGCCAGCTCTCTATGGACGCTGCAATGTCTGGAACTTGATCTTGGTCGGCACATTGAAA
  5   1   2       bld In66                            IMAGE:8966713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTTTTTATATTATTTATTAATAAAAAAATAAAACTCCCCCGACCTCTCCAAGGTCATCGTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATATTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCATGAGCCTGGCCTGTACTGTCGACGCGAGCGCAGCAGTTCTACGCTATGCCAGGCTTCGAGTGCTGCAGTCTCGCACAACGTCGCTACTGGGTCATAGAGGGCAGCTTTACCGGTCACTTCTGGCCACGGTGCCTTGAAGACCTCACAGAACCCTACAGTCT
  5   1   2       bld Tbd0      in                       IMAGE:6977481                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCCTGGACACGGACATCACGTTTGCCACCGACATTGCCGAGCTCTGGGCAATCTTTAAGAAGTTCACAGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTTCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACNGGGAGCCCCTTCCTTGNCCGCCCCCCCNCN
  5   1   2       bld Gas8      in                          st31k14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCTGGGCAATATTTAAGAAGTTCACAGGGTGAGCAAGTTCTGGGTCTGGTGGAGAATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGNCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCANGGGGGCAGCCCANGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGA
  5   1   2       bld Te5       in                        CAAO12979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAGAGTGACTGGTACCTGGGGAACCTGTGGAAGAACCACAAGCCGTGGCCTGCCTTGGGCCGAGGATTCAACACAGGGGTCATTCTGCTGCTGTTGGACAAGCTGCGCCTGATTGGCTGGGAGGAGATGTGGCGACTGACAGCGGAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCGNCACGTGGCCCTGA
  5   1   2       bld Tad5      in                         XZT16756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAGGGAGTTGATGAATATGCTGAGCACCTCGCTGGCTGACCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTGCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGATCCGTGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCGCAACGTGGCCCTGAAGAACTCACAGACCCCTTACGTCTTCCTGTCGGATATTGATTTCCTGCCCATGTACGGACTCTATGAATACCTACGGAAATCCATATCCCAGCAGGACCTGACCGGCCCCCCCCAGGCTCTTATCGTTCCCCGCCTTGAGACTCTCCGTTA
  5   1   2       bld Neu       out                  TNeu113g13.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCCTCTCGCAGGATATATTCAATGCTGTTATCAAGAGTTCCCCTACTCTAGTCTATCAGCTTCCCTGTTACTGGAACGTGCAGCTCTCCGACCACACGCGCTCCGAGCAGTGTTACAGCGAGCTGGCCGACCTCAAGGTCATTCACTGGAACTCCCCCCACAAGCTGCGAGTCAAGAACAAGCACGTTGAACTATTCCGCACCCTGTACCTGACTTTCCTAGAGTACGACGGGAGCCTCCTGCGCCGAGAGCTGATTGGCTGTCCGAGTGAAGGGGAACAGCAGGGGGGCAGCCAGGCTGCTCTGTCGCAATTGGACGAGGAAGACCCATGCTATGATTTCCGGAGGGAGAGCCTTGCATCCCACCGCGTCCACCTGTCCTTCCTGCCGCACGTAACCCCGCCCCCGGACCCCTATGATGTCACGCTGGTGGCACAGCTCTCTATGGACAGGCTGCAAATGCTGGAGCTGATCTGCCGGCACTGGGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTA
  5   1   2      ests                               Xt7.1-TNeu113i15.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTTTCCCCAAGTCCAAGACAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGAAAAAAA
                                                  Xt7.1-CHK-1008229242                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCAAGTCCAAGGCAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGTAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu023i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGACGGCCCAATGAGCCTGGCCCTGTACCTGTCGGACGCGGAGGCGCAGCAGTTCCTACGCTATGCCCAGGCCTCCGAGGTGCTGCAGTCTCGCACCAACGTCGCCTACCATGTGGTCTATAAGGAGGGGCAGCTGTACCCCGTCAACCTCCTGCGCAACGTGGCCCTGAAGAACTCGCAGACCCCTTACGTCTTCCTGTCGGATATTGATTTCCTGCCCATGTACGGACTCTATGAATACTTACGGAAATCCATATCCCAGCAGGACCTGACCGGCCCCCCCAAGGCTCTTATCGTTCCCGCCTTTGAGACTCTCCGTTACCGGCTTTCTTTCCCCAAGTCCAAGACAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCC
  3   1   2       bld Tbd0      in                       IMAGE:6977481                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCCCCCCCCAAGGGGCTTTTTATTGGTTTTCCCGGCTTTTGAAGAACTTTCCGTTTACCCGGGCTTTCTTTTCCCCCAAGTTCCAGGACAGAGCTACTTTTCCTTGCTGGATACGGGGGCGCTCTACACTTCAGGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGTCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATC
  3   1   2       bld Tbd0 5g3  in                       IMAGE:6976587                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCGGGCTTTCTTTTCCGCCCATGTTTCAAGGGCAGAGCTTACTTTCCAATGGTGGGATAGCGGGGGCGTTATACACTTTCTGTTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCATGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTGGACATATCCAAGTTCCGTTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCGTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGTTACGGTTCCGCTGCCGTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCGGATTCTATTTTTAAAATATATTC
  3   1   2       bld Neu  5g3  in                    TNeu073p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTACCGGCTTTCTTTCCCCAAGTCCAAGGCAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTT
  3   1   2       bld Neu       out                   TNeu113i15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTACCGGCTTTCTTTCCCCAAGTCCAAGACAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg068d14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCCAAGGCAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGNGTACCACGTATGGGAGAAAGGTCACGCCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTT
  3   1   2      seed Brn3 FL   in                        CAAK10831.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCAAGGCAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAATGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGTT
  3   1   2       bld Tad5      in                         XZT16756.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTCAAGGCAGAGCTACTCTCCATGCTGGATACGGGGGCGCTCTACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAATGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGC
  3   1   2       bld Tad5                                 XZT72224.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGC
  3   1   2       chi Gas8      in                          st64i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGTACATAGAATGGCGCCTCTCTTCATTGTCAGTTCCGACTCATGAAATGCTAGAAAGGATTTACATGTATTCTCTTTACAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACCAGGGCAGGAT
  3   1   2       bld Gas8      in                          st31k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATNTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCNTAAGGAGGAGTTTCACCAAGACTTGTCCNGGCGCTACGGTTCCGCTGCCNTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACATTACAGAGAGGGGTGTGAGGACAATGGGCTNTTNCGTGCCTCTGCTNTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTNTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGG
  3   1   2       bld Gas8      in                          st71j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACCTTCAGGTACCACGTATGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGAT
  3   1   2       bld Gas8 5g3  in                         st104a18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTCAGGTACCACGTATGGGAGAAAGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACCAGGGCAGGAT
  3   1   2       bld Gas8 5g3  in                           st7i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGTCACGCCCCCACAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTA
  3   1   2       bld Te5       in                        CAAO12979.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATTATGCCAAGTGGAGGACTGCGACCACCCCGTACCGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAATGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGTT
  3   1   2       bld HdA  5g3  in                    THdA051g13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGGTGGAGTGGGCGCCAGACTTCGAGCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld TpA       out                   TTpA027n16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGACCCGTACGTAGTGGTGAGACGGGACTGCCCTGAGTATGACCAGCGCTTCTTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTTTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGTTTGGACATTTCCAAGTTCCGCTCCAGCGAAAATTACCCCCTGTGGGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCCCCCCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGGGTGAGGACAATGGGTTTTTCCGTGCCTTTGTTTTTTTACATACCTCCCTTATACAGGGCCTTCATTATAGGAGGGGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCCCGGGGGATGTTATTTTTGTGGCCTTTGTATGGGCCCCCGGACAATCAGCTGCAGTTCCCCCGCCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTTTTTCCCTGACGCATTTCAAAATTTTTCTTTATTTATATTATTTATGGGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTTTATTTTTAAAAAATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGTTTTTGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Egg  5g3  in                    TEgg015b20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCAGCGCTTCCTCGGCTTTGGCTGGAACAAAGTGTCGCACATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAACGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCCGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACACTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCGCCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGTGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT55166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAATGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAAT
  5   1   2       bld Tad5      in                         XZT55166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCATGGAGCTGGATGCCCAGGAACATGAACTGCTGGTTCTGCCTAATGCCTTTATCATCCACATGCCCCACGCTCCCAGCTTCGACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Te4  5g3  in                          CAAN442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACATCTCCAAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACTAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAATGCTGCAATCGTT
  3   1   2       bld Gas       in                    TGas095e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTT
  5   1   2       bld Gas       in                   TGas095e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTCCGCTCCAGCGAAAATTACCGCCTGTGCGTCCAGGCCCTTAAGGAGGAGTTTCACCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGCGGATAATTC
  3   1   2       bld Gas7      in                          XZG5800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGCAAGACTTGTCCCGGCGCTACGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGC
  5   1   2       bld Gas7      in                          XZG5800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCTCGGTTCCGCTGCCCTAAAATACCTCACGGCTGAGCGCAACCGGTGAACTTGGTGCAGAGACGCTGCCAGGAAACACTACAGAGAGGGGTGTGAGGACAATGGGCTCTTCCGTGCCTCTGCTCTTCTACATACCTGCCTTATACAGGGCCTTCATTATAGGAGGTGCCTGGCCCTTTAATAGGAACGAACCAGTTGCCACGGGGGATGTTATTTCTGTGGCCTTTGTATGGGCCACCGGACAATCAGCTGCAGTTCCCCCGGCCAATGGGGACGCGAGTCGTGATCACTGGACGGAGAGGGTCTCTCCCTGACGCATTTCAATATTTCTCTTTATTTATATTATTTATGTGGATAATTCCGATGAAATCAAACTGACAGGGCAGGATTCCTGATTCTATTTTTAAAATATATTCAGTTTCTTTTTGCAATAAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)