Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 26 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM1396.5                           14 END     14         11      100                nonmuscle myosin heavy chain b

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 278.0    0Xt7.1-CAAP7633.3.5                        101 PI      69          1     1745                Myosin heavy chain [Xenopus tropicalis]
     3 335.0    0Xt7.1-TGas090p06.3                         58 PI      75          3      670                Myosin heavy chain [Xenopus tropicalis]
     4 514.0    0Xt7.1-CAAJ12757.3                          10 PI      71         12     1838                LOC443585 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012154210 Xt7.1-CAAL8166.3.5 - 125 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970......4980......4990......5000......5010......5020......5030......5040......5050......5060......5070......5080......5090......5100......5110......5120......5130......5140......5150......5160......5170......5180......5190......5200......5210......5220......5230......5240......5250......5260......5270......5280......5290......5300......5310......5320......5330......5340......5350......5360......5370......5380......5390......5400......5410......5420......5430......5440......5450......5460......5470......5480......5490......5500......5510......5520......5530......5540......5550......5560......5570......5580......5590......5600......5610......5620......5630......5640......5650......5660......5670......5680......5690......5700......5710......5720......5730......5740......5750......5760......5770......5780......5790......5800......5810......5820......5830......5840......5850......5860......5870......5880......5890......5900......5910......5920......5930......5940......5950......5960......5970......5980......5990......6000......6010......6020......6030......6040......6050..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAL8166.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGGAAAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCA
                                                  Xt7.1-CHK-1008265507                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCxxxxCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9    10    10    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    11    13    11    13    11    13    11    13    11    13    11    12    10    10    10    10    11    11    11    11    11    11    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    10    11    10    11    10    11     9     9     8     9     9     9     8     8     8     8     8     8     7     7     7     7     6     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     8     8     8     8    10    10    10    10    11    11    11    11    12    12    11    12    11    12    11    11    10    10    10    10    11    11    11    11    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    17    17    17    17    17    17    17    17    18    18    18    19    19    19    18    18    17    18    19    19    19    19    18    18    18    18    18    18    18    18    19    19    19    19    19    19    20    20    18    18    19    19    19    19    18    18    18    18    19    19    20    20    20    20    20    20    20    20    20    20    20    20    20    20    19    19    19    19    19    19    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    13    13    13    13    11    11    11    11    10    10    11    11    12    12    12    12    12    12    12    12    14    14    14    14    15    15    15    15    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    15    13    15    12    13     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9    10    10    11    10    11    10    12    10    12    10    12    11    12    11    12    10    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8     9     9    10     9    10     9    10    10    11    10    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    16    16    16    16    16    16    15    15    15    15    15    15    14    15    15    15    14    15    14    15    14    15    14    15    14    15    13    14    13    14    12    14    13    14    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    10    10    10     9    10     9    10     7    10     7    10     7    10     6     9     4     6     3     5     3     5     3     5     4     6     4     6     4     6     5     8     6     8     6     8     6     7     6     6     6     6     4     4     6     6     6     6     5     5     5     7     3     5     3     5     3     6     5     8     5     8     7    10    10    13     8    12    10    14    10    14    10    14    10    14    12    14    13    16    14    17    14    17    14    17    14    17    14    17    15    18    16    18    17    19    17    20    16    20    18    20    18    20    16    18    16    21    17    20    18    21    16    21    17    21    17    21    17    21    17    20    16    21    16    21    16    20    17    20    16    19    17    20    15    19    16    19    16    19    14    18    16    19    15    20    15    23    15    23    15    29    14    28    26    42    28    44    28    44    28    44    28    43    29    44    30    46    31    47    34    49    34    49    31    49    33    46    33    46    33    46    33    35    33    34    31    33    32    33    32    33    32    33    32    36    33    36    33    36    33    36    33    36    33    36    33    36    33    36    33    36    33    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    34    35    33    34    35    36    32    36    32    36    32    36    32    36    32    36    32    36    32    36    32    36    32    36    32    36    32    36    31    36    32    36    31    36    30    35    30    35    30    35    28    34    28    32
  5   1   2  SIG                                      Xt7.1-CAAL8166.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGGGTGGATTATAAGGCAGACGAATGGCTGATGAAGAACATGGACCCTCTGAATGACAACGTTGCCACGCTGCTTCACCAGTCCTCCGACAAGTTTGTGGGCGAGCTGTGGAAAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCTACGTGNGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCACCTGCTACATT------------------------GGAGAGACTGGGGGACACAGCCGGGAGCCCGGGATACAGAGCGCACACAGCCCGGCATTGGCACCGACATGGCGTCAGGCAGCACCGGGGGGGAGGAGGAGCGCAGCCTGCGCGAGTGTGAGCAGTATGTGCACAAACACAACATCCAGCAGCTGCTGAAGGACTGTATCGTGCAGCTCTGCACCGTGCGGCCCGCCTGCCCCATGGCCTTCCTCAGGGAGTACTTCGAGCGGCTCGAGAAGGAGGAGGCGCGTCAGACATTAAACCAGCAGAAATCTGGCTCCCGTTCGGATTCCCGCGAGGATGAGATTTCCCCTCCCCCTAAAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGCGGCGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCA
  5   1   2  SIG                                      Xt7.1-XZT47443.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGTTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACATCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACTACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCATCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTAGACAACG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATTTTGTAAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATAAACTTAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Cs ---- 4e-013     AAX84194.1 cytospin A [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Br ---- 1e-014     CAA11445.1 intermediate filament protein C2 [Branchiostoma lanceolatum] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bf ---- 2e-026     CAA11444.1 intermediate filament protein C1 [Branchiostoma floridae] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 1e-049     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 6e-089     NP_011888.1 myosin class II; Myo1p [Saccharomyces cerevisiae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bb ---- 3e-109     BAC16746.1 myosin heavy chain [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAH67305.1 Myosin heavy chain [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 0          XP_785810.2 PREDICTED: similar to myosin heavy chain [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 0          NP_508504.2 Non-muscle MYosin NMY-1 (nmy-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 0          NP_001014553.1 CG15792-PC, isoform C [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 0          NP_001019619.1 myosin, heavy polypeptide 11, smooth muscle [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_780469.1 non-muscle myosin heavy chain 10; nonmuscle myosin heavy chain IIB [Musmusculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_005955.1 myosin, heavy polypeptide 10, non-muscle; myosin heavy chain, nonmuscle type B;cellular myosin heavy chain, type B type B [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_990805.1 nonmuscle myosin heavy chain [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAA49915.1 nonmuscle myosin heavy chain b [Xenopus laevis]  -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001084034.1 nonmuscle myosin heavy chain b [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAL8166.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------ATGTGA------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------TAA------TGA---------------------------------ATG---------------------------------------TAA---------------TAG---------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------TGA---TAA---------TGA---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------TAA------TGA---------------------------------ATG---------------------------------------TAA---------------TAG---------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------TGA---TAA---------TGA------------------------------------------------------------------------------TAA------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                      Xt7.1-CAAL8166.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGGGTGGATTATAAGGCAGACGAATGGCTGATGAAGAACATGGACCCTCTGAATGACAACGTTGCCACGCTGCTTCACCAGTCCTCCGACAAGTTTGTGGGCGAGCTGTGGAAAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCTACGTGNGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCACCTGCTACATT------------------------GGAGAGACTGGGGGACACAGCCGGGAGCCCGGGATACAGAGCGCACACAGCCCGGCATTGGCACCGACATGGCGTCAGGCAGCACCGGGGGGGAGGAGGAGCGCAGCCTGCGCGAGTGTGAGCAGTATGTGCACAAACACAACATCCAGCAGCTGCTGAAGGACTGTATCGTGCAGCTCTGCACCGTGCGGCCCGCCTGCCCCATGGCCTTCCTCAGGGAGTACTTCGAGCGGCTCGAGAAGGAGGAGGCGCGTCAGACATTAAACCAGCAGAAATCTGGCTCCCGTTCGGATTCCCGCGAGGATGAGATTTCCCCTCCCCCTAAAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGCGGCGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCA
                                                  Xt7.1-CHK-1008276392                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGATTATAAGGCAGACGAATGGCTGATGAAGAACATGGACCCTCTGAATGACAACGTTGCCACGCTGCTTCACCAGTCCTCCGACAAGTTTGTGGGCGAGCTGTGGAAAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCTACGTGNGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCACCTGCTACATTCCCCCC------------------------ACTGGGGGACACAGCCGGGAGCCCGGGATACAGAGCGCACACAGCCCGGCATTGGCACCGACATGGCGTCAGGCAGCACCGGGGGGGAGGAGGAGCGCAGCCTGCGCGAGTGTGAGCAGTATGTGCACAAACACAACATCCAGCAGCTGCTGAAGGACTGTATCGTGCAGCTCTGCACCGTGCGGCCCGCCTGCCCCATGGCCTTCCTCAGGGAGTACTTCGAGCGGCTCGAGAAGGAGGAGGCGCGTCAGACATTAAACCAGCAGAAATCTGGCTCCCGTTCGGATTCCCGCGAGGATGAGATTTCCCCTCCCCCTAAAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGCGGCxxxGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  0   1   1           BrSp FLx                  EC2BBA29CC01.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAACCCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAAACAAAATGATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTTGGTTGTTGAGCTTAAATCCTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTTTTTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Fat1      in                         CABC4233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGATTCGAATTGGCCGAGGGCCAACTCAAGGACAAGGCGGATTTCTGCATCATCCACTACGCGGGAAGGGTGGATTATAAGGCAGACGAATGGCTGATGAAGAACATGGACCCTCTGAATGACAACGTTGCCACGCTGCTTCACCAGTCCTCCGACAAGTTTGTGGGCGAGCTGTGGAAAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAAAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAGGTAAAACCGCTGCTCCAGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAAGATGAAGAACTGCTGAAGGTC
  5   1   2       ext Brn3      in                        CAAK11368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGGGTGGATTATAAGGCAGACGAATGGCTGATGAAGAACATGGACCCTCTGAATGACAACGTTGCCACGCTGCTTCACCAGTCCTCCGACAAGTTTGTGGGCGAGCTGTGGAAAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCCAGGAGAAACAG
  5   1   2       ext Te3       in                         CAAM7414.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCTGTGGAAAGATGTGGATCGGATCGTGGGGTTGGACCAGGTCGCAGGAATGGCAGAGACGGCTTTCGGGGCGGCCTACAAGACCAAGAAGGGCATGTTCCGCACAGTGGGGCAACTGTACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAG
  5   1   2       ext Te3       in                         CAAM6079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACAAGGAGTCTCTGACGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGA
  5   1   3        nb Brn2      in                        CAAJ12683.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAAGCTGATGGCGACGCTGCGCAACACCAACCCCAACTTTGTGCGCTGCATCATCCCCAATCATGAGAAGCGGGCGGGGAAACTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTTCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCANGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAAAGAGAGAGGAACCAGGTGCTGCAGAATGA
  3   1   2       ext Fat1      in                         CABC4233.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCGACCCACATTTGGTGCTGGACCAGCTGAGGTGTAACGGTGTCCTGGAAGGGATCCGAATCTGCCGGCAGGGATTCCCTAACCGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAAAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTG
  5   1   3        nb Te3       in                        CAAM16072.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGATCGTGTTCCAGGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCACGTTCAGGACCTGGAGGAGCAGCTCGACGAGGAAGA
  5   1   3        nb Te3       in                         CAAM4517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAGTTCCGCCAAAGATATGAGATCCTCACACCCAACGCCATCCCGAAAGGGTTCATGGATGGGAAGCAAGCATGCGAGCGAATGATCCGGGCTCTGGAATTGGATCCAAACCTTTACAGGATTGGGCAGAGTAAGATCTTCTTCCGTGCCGGGGTCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGTCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGA
  3   1   0       chi Kid1      out                        CABA7808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCAGTCTCATGAAGTAGTTGAACTACACCAAGGGAATAAGAGAGCTGTCCCATATCCTGTGTGGTGTACATTACTATTTCCCGTCCATGNCAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGGTGAGAATCAGCGTCATCCCTTGTTCCTCCTCCAGTTTGGGTTCGTAGAATAAAATCTTCCCCTTTAGGAGACATAAAAGCCATTAAACACGACCCGTTCTCCCCGGGTTCTGACCCCAAAGACCCACAGAGCTTTGTAGATCCTTTTTGAAGTTGAACCCGCTGGAGACGATTGCCGCCCCTTATTGTGTCATTCCCACAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGTTGGTTCTCCCTGTCGCCACCACCGTGTTCGCTCTGCGACTCTTATGTGATGCCCTTATTGTGCAAATCAAATGGCGACTGCCCAACTGAGCCTTCCCCTCTCCCCTGCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGCCTCTCGC
  3   1   2       ext Lun1      out                        CABD3580.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTGGCTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAAAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTGAAGAGAGGCT
  5   1   3        nb Lun1                                CABD13722.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCATCTGGAGGAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAAAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGA
  5   1   3        nb Te1       out                        CBWN7791.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGGAACGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCACGTTCAGGACCTGGAGGAGCAGCTCGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCC
  3   1   3        nb Brn3      out                        CAAK4834.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGACCTGAAGATCACAGATATCATCATACTCTTCCAGGCCGTCTGCAGGGGATACCTAGCTCGCAAGGCCTTCGCCAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCACGTTCAGGACCTGGAGGAGCAGCTCGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTGAAGAGAGGCT
  5   1   0       chi Brn4      in                         CAAL7899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGAAACAACAGCAGCTGATCGCCCTCAAAGTGCTGCAAAGAAACTGCGCCGCCTACCTCAAGCTGCGGCATTGGCAGTGGTGGCGCCTCTTTACCAAGGTAAAACCGCTGCTCCAGGTGACTCGGCAGGAGGAAGAACTGCTGGCCAAGGATGAAGAACTGCTGAAGGTCAAGGAGAAACAGTCCAAAGTGGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAANAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAG
  5   1   3        nb Tad5      in                          XZT6075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGGGAGAACTGGTGGAAATGGAGCGAAAGCAACAGCAGCTGGTGGAGGAGAAGAACATCCTCGCCGAGCAGCTTCAAGCAGAGACGGAGCTGTTTGCCGAAGCCGAGGAGATGCGTGCCCGTCTGGCCATCAAAAAGCAGGAGTTGGAGGAGATTCTGAGAGATCTGGAGATCCGCATGGAGGAAGAGGAGGAGAGGAACCAGGTGCTGCAGAATGAGAAGAAGAAGATGCAGGCGCATGTTCAGGACCTGGAGGAGCAGCTTGACGAGGAAGAAGCCGCCCGGCAGAAGCTGCAGTTGGAGAAGGTGACGGCAGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCTAAAGACTGAGCTAGAGGATACTCTGGAT
  5   1   2       ext Gas       in                   TGas115h01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAGCCAAGATCAAGAAGATGGAGGAAGATATCCTGGTGCTCGAGGACCAGAATTCCAAGTTCCTGAAGGAGAAGAAGCTACTGGAGGAACGGATTGCAGAGTCGACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCAC
  5   1   2       ext Brn3      in                         CAAK6362.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACCTCTCAGCTGGCCGAGGAAGAAGAGAAAGCCAAAAATCTGGCCAAGCTGAAGAACAAGCAAGAGATGATGATCACAGACCTTGAAGAGAGGCTAAAGAAGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGANAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGA
  3   1   2       ext Brn3      in                        CAAK11368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGAGGAGAAGACGAGGCAGGAGCTGGAGAAAGCAAAAAGGAAGCTGGACGGGGAGACCACAGACCTCCAGGACCAAATCGCTGAGCTGCAGGCTCAAATTGAGGAGCTCAAGCTACAACTCGCCAAGAAAGAGGAGGAGCTACAGGCTGCATTGGCCAGGGGAGACGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAG
  5   1   2       ext Te4       in                         CAAN9824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGAGGTTCTGCAGAAGAACAACACCCTGAAGGTGGTGCGGGAGCTGCAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGG
  5   1   2       ext Te3       in                         CAAM4212.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGGCACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAA
  3   1   3        nb Brn2      in                        CAAJ15535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGATCGCTGAGCTGCAAGAAGACCTGNAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGG
  5   1   3        nb Brn2      in                        CAAJ15535.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGATCGCTGAGCTGCAAGAAGACCTTGAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAAAAAAAAAAAA
  3   1   3        nb Brn2      out                       CAAJ12518.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACTGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCCGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGAC
  3   1   3        nb Te3       out                        CAAM4330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAGAAAAGGCGTCCCGCAACAAAGCTGAGAAGCAAAAGAGGGACNTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGAC
  3   1   3        nb Brn3      out                        CAAK4750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGAAGCAAAAGAGGGACCTGAGTGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGAC
  3   1   3        nb Te3       out                        CAAM3777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGGAGCTGGAGGCCCTAAAGACTGAGCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGAC
  3   1   3        nb Te3       in                        CAAM16072.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGAC
  5   1   2       ext Brn3      in                         CAAK9421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAACTGAAGAAGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAG
  5   1   3        nb Brn2      in                        CAAJ20022.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAGCATTGAAGAAGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGA
  5   1   2       add Te3       in                        CAAM14207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAGGCCAACAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCCGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCAGCAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAGAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGC
  5   1   3        nb Neu       in                   TNeu065l14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGAGGTGAAGTCTCTGCAACAGATGAAGGCAGAGTCTGAGTATAAGCGGAAGAAGCTGGAAGGTCAAGTGCAGGAGCTACACACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCATGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCCACGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGAC
  3   1   3        nb Brn2      in                        CAAJ23448.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGAC
  5   1   3        nb Brn2      in                        CAAJ23448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCAAGGTGTTGGAAGGAGACCGCCTGCGGGCCGACATGGTGGAGAAGAGCAGCAAGCTGCAGAACGAACTGGAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAAAAAAAAAAAAA
  3   1   2       ext Gas       in                    TGas115h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCAGCAAGCTGCAGAACGAACTGAAAAATGTTTCCTCTCTGCTAGAAGAAGCTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAGAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTGAANCGGGACCTGCAGACCCGGGATG
  5   1   3        nb Te4       in                         CAAN5360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAACGAACTCGGAAAATGTTTCCTCTCTGCTAGAAGAAGAGGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAGAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACT
  3   1   3        nb Neu       in                    TNeu065l14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTTGAAAAGAAAGGGATCAAGCTGGCAAAGGATGCAGCGAGCCTGGAGTCCCAGCTACAGGACACACAGGAACTGCTCCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAGAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTGAACGGGACCTGCAGACCCGGGATG
  3   1   2       add Brn4      in                         CAAL7899.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAAGAGGAAACCCGGCAGAAGTTAAACCTAAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAGGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACG
  3   1   3        nb Tad5      in                          XZT6075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGCAGCCGCATCCGACAACTGGAGGAGGAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAGAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGACTGCAGACCCGGATGAGCAGAACG
  3   1   3        nb Te3  PIPE out                        CAAM4265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAAAGAACAACCTGCAGGAGCAGCAGGAAGAGGAAGAGGAGGCTCGGAAAGCCCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAG
  5   1   3        nb Brn3      in                         CAAK6348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGGAAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGT
  3   1   3        nb Te3       out                        CAAM1815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAGCAGATCCTCAGTCTGCAGTCTCAGCTGGTAGAGGCCAAGAAGAAAGTGGATGATGATGTGGGCACCATCGAGGGCCTGGAGGAAGTGAAGAAGAAGCTCCTAAAGGACATGGAGAGTCTGGGACAAAGACTGGAAGAGAAGGGCATTGCCCACGAGAAACTAGAGAAAACCAAAAACCGGCTCCAGCAGGAACTAGATGATCTGATGGTGGATCTGGATCACCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACG
  5   1   2       ext Te4       in                         CAAN1341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAAAGGCAGATTGTGTCCAACCTGGAGAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTC
  5   1   3        nb Te3       in                         CAAM5326.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACCGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGA
  3   1   3        nb Te3       in                         CAAM5839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACG
  5   1   3        nb Te3       in                         CAAM5839.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAAAAAAAAAAAAAA
  5   1   2       ext Brn4      in                        CAAL20710.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTCCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAAGCACATGGAGCTGCTGAACGATCGGTTCCGT
  5   1   2       ext Brn3      in                         CAAK9202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAACTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGCTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTANAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCA
  5   1   4      seed Brn2      in                        CAAJ23419.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCTGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCANACTCCAGCGGGAACTCGACGATGCAACGGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCAGCCGCTC
  5   1   3        nb Te5       in                        CAAO10500.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCANACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCCTGAGAACAGACTGAGAAGGGGCGG
  5   1   3        nb HdA                            THdA043p06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCTGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACGGAGGCCNAATGAGGTGTTGAGCCNGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAAGGGGCGGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCAGC
  5   1   2       add Limb      in                        CBSU8739.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACGGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACG
  5   1   2       add In62                            IMAGE:8953046.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCCGCTTCCTGTAAGAGGATCCCGTCGCTCCGAATTCGTCCCTCCAACAGCACGTCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACCACCCTGCAGGTTGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAGACTCCAGCGGGAACTCGACGATGCAACGGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAATGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAATAGAAACGATAAACGCTGAAGTCACGAGTTCCCACCCAACGGATGAGCCGTTCCTCGCAGTTCCCGGGCCCCACTTCCGACCGGAGCATGGTCATCGCACTTCAGTGCTGAAGGGCGATG
  5   1   3        nb Tad5                                 XZT48169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACTACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCATCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAGTGCTTTTGTCTTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTTGACTTGTTCTGCCGAAATTCCCCC
  5   1   2       ext Brn2      in                        CAAJ14280.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCGGAAAGCCACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCT
  3   1   3        nb Te3  5g3  out                        CAAM1396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTAAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGT
  3   1   3        nb Brn2 5g3  out                       CAAJ14049.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAAGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCCAATCCCCCCCCCCTCCCCCT
  5   1   2       add Brn3      out                        CAAK2780.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAAGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCCAATCCCCCCCCCCTCCCCCTAAAAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGGCCCGTCC
  5   1   2       ext Brn4      in                         CAAL8166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCTACGTGNGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCACCTGCTACATTCCCCCCTCCA
  5   1   2       add Brn4      in                         CAAL6766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCGGGAGAGACTGGGGGACACAGCCGGGAGCCCGGGATACAGAGCGCACACAGCCCGGCATTGGCACCGACATGGCGTCAGGCAGCACCGGGGGGGAGGAGGAGCGCAGCCTGCGCGAGTGTGAGCAGTATGTGCACAAACACAACATCCAGCAGCTGCTGAAGGACTGTATCGTGCAGCTCTGCACCGTGCGGCCCGCCTGCCCCATGGCCTTCCTCAGGGAGTACTTCGAGCGGCTCGAGAAGGAGGAGGCGCGTCAGACATTAAACCAGCAGAAATCTGGCTCCCGTTCGGATTCCCGCGAGGATGAGATTTCCCCTCCCCCTAAAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGCGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTT
  5   1   2       add Limb      in                        CBSU9606.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAAGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCAGGAGCATTGGCGCAGCCGCACTCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCCCCCAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCTCACGTGGGGTGAGGGCGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTGCTTGCGCCCCCCCCCCCAATCCCTCAATCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAAAATTTCTGCTCCTCTGTCAAAATGGGTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCAAGGTCTTTCAGGGTGGG
  5   1   2       add Tbd1      in                         CBXT4623.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATCCATTGAACTTGTTCTGCCGAATTTCCCCCCCCCTCCCCCCAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAATCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAAAATGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATAAAATGCTCTTTCAGGCTGGGATAGGCAAAATGAATGGGGGAATGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGTGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAAACAAACTGTGCCTTAAACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTA
  3   1   2       ext Brn3      in                         CAAK9421.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       add Limb      in                        CBSU8739.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTTACGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCCTGTGAGGCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  5   1   2       ext Tad5      in                         XZT17308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCC
  3   1   3        nb Brn2      in                        CAAJ20022.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   4      seed Brn2      in                        CAAJ23419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Brn3      in                         CAAK9202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATGGAAT
  3   1   2       ext Te4       in                         CAAN1341.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Te4       in                         CAAN9824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       add Limb      in                        CBSU9606.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGTTACTGTCCTTTGCTTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAAACAAAATGATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTTAGTTGTTGAGCTTAAATCCTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTTTTTTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Te3       in                         CAAM6079.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCGTTACTGTCCTTTCCTGCGCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       add Tbd1      in                         CBXT4623.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATAAAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGTGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATTTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTTAGTTGTTGAGCTTAAATCCTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGTGGATCACAGTAACTCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAGAAAAAAAAAAAAAAA
  3   1   3        nb Brn2      in                        CAAJ12683.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTTTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCCTTATGG
  3   1   2       ext Brn2      in                        CAAJ14280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Brn4      in                         CAAL8166.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCCCCCCCNCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   3        nb Brn3      in                         CAAK6348.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTCTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Brn4      in                        CAAL20710.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       add Brn4      in                         CAAL6766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Brn3      in                         CAAK6362.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTTTTTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTCTGGAATC
  3   1   2       ext Te3       in                         CAAM4212.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATGG
  3   1   3        nb Brn2      out                       CAAJ16074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGGGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATTTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTTTTTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATGGAATC
  3   1   3        nb Te3  5g3  out                        CAAM1619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   3        nb Te5       in                        CAAO10500.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCNCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Tad5      in                         XZT17308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCAATCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Te3       in                         CAAM7414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATGG
  3   1   3        nb Brn2      out                       CAAJ20009.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCAGTCTCTGCAAGGGTACAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   3        nb Te3       in                         CAAM5326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATCTTGTAAGACAATAAACTTATTCATTATAG
  3   1   3        nb Te4       in                         CAAN5360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTCCTCTGTCAGACTGGCTATGAAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCCTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTAT
  3   1   3        nb Te3       in                         CAAM4517.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATA
  3   1   2       ext Tad5      in                         XZT57404.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGGGAAATGTCAATCACTTCTAGTCCCCGCCCATATAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATT
  5   1   2       ext Tad5      in                         XZT57404.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAATGTCAATCACTTCTAGTCCCCGCCCATATAATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAGAAAAAAAAAAAAAAAGG
  5   1   3        nb Te3                                 CAAM16431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTC
  3   1   3        nb Te3  5g3  out                       CAAM15800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATGAATGGGGGAGTGCCACTCACTCCCCGGCTTTTATTGGGTGTGGCATTTAGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTGGTAAGACAATAAACTTATTCATTATAGAATC
  5   1   2       ext Tbd1      out                       CBXT22247.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTATAACACATTTGAAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACAAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAGAATGGCAGAATGAGGAGAATTCGTGCTTTGCCTTAAGTTGCCCGTGATCATTTCACTTTAATGATGTTTGATTTAAAGAACAATCCATGTACTGTGATTTATTATAGGGATTTTGAGCACCTGACTGTTCTGATGTTCCTCTTACAGTTTCCAGCACTGCAGTAAATGCTCAGCGTGGGGGACACGGCAGTGTAAGAGACACTCTGGTCCTTACTGGCCAAGCTGATTTGTTCAGCAGTGCTGAAGTTTTCCATCTCATTACTGTG
  3   1   3        nb BrSp FLx  in                     EC2BBA29CC01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAAACCCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAAACAAAATGATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTTGGTTGTTGAGCTTAAATCCTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTTTTTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTCTAGACAACGAAT
  5   1   3        nb BrSp FLx  in                     EC2BBA29CC01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGAAACCCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAAACAAAATGATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTTGGTTGTTGAGCTTAAATCCTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTTTTTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb HdA                            THdA053j18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  5   1   3        nb HdA                            THdA053j19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCCGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  5   1   2  SIG                                      Xt7.1-XZT47443.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGTTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACATCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACTACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCATCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTA
                                                  Xt7.1-CHK-1008276394                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGTTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACATCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACTACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCATCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATT
  5   1   2       ext Tad5      in                         XZT47443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGAAGCAGAAGAAGTTTGATCAGCTCCTGGCAGAGGAGAAGAACATCTCTGCCCGCAACGCAGAGGAGCGAGACCGAGCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGTTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACATCTGGAAAGTCCGCCCTCCTGNACG
  3  -1   2       ext Lun1      in                         CABD8491.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCGAGGCTGATGCCCGTGAGAAGGAAACCAAGGCCCTGTCCTTGGCCCGAGCCTTGGATGAAGCTCTGGAAGGTCGGGATGAGTTTGAAAGGCTGAACAAACAGCTGCGGGCAGAGATGGAAGATCTCATGAGCTCCAAAGATGATGTGGGGAAGAACGTTCATGAGCTGGAGAAGTCAAAGCGGGCACTTGAGCAGCAGGTGGAGGAGATGCGCACTCAGCTGGAGGAGCTGGAGGATGAACTGCAGGGCACGGAGGATGCCAAGCTGCGCCTGGAAGTGAACATGCAGGCCATGAAGGCTCAGTTTGAACGGGACCTGCAGACCCGGGATGAGCAGAACGAAGAAAAGAAACGGGCGCTGGTGAAACAGGTGCGGGAGCTGGAAGCTGAGCTGGAGGATGAGCGCAAGCAGAGAGCTATGGCCGTGGCCATCAAGAAGAAGTTGGAGATGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACATCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAG
  5   1   2       ext Tad5      in                         XZT68460.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGACGCGTGGGTGGATATGAAGGACTTGGAGTCCCAAATCGAAGCTGCAAATAAAGGCAGGGAAGATGCCATCAAACAGCTGCGCAAGCTTCAGGCCCAGATGAAGGATTACCAGCGGGAGCTGGAGGAGGCACGGGCATCACGAGACGACATCTTTGCTCAGTCCAAGGAGAACGAGAAGAAGCTGAAGAGTTTGGAGGCGGAAATTCTTCAGTTGCAGGAGGAACTGGCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACATCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACTACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGANACAGCTGAAGAGGCAACTGGAGGAGGCGGA
  5   1   2       ext Eye       in                         CCAX7727.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCATCTTCAGAGCGCTCACGGCGACATGCAGAGCAGGAACGGGACGAGCTTGCTGATGAGATTTCCAACAGCACATCTGGAAAGTCCGCCCTCCTGGACGAGAAGAGACGCCTGGAAGCGAGGATCGCCCAGTTAGAGGAGGAGCTGGAGGAAGAGCAAAGCAACATGGAGCTGCTGAACGATCGGTTCCGTAAAACTACCCTGCAGGTGGACACCCTGAATTCTGAGTTGGCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCA
  5   1   4      seed Tad5      in                         XZT41693.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTGGAGAGCGCAGTTCAGCCCAAAAAAGCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGTACAAAGAGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCATCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCT
  5   1   0       chi Tad5      in                         XZT30027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGCAGGCACGCTGACCAGTACAAAGAGCAGGTACCAAGGGGCACAGATAAGACCCTGGTGGCACAGTGCCAAGGTAAGTGCAATTAAGTCGTATGTCTGTGATGCAGATGGAGAAGGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCACGGCGCAAACTCCAGCGGGAACTCGACGATGCAACGGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCGTCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAAGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCCAATCCCCCCCCCCTCCCCCTAAAAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGCGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCTCCCACCCTGGTTCTGTCGACAGC
  5   1   0       chi Tad5      in                         XZT23161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGAGAACGCTCGGCAGCAGCTGGAGCGGCAGAACAAGGAACTGAAGGCCAAACTACAGGAACTGGAGGGTTCCGTAAAGTCCAAATTTAAAGCCACTATTGCCACTCTGGAGTCTAAGATTGCACAACTGGAAGAGCAGCTGGAGCAGGAGGCCAAGGAGCGAGCTGCCTCTAACAAACTGGTGCGCAGGACTGAGAAGAAGCTGAAGGAGGTGTTCATGCAGGTGGAGGATGAGCGCAGGCACGCCGACCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCATCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGNGGTGAGGGTGGCAGTGNGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCT
  5   1   2       ext Eye       in                         CCAX5467.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCCAATACCCGCATGAAACAGCTGAAGAGGCAACTGGAGGAGGCGGAAGAGGAAGCCACTCGCGCCAACGCATCGCGGCGCAAACTCCAGCGGGAACTCGACGATGCAACCGAGGCCAATGAGGTGTTGAGCCGGGAAGTGTCCACCCTGAAGAACAGACTGAGAAGGGGCGGGCCCGTGTCCTTCTCTTCCTCCTCCAGCCGCTCGGGCAGGCGCCAGCTGCAGATCGAGGGGGCATCCCTGGATATCTCCGACGATGAAATAGAAACGAAAAACGCTGAGGTCAACGAAGTCCCCACCCCAACGGAGTGAGCCGCTCCCTCGCCAGGTTCCCGGGGGCCCCCACACCTCTCAGCCCGGAGCATTGGCGCAGCCGCACCCTCATTGGCAAAAAGTGCTTTTGTCTTTTTTTTTATTTTATTTTATTAATTCCAAAATACAGATCCATTGAACTTGTTCTGCCGAATTCCCCCCCTCCCCCCCAAAAAAAGGCCCAGATCTGCACCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTC
  5   1   0       chi Tail      in                         CBSW4484.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTGGAGTGATAAGGAACCAATCTTATAACAAAAGTACTTCATGTGGAATGAAATAATTTATTTCATGGATACTGAAAATATATTGAGAATGGGTTTTGATATGTTTTATCATCTTGTTTTACTTCATTTATGTTGCTCAGTAGTGTGTGCAATCTCCCCCTAAAAAAAAGCCCCAGGGGGCTACACTCCCAGCCTTTCAGATCTCCAATCAGACTTCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGCGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGAGCCCCCCCCCCCCCCCCCCCCAA
  3  -1   2       ext Mus1      in                         CABH7148.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTCCTTTCTCTCCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAAAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGGGGGCGTGGTATTCCCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAAATGCGTACCCTTTTACAATGCTTAAAGTCATACATAAAACAAACTGTGCCTTAAACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAAACAGAAGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCA
  5   1   3        nb Tad5      in                          XZT3165.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCTCTTTCTCTCATGGCACCATGTGAAGTATCTGAACACTACGTCTGTGGCCCCGTCCCACGTGGGGTGAGGGTGGCAGTGGGGGGCATTTGCTTCATTTCTCACCCCTTTGCTTCTCGCAGCTGCTACATTCCCCCCCTCCCACCCTGGTTCTGTCGACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAAACCCTCAATCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAAAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCAAGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGGGGCATTTGGTGGGCGTGGTATTCCCAAGGAATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAAAAAAACTGGGCCTTAGACACTTAAAATCTGAGAAAAAAATAGTTAAAAAACGAAATAATGACTTATCTACCTGCCACCCACCAATCAAA
  5   1   0       chi Tad5      in                         XZT55368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTAGAGGATACTCTGGATACCACCGCAGCCCAACAAGAACTGAGGACGAAAAGGGAGCAGGAGGTGGCAGAACTGAAGAAGAGCATTGAAGAGGAGACCCGAAACCATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGA
  3   1   2       add Tad5      in                         XZT55368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATGAAGCTCAGATCCAGGAGATGAGGCAGCGACAGGCAACAGCCCTCGAGGAGCTCTCTGAGCAGCTGGAACAGGCCAAGAGGTTCAAGGGAAACCTAGAGAAGAACAAGCAGAGCCTGGAGTCAGACAATAAGGAGCTGGCCACTGAGGTGAAGTCTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  5  -1   2       ext Mus1      in                         CABH7148.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGCAGAAGAACTCAACTGTGAATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAA
  5  -1   2       ext Lun1      in                         CABD8491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAGAAGAACTCAACTGGGAATCCGTTACTGTCCTTTCCTTGGGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTT
  3   1   2       ext Tad5      in                         XZT47443.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCCGTTACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   3        nb Mus1      out                       CABH11865.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGTCCTTTCCTTGCGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   4      seed Tad5      in                         XZT41693.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTTTCCTTGCGCCCCCCCCCCCCCNCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAG
  3   1   2       ext Tad5      in                         XZT68460.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTCCTTGGGCCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGGGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATTTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATTTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTTTTTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATGG
  3   1   2       add Tad5      in                         XZT23161.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCCTGGGGCCCCCCCCCCCCCCCAATCCCTCAGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATGG
  3   1   2       ext Eye                                  CCAX2097.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTCTCTGCAAGGGTTCAAGGGGCCCACTTGGTTCCACAAACAGAATTTCTGCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAGAATCC
  3   1   0       add Tail      in                         CBSW4484.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCAGAATGAATGGGGGAGTGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAACCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAATGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTCTCTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATTCATTATAGAAAAAAAAAAAAAAA
  3   1   3        nb Tad5      in                          XZT3165.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCCTCTGTCAGACTGGCTATGGAAATGTCAATCACTTCTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAACACATTTGAAACCCCCAATCCCTAACTGCGTACCCTTTTACAATGCTTAAAGTCATACATAAGACAAACTGTGCCTTAGACACTTAAAATCTGAGAAAAATATAGTTAAAAAACGAAATAATGACATATCTACCTGCCACCGACCAATCAGATGTGATCGTTCCTCGCGCTTTATGTTACGATATGAAGAGATCAGTCAGTATTACCCAGAAGCCTCAGTCATGTGCTGGACATATCACTTTATTTGTATTTTGTTTTTTTAGTTGTTGAGCTTAAATCTTTTATTGAGCGTTTCTGGCCCGAGGGTCCAGCGCGGATCTGTGCGCATTCGTCTCTATTCATTATCATTATATATATTATTTTTTTTAACACATAACAGCTGCAAGCTCCTCCCTTTTTGCTAAACCCGCCTCACCCCTGCCCCGCCCCTCTGTATAGCCCATATTTCTAGACAACGAATTTTGTAAGACAATAAACTTATT
  3   1   2       ext Eye       in                         CCAX7727.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGTCAGACTGGCTATGGAAATGTCAATCACTTTTAGTCCCCGCCCATATCATGCTCTTTCAGGCTGGGATAGGCCACTCACTCCCCCGGCTTCTATTGGGTGTGGCATTTGGTGGGCGTGGTATTCGCAGGGTATGGGGGCTATAA<