Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012154220 Xt7.1-CABD6470.5.5 - 72 ESTs
                                                                       ..-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABD6470.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTAGCACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAAAGCCCCAAATCACAAAGTCATTCCAGTGTAGTATAGTGTGTAGGGATTTATCCAGGTTCCATTCCGACCCCCCCCCCCCCCCCACAGTTGGCTGTGCTGTACTAGGCACCTCCATTAATGATCCATTGCCACCTTGCCCGAGAAAATAAATAAATTAAGCCTGTAACGTTCTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008266419                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAAAGCCCCAAATCACAAAGTCATTCCAGTGTAGTATAGTGTGTAGGGATTTATCCAGGTTCCATTCCGACCCCCCCCCCCCCCCCACAGTTGGCTGTGCTGTACTAGGCACCTCCATTAATGATCCATTGCCACCTTGCCCGAGAAAATAAATAAATTAAGCCTGTAACGTTCTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    3     6     6     8     8    10     7    12    13    14    13    15    15    15    15    15    15    15    15    16    16    16    17    17    17    17    16    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    20    20    20    20    19    20    19    20    20    21    20    21    20    21    20    21    20    21    19    21    19    21    19    21    19    21    19    21    19    21    20    22    20    22    20    23    20    22    20    22    20    22    20    22    20    21    20    21    19    20    18    20    18    20    18    20    17    19    17    19    17    19    15    18    11    16    12    17    12    17    12    17    12    17    11    17    11    17    11    14    11    14    11    13     9    12     9    12     9    11    10    12     9    10     9    10     8     9     8     9     8     8     8     8     6     8     8     8    10    11    11    14    15    16    14    16    15    16    15    16    15    16    15    16    14    17    14    17    15    17    16    17    16    17    16    17    16    17    16    18    16    18    16    18    18    19    18    19    18    19    18    19    18    19    17    19    18    19    17    19    17    18    18    19    18    19    15    18    17    18    17    18    16    17    15    16    15    16    15    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    17    17    16    17    16    17    16    17    16    17    16    17    17    18    17    18    17    18    17    18    17    18    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    19    17    19    15    18    15    18     6    10     8     9     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     5     5     5     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     7     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     8     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     4     5     3     5     3     5     3     5     4     6     4     6     7     9     7     9     7    10     8    11    10    11    10    11    10    11    13    15    11    15    13    15    13    15    13    16    12    16    14    17    15    17    15    17    15    17    14    17    15    17    15    17    14    16    15    17    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    15    16    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    14    15    14    14    14    14    14    14    14    14    14    14    10    13    10    13    10    13    10    13    10    13     6    10     3     3
  5   1   2      ests                                 Xt7.1-CABD6470.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTAGCACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAAAGCCCCAAATCACAAAGTCATTCCAGTGTAGTATAGTGTGTA
  5   1   2      ests                                 Xt7.1-CAAN5557.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACGTTCTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTATTAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AG----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---C--------
                                               BLH ATG      64     648                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN      64     105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               CDS MIN      64       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI     -10       6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                       PROTEIN --- Ce ---- 1e-008     NP_001040875.1 T23G5.2a [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Sc ---- 8e-010     NP_013796.1 Phosphatidylinositol/phosphatidylcholine transfer protein involved in coordinate regulation of PtdIns and PtdCho metabolism, products of which are regulators in Golgi to plasma membrane transport; functionally homologous to mammalian PITPs [Saccharomyces c ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 4e-040     NP_724193.1 CG10237-PA [Drosophila melanogaster] ----------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Xl ---- 1e-045     AAH88689.1 LOC496227 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - ?? ---- 1e-045     NP_001088883.1 hypothetical protein LOC496227 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Sp ==== 3e-051     XP_780795.1 PREDICTED: similar to tocopherol (alpha) transfer protein [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 8e-103     NP_997755.1 Unknown (protein for MGC:63845); wu:fb20b02 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Gg ==== 1e-128     NP_001026025.1 hypothetical protein LOC419197 [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Mm ==== 1e-130     NP_859423.2 hypothetical protein LOC76080 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Hs ==== 3e-132     NP_001034288.1 hypothetical protein LOC79183 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          CAJ82567.1 Novel protein containing CRAL/TRIO domain [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABD6470.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TGA------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---TAG------------------------TGA---------------------TAG---------------------------ATG------------------------------ATG---------------------------------TGATAATAG---------------------TAA------TGA---------ATG------TAG------------------ATG------------------------------------------------------------------------TAGTAG---------------------------------------ATG------------TGA------TAG---------------ATG---------------------------------------------------------TAA---ATG------------------------------------TAG------------------------------------------------------------------------------------------------------------------TAG---------TAA---------------ATG---------------------------TAATGA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAA---------------------TAG------------------------------------ATG---------------------------ATG------------------------------------------------------TAA---------------TAA------------------------------------------------------------------------------------------TGA---------------------------------------------TAA------------------------------------TAG---------------TGA------------------------TAA------------TGA---TAG---------------------------------TAA------------------------------------------ATG---------------------------------------TAGTAG---ATG---------------TAA---------------------------------------------------------------------------------------------------TGATGATGATGA------------------------------------TAG---------------------------------------------------------------------------TAG---------TAG------------------------------------------------------------------------TAATGA------------------------------------------TAA------------TAG------------------------------------------------------TAA---------TGATAG---------------------------------TAG---------------------------------TAGTAGATG------------ATG---------------TAA------------------------------ATG------TAA---------------TGA------------------ATG---TAG------------------TAG---------------TAA---------------------------------------------TAG---------------------------------------------------------------ATG---------TGA------------------------------------------------------------------------TGA------------------------ATG---------------------------TGA------TAG---------------------------------------ATG------------TAG------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG------------ATG------------------------------------TAGTAA------------------------------TGA---------------------TAA------------------TAA---ATG---------TAAATG---------------------------TGA------------------------------------TAG---------------------TAG---------------------------ATG---------------------------------------------------TAA------------------------ATG---------ATG---------------TAA------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Gas  FL                     TGas020k08.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCACATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CABD6470.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTAGCACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAAAGCCCCAAATCACAAAGTCATTCCAGTGTAGTATAGTGTGTA
                                                  Xt7.1-CHK-1008225541                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAAAGCCCCAAATCACAAAGTCATTCCAGTGTAGTATAGTGTGTAGGGATT
  5   1   2       bld In60 5g                         IMAGE:8947827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCTGTTTTAAATACTTATTATTTCGATTCGAATTCGTCCCCAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGACGGCTTTCCTATCAGATCAAGCTGTCAATGTCATAACGAGCCGAGATATTTAAAGGCATATTTGCTATCCTGAAGCCTTTCTGAAGAAAAATAGTAAAAGTTCTTTCTCCATGATCAGACTGAATCCCTCATGCAAATACAAAGTCATCCTACCTGAGATATGGCGGCCTGCTGAGCTGACCACTGCATGATCGATCTATAAATCGAGGAGACTGCATATTGCCTGGCATCCACGGAGACCTCAGCCTTCTATAAGATCGATCGATCTCGATCAGGATTCCCCGGGGGATCCCCCCTTGATCAGATG
  5   1   2       bld Gas7 PIPE in                         XZG19372.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAGCGATCCCGGAGTGCGGGCTGTGGGAGGGAAGTCGGTGCTGTTGGGCAGGATGCAGTTACTTGGAGTTTAGTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTC
  5   1   2   12  bld Gas7 5g3  in                         XZG34142.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCGGCTGCGGGATTTTGTGTAGCACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCANAGTCCATCCTAACTGAGAATATGGCGGCACTGCTGGAAAGCT
  5   1   2       bld AbdN 5g                            IMAGE:7023761                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGGGATTTTGTGTAGCACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATTCTGAAAGCCCTTTCTGAAAAGAAAAATAGTAAAAAGGTTCTTTTCTCATGGGATCAGAACTTGAAATTCCCCTTCATGCCCAACATACCAAAGTTCCATCCTTACCCTGGAAGGAATATTGGCGGGCACTTGCCTGGGAAAGCCTGGGAAAACCACTTGGCAT
  5   1   2       chi Te3  5x3  in                         CAAM9792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGCTGTGGGAGGGAAGTCGGTGCTGTTGGGCAGGATGCAGTTACTTGGAGTTTAGTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGTAGGTAGTGACTCATGCTGAGCCTCATTTATAAAAAGAGTGCTAGGTGCAAAAACAGGTGCTGTTAACAAGGTTGTTCACCTTTAATCAGCTCTCAGCATGATGTTAAAAACGATACTGTAAAAAAAAttgcaattggtcttcattttttattatgtgtagcttttgaattatttagctttttcttcagcaactctccagtgtggaatttcaactgcactctggttgctagggttcagatttccctagcaactgagcagtgatgtgactgagaaactggaatatgaataggagaggcctgaatagagagataaAGTAATACAGAACAATAGTTCTCAGGCTCAGTGACCCCCATTTAAAAGCTG
  5   1   2   10  bld Te1  5g3  in                         CBWN7276.b1 .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ATTTTGTGTAGGACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTTTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCGCTCTGCACCTCAGCAGGGTTACGTCTGCAGCCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCATTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATCGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTCATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTG
  5   1   2       bld Te5       in                        CAAO12343.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTTGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGANAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCACATACCAAAGTCCATCCTACCCTGA
  5   1   2   12  bld Gas7 5g3  in                         XZG21833.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACAGGAGGCAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCTGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTAT
  5   1   2       bld Te5       in                         CAAO4923.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGNAAGAAAAATAGTAAAAGGTTCTTTCTCATGGATCAGACTTGATTCCCTCATGCCACATACCAAGTCCATCCTACTGAGGATAT
  5   1   2       bld Te5       in                         CAAO8934.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCGGGCGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGANAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGANGAATATGGCGGCACTGCTGGAAAGCTGGA
  5   1   2       bld TpA  5g3  in                   TTpA061f18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTTTGACAGCTTGTGTGGGAGGTTTGACCTCTACTCATGGCACAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCATTGAAGACCACTCTGCACCTCAACAGGGTTACGTCTGCAATCTGAATCAATAACTTGTCCTTAAAGCTCGGGAGGAACTACTACAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGATGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTACTTCTTGCTTCGATTTCTCAGAGCCAGGAAATTTGATTATGACCGGGACCTGCACTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCATAGGTTTTTACTGATTTGAGACCCTCATCTGTTAAGCCCGATGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACTTAGGGGCGCCAGGTTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGATGACACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGAGGTTGACACACTCTTCTCACTTTGGGCCCTTTATTG
  5   1   2   10  bld Mus1 5g3  in                        CABH10735.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGAGGGTGGGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGANAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACACTGCATGGAGTCAGATACTATTAGATTTCTGAGAAGACTTTGCAGTACA
  5   1   2       bld Gas  FL                        TGas020k08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAGGTTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCANAATCAAGGCTGTCAATGTCATTAACGAGCCGA
  5   1   2       bld Lun1      in                         CABD6470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTAGTTGACCTCTACTCAATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCANAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGC
  3  -1   2       bld Gas0                                 dad23e05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCTCTACTCATGGCAGAAGACAATGAGACATCCTTAGGAAGTTCATCTGTTTCCACACCCCTTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGAGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGGTTCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGGGATCTTAGCCCACTAC
  3   1   2       bld Gas7 PIPE in                         XZG19372.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGTTTCCACACCCCCTGAAGACCACTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTG
  5   1   2       bld Ski1      in                         CABJ9595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTGCACCTCAGCAGGGTTACGTCTGCAGTCTGAGTCCAGAACTTGTCCTTAAAGCTCGGGAGGAACTACAAGAAAAGCCAGAATGGAGGCTACGTGATGTCCAGGCTCTGAGGGACATGGTATGGAAGGATTACCCCCACCTAAAGACTCGAGTGGATGATTCCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCANAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCA
  5   1   2       bld Gas7      in                         XZG57635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTCTTGCTTCGCTTTCTCAGAGCCAGGAAGTTTGATTATGACCGGGCCCTGCAGTTGCTGGTAAACTATTACAGTTGCCGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCATTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATG
  3   1   2       bld Te5       in                         CAAO4923.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTGCAGTTGCTGGTAAACTATTACAGTGCCGGGAAGGCTTGGCCAGAGGTTTTTACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTGGCGCT
  5   1   2       bld Te1       in                        CBWN16672.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGATTTGAGACCCTCAGCTGTTAAGCCCGTGTTGGACTCTGGCTTTCTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCGTTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTA
  3   1   2       bld Te1  5g3  in                         CBWN7276.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTNTAACAGTCCTGCCTCACACAGACACAGAGGGGCGCCGGATTGTCTGTATCCGTCCTGGCTGCTGGATTCCCAGAGATTATCCAATCACAGAGAACATCCGTGCCATATATCTCTCATTGGAGAAGCTTGTGGAGTCTGAGGAGACTCAAGTTAATGGCATCGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTCATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACAGAATCTGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATGAAAAAAAAAAAAAAA
  5   1   2       bld Te1       in                         CBWN4229.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGAGTCTGAGGAGACTCAAGTTAATGGCATCGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCCCTGCAGTTCGAGGAGTCCGCGCGGGGTGTAAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTGTTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCANGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTA
  5   1   2       bld Gas7      in                         XZG54374.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGTTAATGGCATTGTGATCTTAGCCGACTACAATGGAGTGGGGTTGACACACGCTTCTCACTTTGGGCCCTTTATTGCCAAAAAAGTAATTGGAATTCTTCAGGACGGCTTTCCTATCAGAATCAAGGCTGTCAATGTCATTAACGAGCCGAGAATATTTAAAGGCATATTTGCTATCCTGAAGCCCTTTCTGAAAGAAAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTT
  5   1   2       bld Brn4      in                        CAAL20881.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATAGTAAAAAGGTTCTTTCTCCATGGATCAGACTTGAATTCCCTTCATGCCAACATACCAAAGTCCATCCTACCTGAGGAATATGGCGGCACTGCTGGAAAGCTGGACACCACTGCATGGAGTCAGATACTATTAGATTCTGAGGAAGACTTTGCAGTACATTTTGGCCTGGCGCATCCCACGCGGGAAGGATCGCTGCAGGGCTTTCTCATGAACGATACGGAATCCGATTCTCTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCNCATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGA
  5  -1   2       bld Gas                            TGas060n21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGATTTTGAGGAAGACTTTGCAGTACATTTTGGCCTGGGGCATCCCACGCGGGAAGGATCGCTGCAGGGTTTTTTCATGAACGATACGGAATCCGATTTTTTGCAGTTCGAGGAGTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTTTCAGTTAAAGCTGTTTATCATTCATTGGCTCTCCCCTTATTCACCCATGTTCCTTGTGCACTGTCTCCCTTTTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCCCATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTTTGCAAAGCTGGTAGTTTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGTTTAGTCGCCCCCATGCTGCCATGGAACATAGGGAGATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGCCCCGG
  3   1   2       bld Gas7 5g3  in                         XZG34142.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAGTCCGCGCGGGGTGTGAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTGATTTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Lun1      in                         CABD6470.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTCCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAG
  3   1   2       bld Mus1 5g3  in                        CABH10735.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGCGCGGGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCACATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATTTCAAAAAAAAAAGCCTCTCG
  3   1   2       bld Te3  5x3  in                         CAAM9792.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGTGTGAAATCCCAGCTCTATTGTTACTGAGTGTTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATT
  3   1   2       bld Gas7      in                         XZG57635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGTGTGAAATCCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG54374.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTGTGAAATTCCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTANTCATTCATTNGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAGG
  3   1   2       bld Te5       in                        CAAO12343.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATNTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTT
  3   1   2       bld Ski1      in                         CABJ9595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCTCTATTGTTACTGAGTTGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTT
  3   1   2      seed Te5       in                         CAAO8934.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTNGTATATGATCTCAAGAGTATATTTTGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATT
  3   1   2       bld Te1       in                        CBWN16672.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCTAGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCTTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAA
  3   1   2       bld TbA                             TTbA013a24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCGCTTGATTGACCAATGTCTCAGTTATAGCTGTTTATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7 5g3  in                         XZG21833.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTTATAGCTGTTAATCATTCATTTGCTCTCTCCTTATTCATCCATGTTCCTTGTGCACTGTCTGCCTTCTGCTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTGGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Te1       in                         CBWN4229.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCTCATATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTGTTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTAGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCAGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTTATCCATGTTGAGTTTATGTTTGGCAGTGGTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGATTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA061f18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATGCCAACAAAAACTAACTGCCAAAATAAGCCAAAGCATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGGTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGTTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTATTACTAATGGTGCAACACTGTTAATGAACACTGATCCTTTGATGTTGCTAGAATACAGCTCTCAGCATGGAGGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGAAGCATCTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCTTACTGTCAAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTTACTCCATCCAATAGTCACACATTAAAAAAAAAAAAAAAAA
  5   1   2       bld Te4       in                        CAAN11702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATAGTCATCCTTCACATTAAACATAAATTGAGTTAGTTGTAGGGCCTCCATTGTTATTGCAGAGTATGAAATTCAGGTCTGCAAAGCTGGTAGTCTCAAGCTAATACCCAATGTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACA
  3   1   2       bld Brn4      in                        CAAL20881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAAGAGGATGCTCCAATCAGAATTCAGCTTAGTCGCCACCATGCTGCCATGGAACATAGGGAGATTACTGTGCAGCTGATAATAGCCTGGAATTGAACATCAGGTTTAAACATGCTGATTTGCAGATATGGGGTTTTAGAGAAAACCATTAGCAATAATGGCATACACAAGGAACAGGGAGCCGGAGTACACAGAGAAGTCTGGATTCTCATTAGGATCATTTTGCATTCATTAGTAGGATCTTGTCAGTATTACTACTAATGGTGCAACACTGTTAATGAACACTGATCCCTGATGTTGCTAGAATACAGCTCTCAGCATGGATGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTT
  5   1   2       bld Te1       in                         CBWN7557.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAACACTGATGCCTGATGTTGCTAGAATACCGCTCTCAGCATGGGTGAACCCTTGGTAATATGGTTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGA
  5   1   2       bld Te4       in                         CAAN4492.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGTCTGCTGGGCATTATAGTCCAGCAATATTTGGGTAATCCATGTTGAGTTTATGTTTGGCAGTGCTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCA
  5   1   2       bld TbA       in                   TTbA071h07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGCACTCAGGGCAATAGTTTAGTGACTGTCTCATTGAAGTTAGTGTTGACACTGGGGTACTCTTTTCCTACTGTTCAGATAGTGTGAAAGACCCTGCTCATATCAGTGTTTTACTTTTTAACTCCATCCTATAGTCACATATTTAAAAAAAAAAAAAAATATGCTCTTGTTTTTTATTCAATGGTTTCTTTAATGAATTGCCTTGTGTATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTAATAGGGTTAAGGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGC
  5   1   2       bld Te4       in                        CAAN11157.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGAATACTCGGCCATATCAGTGCCGTAAAGCCTACCTAACAAGCTATCCACGCTCCCTTTCTGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGNGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAG
  5   1   2       bld Spl2      in                        CBSS2722.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACACAAGTGGAGGTGGAAATGAAGGGAAGTGCTCTCACATTCCTCCTGTTAGAGAAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAG
  5   1   2       bld Te5       ?                          CAAO9612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAACAATTAGTAGGAGCACTTCTGCTAATTGTTCTAAGGGGGCCCCTAAGGGTGACTCAGGCAAAAGCCCCCTTTTCAAATTGATATCATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGNGTTTTAGGAAAGCAG
  5   1   2       bld Te4       in                         CAAN5557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCCTGCCCGGGATGCATTATTGCTGTGTGCGTTCTAAGAGATTGTTGATTGGTAGTGAGTAAAGTTTACTGTATAAAGCACAAAGTAGGGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGNGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTNAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGGATTCTTATGACTTACT
  5   1   2       bld Tad5      in                         XZT69307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGCAGATTCCTAATATCTCAGGGCACGGGGGCGTTAGAGACCAAATGAATGGTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACATAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAAAGCCCCAAATCACAAAGTCATTCCAGTGTAGTATAGTGTGTAGGGATTTAT
  5   1   2       bld Gas                            TGas026e05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGGTCTGCTTTGAGGGGGTTGATGCTTTTGGTGACAGAGCAAAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGA
  5   1   2       bld Te5       in                         CAAO6282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGCCTAAGATGCTTTGCTGGATTTTTGTTTATTATACATGTTCATTAAGGCCTAATGGGGCTGTTTAATTGTCACCCATTGCCTAAACATCTATTATAGGGTTAAGGGAACAGTTGTTGGCCATTGTTTCTCATTTTTTTTATTTCTGTTTTCATGGTTTGGGCCCAACATTCAGATGAGTGCAGTTACCATCTCAGCATTACATTGTGTACTGTTATAAGGCATAATGGCACAAGTATACTTGGCAATGCCAGGGGGCACTTTAGTACCTGTACAGGTTATGAAACAAAAATGTGTCAGTTGGTGCCTAACACACCCTTCCGTGATTATAGCTTTACGCTATTAAAATATGTATAGCATACTGTTAAGTGGGTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAA
  5   1   2       bld TbA       in                   TTbA007b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTAGGAAAGCAGAGGAAATTCAAGTCCCAGAATCCATGACTTCAACACAAAGCAAGGTAGGGGAGGGGTACTTTACATAGTAGAAAATGTCATGTGGAAATCGGTAATTGCGAAGCACAAATAAAAGGGGGTTGTATTTGGTAGATGTTTTATATGGAATAGTTGCTGTTACTGTTCTTAAAGAGAAATTTGAGCTAAGACTGTGTTGATGATGATGAGGGAATTCTTATGACTTACTGGGGGTGCTGAGTGCATAGCTGTTGGACATCTCCACCTCCTTTGCCCTTCATAAGCCAATCACAAAAGCCCCAAATCACAAAGTCATTCCAGTGTAGTATAGTGTGTAGGGATTTATCCAGGTTCCATTCCGACCCCCCCCCCCCCCCCACAGTTGGCTGTGCTGTACTAGGCACCTCCATTAATGATCCATTGCCACCTTGCCCGAGAAAATAAATAAATTAAGCCTGTAACGTTCTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATANGGTATCTATAGCTGCCAA
  5   1   2      ests                                 Xt7.1-CAAN5557.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACGTTCTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTATTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008230615                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTxTxxxAAAAAA
  5   1   2       bld AbdN                               IMAGE:7024934                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTACTGGGCACCTCCATTAATGATCCATTGCCACCTTGCCCGAGAAAATAAATAAATTAAGCCTGTAACGTTCTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAAATAAGTGAAGCCCGTAGCCTTACCTTCCTTGTTTTTTTCCAGAAATATTTGGCATTTTGGAAGATGTCCGAATACCTGGAAAAATTCCCAGGGGTGCCTTGCCCCTGGAGGTGCAGGGCATAAAAAAAAAAAATTTGGGTTGGTGGAAACCCCAGAAAAGAAAGTGGAAATGGGCTGCCGGGTTTGGGCCAAAATCAAAGGGTTTCAGCCCCTTCCCCCCCTTAAAATTGTTAAAAAAAGAGGGGGCTTTTTGGGGGCCATAAAGGGCAAAAAATTTACCGGGGGGGGCCCCAAAAAATTATTTTGTGTATGCCGCCTTTGGAAAAACCCCTATG
  5   1   2       bld Mus1      in                         CABH2200.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACGTTCTAGCTATTAGGCTGCAACGCCCACCAAGCCTTCTGACTTTGGTAGTTTGGTAGTTGTAGTTCAATAACAGAGGTCTTGATAGAATGTCCTGTTACTGGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTT
  5   1   2       bld Egg                            TEgg097d01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCTGTTACTGTGGAAATTCCATACAGTTATAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTACATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGGGGTATCTGTCGTTAATGGGAAAGTAAGCTTCATTTACCAACTGATGTTTGAATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATATTTATTAAAGCGGAAATAAAACTCCGAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGACGTGCAAGCATAAAAAACAAATATGGCTGGGGAAACCAAAAAAGAAATGATATGGCTGCTGGATGGGCAAATCTATGCTTCAACCCTCCACCATAAATGTAACATGAAGGCATTACTGCATACAGGCAATATTACTGTGTGCACAGAATATTTGTATGCTATGTAAGCCATAAGGCTAGTTTGGATAGACTGATAAACTGCAGGCCCTGG
  5   1   2       bld Te1       in                         CBWN6102.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAGGGGTTACAATCCAGTGTCAGTGCCATATTTATATAGTAGATGAACTGGCAGGGAATGGGTAAGTATGGAATATAAACTATAGCGCTCTTGAGGTATCTGTCATTAATGGGAAAGTAAGCTTCATTTAGCAACTGATGTTTGTATTATATTTATATGTTTTAGTTAAGGTCAGGTTGGACATAGTTATTAAAGCGGAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGACCAGCACTATGTATCCAAGGGGAATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTATGCTTGCCCTGGGGTGCAGGCATAAAAAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCGGCTGGTTGGGCAAAGCAATGCTTCAGCCATCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGTTATAGGGTTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGGCAACAAAACCTCCAGTCTGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCT
  3   1   2       bld Te4       in                        CAAN11157.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAATAAAACTCCAAACATACTTATAATATTCCTTATAGCATAGGGTATCTATAGCTGCCAATAAGTGAAGCCGTAGCTTACCTTCCTGTTTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAG
  3   1   2      seed Te4       in                         CAAN5557.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTCCAGATATATTTGTCATTTGGAGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTT
  3   1   2       bld Te4       in                        CAAN11702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGNTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTT
  3   1   2       bld Te4       in                         CAAN4492.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATGTCAGATACATGAAGAATACACAGTGTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTT
  3   1   2       bld Mus1      in                         CABH2200.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTCAGATACATGAAGAATACACAGTGTGCTTGCCNTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTAAA
  3   1   2       bld Spl2      in                        CBSS2722.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGCTTGCCCTGAGGTGCAGGCATAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTNTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTATTCTC
  3   1   2       bld Te1       in                         CBWN6102.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGGCATAAAAAAAAAACAAATATGGCTGGTGAAACCAAGAAAGAAGTGATATGGCGGCTGGTTGGGCAAAGCAATGCTTCAGCCATCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGTTATAGGGTTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGGCAACAAAACCTCCAGTCTGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGCGTAATTGGAATTTAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAGATGTATTATAATGAGATCTGCCCTCCGCTGTGAAGTACGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR3014.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCCCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTATTCTC
  5   1   2       bld Liv1      in                         CAAR3014.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGAAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCCCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTATTCTCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                         CBWN7557.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGTGATATGGCTGCTGGTTGGGCAAATCAATGCTTCAGCCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                   TTbA007b19.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGATATGGCTGCTGGTGGGGCAAATCAATGCTTCAGCCCTCCACCATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGNTCAATCCAATAAAATCTACATGTTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT69307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATAAATGTAAGATGAGGGCTTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTT
  3   1   2       bld TbA       in                    TTbA071h07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAGTGCATAAAGGCAATATTACTGTGTGCTCAGAATATTTGTATGCTATGTAAGCCATAGGGCTTGTTTGGTTAGACTGATAGACAGCAGGCCCTGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTAAAAAGAAAAAAAAAAAAGC
  3   1   2       bld Te5       in                         CAAO6282.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGGAGATTAAGTGCAGACAACAAAACCTCCAGTCCGCCATAGCCCTTAAAAAAGACTTCAGTAAAGACAAGCATTATGCAAGGAATGTTCTGGGCACACAATATAAACTATACCCACATACTGTATTTCTGTTAAGAGTAATTGGAATTGAAGCTCCATATATGTAGGAGAAAGGGAGGATGGTGGCAGACGGGTCTGTAACTGTGGCATATTGTGTATAGTAAGGCAAAGCAAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTG
  3   1   2       bld Ski1      in                        CABJ10804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAACACTTCACCCATTGATTGTTGAGAATGTTGCATTTCCCTTTCTTAAACCCTAAGAATACAGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACNNTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTT
  5   1   2       bld Ski1      in                        CABJ10804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCTTCCCGTTTCTTAAACCCTAAGAATACGGAGGTAAAACATGAACGTCTCCTAAATGTATTATAATGAGATCTGCCCTCTGCTGTGAAGTAAGTCTGAGCAATATGGCTGCTGTACGGGTTGCTAGTATAGTGTAACATACAATAAATAGAACATTGTTTTAGAATTTTTGTGCTCAATGAAATGTTTATTTTTCTACCCTGGTTTATCCATCAACATTTTATATTGTATATAAAAGTGGCACTTGGGTCTCTTTCAAATGTCAGTTTATATGCATGGGTCAATCCAATAAAATCTACATGTTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)