Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA031b10.3                         65 END     1           1        1                novel protein similar to actin-related protein 6 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 495.0    0Xt7.1-CAAR10953.5.5                        70 PI      71        980     2718                chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012154247 Xt7.1-CABK4825.3.5 - 53 ESTs
                                                                       ........-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK4825.3.5                                                                                                   CATACCAGCCTAGTCACCGATCTGAGAGGGCCTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGGGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTTTACTCTTCGTTCCATCAACCCCTTTGGGAACAGCCGTCTGGTCCTCTTCTATGTTGAGTTTCATGCACCGTGGCACTTATTGGAGCTCATTCCATTCATTTTATTGGGGATATTTGGGGGATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTCACTAAG
                                                  Xt7.1-CHK-1008265063                                                                                                         AGCCTAGTCACCGATCTGAGAGGGCCTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGGGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTTTACTCTTCGTTCCATCAACCCCTTTGGGAACAGCCGTCTGGTCCTCTTCTATGTTGAGTTTCATGCACCGTGGCACTTATTGGAGCTCATTCCATTCATTTTATTGGGGATATTTGGGGGATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTC
                                                      consensus depths                                                                                                        2     2     2     2     2     2     4     4     5     6     5     6     5     7     5     7     6     8     6     8     6     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     6     8     5     8     6     9     6     9     6     8     5     6     4     4     4     4     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     3     3     4     3     4     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     4     3     4     3     4     3     4     4     5     4     6     5     6     5     6     5     6     5     7     5     7     5     7     6     7     6     7     6     7     7     8     7     8     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    10     9    10    10    10    10    10    10    10    10    10    11    12    11    12    11    12    11    12    11    12    12    13    13    14    12    14    12    14    12    14    12    14    12    14    12    14    12    13    12    13    11    12    11    12    11    12    11    13    11    13    12    14    12    14    13    15    14    15    14    15    15    16    15    17    14    17    15    17    15    17    15    17    15    17    14    17    13    16    13    15    12    14    12    14    12    14    12    14    13    14    13    15    16    17    15    16    15    16    15    15    15    15    17    17    18    18    17    18    17    18    17    17    17    17    17    17    16    17    17    17    18    18    18    18    19    19    21    21    22    22    22    22    22    22    21    22    21    22    22    23    22    23    21    22    22    22    22    22    22    22    22    22    20    20    19    19    16    22    17    23    17    23    17    23    17    23    17    23    17    23    16    23    16    23    16    23    17    24    18    25    17    24    16    23    16    23    16    23    18    23    14    17    14    16    14    15    14    14    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    14    12    14    13    14    11    14    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12     5     7     6     6     2     5     2     5     2     5     2     5     2     5     2     5     2     4
  5   1   2      ests                                 Xt7.1-CABK3932.5                                                                                                   CATACCAGCCTAGTCACCGATCTGAGAGGGCCTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGNGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTT
  5   1   2      ests                                 Xt7.1-CABK4825.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGGGATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       G-----------
                                               BLH ATG     313     602                                                                                                   
                                               BLH MIN     313     321                                                                                                   
                                               BLH OVR     313      40                                                                                                   
                                               EST CLI      36      42                                                                                                   
                                               ORF LNG     313      18                                                                                                   
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 6e-101     NP_012574.1 Integral membrane protein highly homologous to voltage-gated chloride channelsfrom humans, mice and fish; Gef1p [Saccharomyces cerevisiae] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 0          NP_495940.1 voltage gated CLC-type chloride channel subunit (88.2 kD) (clh-5)[Caenorhabditis elegans] -----------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Sp ---- 0          XP_792053.1 PREDICTED: similar to Chloride channel protein 3 (ClC-3) [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Dm ---- 0          NP_648834.1 CG5284-PB [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 0          NP_057900.2 chloride channel 5 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 0          NP_000075.1 chloride channel 5; Chloride channel-5 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 0          XP_690819.1 PREDICTED: similar to chloride channel CLC-5 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Gg ---- 0          XP_420265.2 PREDICTED: similar to chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 0          AAD24497.1 chloride channel ClC-5 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          CAJ83644.1 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK4825.3.5                                                                                                             TAG---------TGA---------------------ATGTAA---------------------------ATG---TGA---------------TAA---------------------ATG---------TGA---------------------------------------------------ATG---TGA---------------------------------------TAA------------------------TAA------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------ATG------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATG---------------ATG---------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------------ATG---------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGA---------TAA------------------------TGA------------------------------------------------------------------ATG------------TGA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------TAA------------------ATG------------------------------------------------TGA---------------TGATAA------TAATGA------------------------------------------------------TAA---------------------------------------------------------------------ATG---------------------------------------------------------------------TAG------------------------------------------------------------TAA------------------------------------------------TAA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Egg  FL                     TEgg016f13.FL-Sanger                                                                                                                                                                          CTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGGGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTTTACTCTTCGTTCCATCAACCCCTTTGGGAACAGCCGTCTGGTCCTCTTCTATGTTGAGTTTCATGCACCGTGGCACTTATTGGAGCTCATTCCATTCATTTTATTGGGGATATTTGGGGGATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTAGGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CABK3932.5                                                                                                   CATACCAGCCTAGTCACCGATCTGAGAGGGCCTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGNGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTT
                                                  Xt7.1-CHK-1008235613                                                                                                         AGCCTAGTCACCGATCTGAGAGGGCCTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGGGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGC
  5   1   2       bld Gas1 5g                            IMAGE:6986718                                                                       ATACGGAGTCCGGAATTCCCGGGGATCTCATACCAGCCTAGTCACCGATCTGAGAGGGCCTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATAACCTTGCTTGGATGACATTTCCTCACACTGGATGACTGATCAAAAGGAGGGTATCTGTTCTGCCTTGGTTCTGGGTTAACACTGAACAGTGCTGTTGCCGTCAAAA
  5   1   2   10 seed Spl1 5g3  in                         CABK3932.5p ......................................................................................CATCGATTCGCTCATACCAGCCTAGTCACCGATCTGAGAGGGTCTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGC
  5   1   2   24  bld Te4  5g                              CAAN3597.5p .................................................................................................................................CTGTCTGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTC
  5   1   2       chi Thy1      in                       CBST10033.fwd                                                                                                                                       TGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCG
  5   1   2   14  bld Te4  5g3  in                         CAAN7629.5p .......................................................................................................................................TGCGACTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTTATCTTCTCTCTTTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACTCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCG
  5   1   2   10  bld Liv1 5g3  in                         CAAR7857.5p ...........................................................................................................................................CTCTGATGTAATTACATGTTAGAGAGGTGACTAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTC
  5   1   2       bld Egg  FL                        TEgg016f13.p1kSP6                                                                                                                                                                      TAACACAATGCTGTGATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCTTCTCTCTTCTTGAGAGCACGATACCACTCATGATGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGATGCCTCTATTATAATAGCTAATGTCTGACATCGAGTAACTGCATCTAAGGAATCCAGCATTTGACCAGACATCCCCCTCTGTCGCCAAGGGATGGACAACAAAGGATTTCGCCGATCCAGCCTCTCAAGGTTTCACATGCACCACTAGTGACTAAGACATGGTCTGAAATAAACTGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTAGGATGCTTTGTTTCATAATACGGCTATGGTTTGCATGGACCCTCTAAAGTGATGGATTTCCTACACGTGCCAAGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAAAGATCGAGACCGGCGCAGACATATTCTATGCTCGAGTAGGGAGTCCGCGTGGGCCCTTCTGCGCGGTATCAGTGATGCCTTTTCTGGATGGATGCTGATGCTGCTCATTGGCCT
  5   1   2   10  bld Fat1 5g3  in                        CABC11442.5p .........................................................................................................................................................................................ATTGCATTCAGAAAAGTAATACTCTGCTGCAAGTTCTTCCATGTTTTTTAGCTGATCGTCTCTCTTCTTGAGAGCACAATACCACTCAGGAGGTGACCACAAAATTATGGCTTGACAATGGGTTTGTACAGCAAGAGGCCTCTATTATAAGAGCTAATGTCTGACATCGAGTAACTGCATCTAAGTAATCCAGCATTTGACCAGGATCCCCCTCTGTCGCAAAGGGATGGACAACAAAGGATTTCGCCGTTCCAGCCTCACAAGTTTTCACAGCAGCACTAGTGACGAAGACATGGTTGAAATAAACGAGGCTACCCTGGATTTTACCATGACGGATGATGTGCCCCCCATTGACAGAGACATGGCTGGAGGCTTTGTTTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAAACATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACT
  5   1   2       bld Spl1      in                         CABK4825.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCATACAACGGCAATGGTTTGCATGGTCCCTCTAAGGTGATGGATTTCCTAGACGTGCCAGGAGTGGGGACTTACGAAGACTTTAATACAATCGACTGGGTGAGGGAGAAGTCAAGAGATCGAGACCGGCACAGAGAGATTCTAAGCAAGAGTAAAGAGTCCACGTGGGCCCTTCTGCGCAGTATCAGTGATGCCTTTTCTGGATGGATGCTTATGCTGCTCATTGGCCTTACCGCAGGTTCATTAGCTGGCTTGATTGACATTTCATCACACTGGATGACTGATCTAAAGGAGGGTATCTGTCTGCCTTGGTTCTGGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGNGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTTTACT
  3   1   0       add Neu       ?                     TNeu092p22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTTGGACAGCTGGTTCCTGATGGGTTTTATTTCCATTGTGCTGGAATAAGGAGAAATAGAAAAGCATAAGGTGGGTTTTTTCCACTCTTTCCATACTACATATCCCTGTAATTCCTGCCAGGAAGTGGAGAATGCCATCTCCATAGGGTTAGGCGCCCATAATCGAATAACATTATACCTTTTCAGTGAGTAGGAAGTATCTTTCATGCATTCTTTATGCTATAGGTTATTCCTTTTTAACATGTTACCTAGAAACATATGGTCCATGCTAGTAGAATGATTTTTTTTTTTACTCTATATAGCCTTCAAATATTTCCATATTCTTACAGCTTTTGTGAACCTCTTTCTTCAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGAGACAGGTTTGATCACTTGTGTATCAGATATCATCAGAGTTTGTATGGGATATCATTAACTATACATTAACAAGATTCAGTCTGCTGTAGACTCTTGCTTTGGAATTGAATTCTACTGCAAACAGGAATGAGTTGTTTAGGAAAAGGGAAATGCGCCATAGCATTAGTTGCACAGTTTGGCAGCTGAACAGAAACAGGATTCCACAGGAGCAAAAATAGTCCACAAGGAAATACCTGCTGGTGAAATCCACTAAAAAAAAAAAAAAAAA
  5   1   0       add In60                            IMAGE:8948720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTTTTGAGGGATCAATCAGATTCAAATTCGTCCCGTTTAACCATGAACAGTGCTGTTGGCAGTCTAATAATGTGACTTTTGAAGATCGAAACAACTGTCCGGAATGGAGAAGCTGGTCCCAGCTTGTTCTCGGCAGGTCCGAGGGAGCGTTTCCATACATTCTAAATTACTTCATGTATGTGTTATGGGCACTGCTTTTCTCGCTGCTTGCTGTTTTGCTGGTCCGTAACTTTGCCCCATATGCCTGCGGTTCAGGGATTCCTGAGATAAAGACAATACTGAGTGGTTTCATTATACGTGGCTATTTGGGCAAGTGGACATTGATTATAAAGACTATGACACTGGTGCTGGCTGTGTCTTCTGGTCTCAGCTTGGGCAAGGAAGGACCTCTCATTCATGTTGCCTGTTGTTGTGGTAACATCCTGTGCCATCTATTCACTAAGTACCGCAAGAATGAGGCCAAAAGGAGAGAGGTGTTGTCAGCTGCAGCCGCTGCTGGGGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTTTACTCTTCGTTCCATCAACCCCTTTGGGAACAGCCGTCTGGTCCTCTTCTATGTTGAGTTTCATGCACCGTGGCACTTATTGGAGCTCATTCCATTCATTTTATTGGGGATATTTGGGGGATTATGGGGTGCCTTTTTCATCCGAGCACATTGCCTGTGCCAGAGACGGAAACCACCAAACTGCCGCTATCAGTGCAGAAGTCCTGTGGGTGACGCTATACAGCATGCTGCCTTTCCCAATGATACACCAGATGACTCTATGAAATGATATCTGACTTTCAATGACTGTGCTCTGGACTCGTCAAGCTATGTGATTACCCTTAATGATTACATTAAC
  5   1   2      ests                                 Xt7.1-CABK4825.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGGGATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTC
                                                  Xt7.1-CHK-1008226606                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTCACTAAG
  5   1   2       bld Ovi1      in                        CABI10766.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGGTGTTGTCAGCTGCAGCCGCTGCTGGGGTGTCAGTAGCTTTTGGTGCTCCCATTGGTGGAGTTCTCTTCAGTCTGGAAGAGGTCAGCTATTACTTCCCACTGAAAACTTTGTGGAGGTCATTTTTTGCTGCATTGGTAGCAGCCTTTACTCTTCGTTCCATCAACCCCTTTGGGAACAGCCGTCTGGTCCTCTTCTATGTTGAGTTTCATGCACCGTGGCACTTATTGGAGCTCATTCCATTCATTTTATTGGGGATATTTGGGGGATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTTGTGGTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGG
  5   1   2       bld TpA       in                   TTpA036n10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGCCCCGGGCCCCGGGCCCCGGGGGGATATTTGGGGGATTATGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGCCAGAGACGGAAAACCACCAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGAC
  5   1   2       bld TpA                            TTpA032c20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATTGTTGGGGTGCCTTTTTCATCCGAGGCAACATTGCCTGGTGACACAGACTGAAAACCACCAAACTTGGCCGCTATCCAGTGGCACAAGTCCTTGTGGTGACAGCTATTACAGCAGTGCTGTGCTTTTCCCAATGATTACACCACAATGATCTCTATTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAGAGGGGGGGAACCTCCCTGACCGCGCAGCACGAAATGGAGTCTACACAGCAATGTGGCAACTGATCCCTGGCGTTGATCTTCAAAGATGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGACTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGAGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGATGATCTTCAAATGATGGTGCAACCAATGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGATTGGAGCAGCTGCCTGCCTAGGTGAGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCAGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCACACGCTTTGAGGCGGGAGAGTATCTATGATGCCCACATCCAT
  5   1   2       bld Ovi1      in                         CABI9239.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAACTTGGCCGCTATCCAGTGGCAGAAGTCCTTGTGGTGACGGCTATTACAGCAGTGGCTGGCTTTTCCCAATGATTACACCAGAATGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCANAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCG
  5   1   2       bld Neu       in                   TNeu105n11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGCTCTAGTGAAATGATATCTGAGCTTTTCAATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAACTATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCT
  5   1   2       bld Gas7      in                         XZG33111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGATATCTGAGCTTTTCATGACTGTGGCCTTCTTGACTCGTCCAAGCTATGTGATTACGTTAATGATTACAATAACACAAAGGGGGGGAACCTCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAAGCAGA
  5   1   2       bld In62                            IMAGE:8956894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACATTAGAGTATTTTTCAAAAAAAACAAAAAAATAAAAAATCCCCCTGACCGCGCAGCAGGAAATGGAGTCTACACAGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGAAGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAAGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGGCTTCCCATTGTCATTTCTAGAGAATCCCAAAGACTGATTGGCTTTGTACTGAGACGAGACCTATTATATCTGTCGAGAGCGCCCGAAAAGCAGAGCATATGAGCACATCGCGATTACTTACGAAACACACCCACAACACGGACGGTCGCCAGCTAGTCAGGCATAGGACTAGCTCAATACGACCAGGCTTGGATTGGGGTGAAT
  5   1   2       bld Ova1      in                          CABE406.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCAATGTGGCAACTGTCCCTGGCGTTGATCTTCAAAGCTGTTATCACCATTTTCACATTTGGCATGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGAACGCTCCGCCCAGCCTAAAACTC
  5   1   2       bld In60                            IMAGE:8950411.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGATCAAAAATAAACCCGAAACTATTTTAAATAAAAATCGTCCCTGAAGGTACCGTCAGGCCTTTTCATCCCAAGCATGGCTGTTGGCGCTATAATGGGAAGGCTTTTGGGGGTTGCCATGGAACAGCTCTCCTTCTACCATCATGACTGGCTGATCTTCAGAGGATGGTGCAACCAAGGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATTCCAAAGACTGGTTGGCTTTGTACTGAAACGAGACCTTATTATATCTGTCAAGAGCGCCTGGAA
  5   1   2       bld HdA       in                  THdA016a19.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGACTGATCTAAAGGAGGATGGTGCAACCAAAGAGCAGACTGTATTACCCCTGGTCTCTATGCCATGGTTGGAGCAGCTGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGGATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTANAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACANACTATAGACCCTGTTGTAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACT
  3   1   2       bld Ovi1      in                         CABI9239.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCTGCCTAGGTGGCGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTAGGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTT
  5   1   2       bld Neu                            TNeu111i05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGACTAGGTGACGCCACACGTATGACTGTCTCACTTGTGGTTATCATGTTTGAGTTAACCGGTGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTCCGTAAGCTTGGTCTACGGCAGTGCC
  3   1   2       bld Spl1      out                       CABK10081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTAGGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCAC
  3   1   2       bld Fat1 5g3  in                        CABC11442.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCTGGAATACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTAGGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCAC
  3   1   2       bld Neu       in                    TNeu105n11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACATTGTACCACTGATGGCCGCCGCAATGACCAGCAAGTGGGTGGCAGACGCTTTGGGGCGGGAGAGTATCTATGATGCCCACATCCATTTAAATGGTACCCATTCCTGGAGGCAAAGGAGGAGTTCAGCCATAAAACACTGGCCATGGATGTCATGCGTCCCCGGCGCAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGGATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAG
  5   1   2       bld TpA                            TTpA014b14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGGATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTG
  3   1   2       bld Spl1      in                         CABK4825.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACGACCCTATATTGACAGTCATTACCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGGATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTAT
  3   1   2       bld Ova1      in                          CABE406.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGTCATACCCCAAGACAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTAGGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACAC
  3   1   2       bld Ovi1      in                        CABI10766.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGACCAGTATGACGGTGGAGGACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTAGGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGT
  3   1   2       bld Liv1 5g3  in                         CAAR7857.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACATCGAGGCCATTATAAATGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTAGGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTAC
  3   1   2       bld Te4  5g3  in                         CAAN7629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAACAACCTACAGTGGCTTCCCAATTGTCATTTCTAGAGAATCCCAAAGACTGGTTGGCTTTGTACTGAGACGAGACCTAATTATATCTGTCGAGAGCGCCCGGAAAAAGCAAGAAGGCATAGTGAGCACATCGCAGATTTACTTTACAGAACACACCCCACCCCAACCACCGACCGCTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAAAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACAGACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTAC
  3   1   2       bld HdA       in                   THdA016a19.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAACCACCGACCGTTCCGCCCAGCCTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTTTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTTTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas7      in                         XZG33111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCAGCNTAAAACTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGACCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATCC
  3   1   2       bld Thy1      in                       CBST10033.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCAGCCTAAAATTCAGGGCAATTATGGACTTAAGCCCTTTCACAATAACAGTCCAGACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATTACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGTCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTTTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTAAG
  5   1   2       bld HdA       in                  THdA029h07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTG
  5   1   2      seed HdA       in                  THdA029h09.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACGCCTATGGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCC
  5   1   2       bld Spl2      in                        CBSS5688.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGATTGTGGTGGATATTTTCCGTAAGCTTGGTCTACGGCAGTGCCTTGTGACACACAATGGGAGATTGCTTGGCATAATAACAAAGAAAGACGTCCTAAAGCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCAC
  3   1   2       bld TpA  5x3  out                   TTpA032c18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCATATAGCACAGATGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAGTCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1 5g3  in                         CABK3932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGCCAATCAAGATCCGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATT
  3   1   2       bld BrSp      in                     EC2BBA16CH04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGCGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCAC
  5   1   2       bld BrSp      in                     EC2BBA16CH04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGACTCTATATTATTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGCGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3       out                        CAAM7452.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTAACTGAACCGATCACTAAAATAACACAAACTATAGACCCTGTTGAAGCCATATTCAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATTGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAGTCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGATGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATT
  5   1   2       bld Tbd1      in                        CBXT21968.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTGTCATTGTACGGTGCGTGTTGCACCTACATACTGTGAAGAGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTA
  3   1   2       bld Tbd1      in                        CBXT21968.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGTGCCTCGCGTCATGAAGTGGAGTGACTGAAGCTTTGGTGGTCGACTCACAAAAATGAAGTTAAAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA036n10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAAAAAATGCTCTCCTTGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACNTGTGGTTCAGTGGACCACGCCCCTGTGGAGTGGAATANNTACGCATAGCTGNNCAAAGTTGCAAGNNCACATTTTTCTGAAGGAAATTGCCACCCCTTTAATTATAGAGAAGGGGAATAAATTATATATTTAAGTANAAAAAAAAAAAAAAAA
  3  -1   2       chi Kid1      in                         CABA3937.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCATGCATTATTCTGTTCTGCAGAACAGTCTGCTCACTTATGCTGCTGATCCTTCATGCACATGGGAGACTGGTCAGTAAGCCCCTTTGCAATTCAGAATATTATGAAAGAAAACTGACTCTAAATTATGCCCCATGTATCACATATGCCACAGAGATTTGAGAGTCATAGCGAGGTAAGAATTACAAGACCAATATTATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTA
  5  -1   2       chi Kid1      in                         CABA3937.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCATGCATTATTCTGTTCTGCAGAACAGTCTGCTCACTTATGCTGCTGATCCTTCATGCACATGGGAGACTGGTCAGTAAGCCCCTTTGCAATTCAGAATATTATGAAAGAAAACTGACTCTAAATTATGCCCCATGTATCACATATGCCACAGAGATTTGAGAGTCATAGCGAGGTAAGAATTACAAGACCAATATTATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTT
  3   1   2       bld Spl2      in                        CBSS5688.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCAGGTCACTTCAAAGATGGCTGCCACCATCGTTCCTTTTGCCACAGCCAATTTGGCGCATTTATGTGTCCTTTCAACTGTGGTTCAGTGGACACGCCTGTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAGTCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTCACT
  3   1   2       bld HdA       in                   THdA029h07.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGAGTGGAATATACGCATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCCCCTTGTATTGTCAATATTATATTTATCACATTTAAGACGCATGATTTTGAGATAAAGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAGTCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTTTTTAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGANTATTATAAGTCACTAAGGAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld HdA       in                   THdA029h09.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATAGCTGCAAAGTTGCAAGCACATTTCTGAAGGAAATTGCACCTTTAATTATAGAGAAGAATAAATTATATATTTAAGTACACACATTTCCTGTCTTAAAAGGTCAGCGATTGGTGGTGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTTTAACTTGAAAAAAGCAGTTATGGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCACATACACTAATCAATAGTGTGCCCCCCTTGTATTGTCAATATTATATCTATCACATTTAAGACGCATGATTTTGAGATAATGTGTGGGTATGTGTGTATATATATTTCATGGCTAGAGAACATATTTATCCCTTTGGGGATTTTTTTTAGTTAGAGATTCAGTTGGCAGTCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTTTTTTTAAAAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTCACTAAGGAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld BrSp                            EC0CBA003DB05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTACGGTATAGTCAAAGCGTAAGCGTTTACAGAGTTTATCATGGGCCTGGAAATAAATGACACGTTTCAATACACACACTCATTTCTAACTTGAAAAAAGCAGTTATTGTGATAACAGAAATAATGAAATTTAATACTTTATGTTGGGGATTTACTAAGTACAGAAAATTTGCCCATACACTAATCAATAGTGTGCCCACCTTGTATTGTTAATATTATATCTATCACGTTTAAGACGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTCACTAAGGACATTCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                  XZT8397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATTTGCACATACACTAGTCAATAGTGTGCCCACCTTGTATTGTCAATATTATATCTATCACATTTAAGATGCATGATTCTGAGATAATGTGTGTGTATGTGTGTATATATATCTCATGGCTAGAGAACATATTTATCCCTTTGGCGATTTTTTTTAGTTAGAGATTCAGTTGGCAATCCTTACCACTGACCTACATAGAATACTGTACAAAAATCTCTATTTAAAAAAAAAAAAAAAAAGACAACATTTGGTTATTATTTTATATAGGATAATGTCCCTCATGCTGTAATTTATAAAGATATTATAAGTCACTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)