Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012154265 Xt7.1-CAAQ8861.3.5 - 25 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAQ8861.3.5                                     AAAATAATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGCAGGAAACGTTATTCATGCCATGCTACTCTATCGCCGAAAGCTGGAAAGGGGCTTGATACCTCCAGTTATGGCTCTTGGCATTGTTCCTATGTGCTCTAATCAGATGGTGAGGATGTTTAACACAACAAGAGTTCCAGGAGTGGAAACTGACTGCCTTCAGCACTTGGTTGAAAGTCGCCATGTCTGTGTATATCACAAAGGACGGTATTATAGGTTAGCCCTGTATGAGAATGGAAACCTCCTCACTCCCCGCCAGCTCCAGGCACAGATTCAGTACATCCTGGATGACTCCAGTCCCCCTCAGCCTGGGGAGGAGAAGTTGGCAGCTCTAACTGCAGGGAACAGGGTCCATTGGGCTCAGGCTCGCACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACT
                                                  Xt7.1-CHK-1008265068                                           ATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGCAGGAAACGTTATTCATGCCATGCTACTCTATCGCCGAAAGCTGGAAAGGGGCTTGATACCTCCAGTTATGGCTCTTGGCATTGTTCCTATGTGCTCTAATCAGATGGTGAGGATGTTTAACACAACAAGAGTTCCAGGAGTGGAAACTGACTGCCTTCAGCACTTGGTTGAAAGTCGCCATGTCTGTGTATATCACAAAGGACGGTATTATAGGTTAGCCCTGTATGAGAATGGAAACCTCCTCACTCCCCGCCAGCTCCAGGCACAGATTCAGTACATCCTGGATGACTCCAGTCCCCCTCAGCCTGGGGAGGAGAAGTTGGCAGCTCTAACTGCAGGGAACAGGGTCCATTGGGCTCAGGCTCGCACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAA
                                                      consensus depths                                          2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     2     2     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     5     5     6     6     6     6     6     7     6     7     7     7     7     7     7     7     7     7     7     7     9    10     9    10     9    10     9    10    12    12    12    12    12    12    12    13    12    13    12    13    14    15    14    15    14    15    15    16    15    16    15    16    15    16    16    16    16    16    16    17    16    17    16    17    16    17    16    16    16    16    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    11    12    12    12
  5   1   2      ests                                 Xt7.1-CABI6156.5                                     AAAATAATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGCAGGAAA
  5   1   2      ests                                 Xt7.1-CAAQ8861.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACT
                                               BLH ATG      19     482                                     
                                               BLH MIN      13     304                                     
                                               BLH OVR      19     187                                     
                                               ORF LNG      19      41                                     
                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 8e-055     NP_013670.1 Carnitine O-acetyltransferase, peroxisomal and mitochondrial; Cat2p[Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ci ---- 3e-067     BAB85859.1 choline acetyltransferase [Ciona intestinalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PREDICTED = Sp ==== 3e-116     XP_782556.1 PREDICTED: similar to carnitine palmitoyltransferase 1A, partial [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN === Ce ==== 0          NP_496721.2 Y46G5A.17 [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN === Dm ==== 0          NP_724940.1 CG12891-PB, isoform B [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                 PREDICTED - Dr ---- 0          XP_688483.1 PREDICTED: similar to Carnitine O-palmitoyltransferase I, mitochondrial liver isoform (CPT I) (CPTI-L) (Carnitine palmitoyltransferase 1A) [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN === Gg ==== 0          NP_001012916.1 carnitine palmitoyltransferase I [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN === Mm ==== 0          NP_034078.1 carnitine palmitoyltransferase 1b, muscle [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN === Hs ==== 0          NP_004368.1 carnitine palmitoyltransferase 1B isoform a [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN === Xl ==== 0          AAH86271.1 LOC495682 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PREDICTED = ?? ==== 0          NP_001088630.1 hypothetical protein LOC495682 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PREDICTED = Xt ==== 0          AAI25803.1 Hypothetical protein MGC147544 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAQ8861.3.5                                         TAA------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------ATG------ATG---------------ATG---------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------ATG---------------------------------------------ATG------------------ATG------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TGA------------------------TGA---------------------------------------------------------------------TAA------------------------------------------------------ATG---------------------------------------TAA------------------------------------------------ATG---------------------ATG---------ATG---------------------TAA
                                                                   ORF                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Ovi1 FL                          CABI6156.FL-MGC GTTAGTGTTTCATTCTGAAGATATCTGAAAAAGTGCAAAATAATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGCAGGAAACGTTATTCATGCCATGCTACTCTATCGCCGAAAGCTGGAAAGGGGCTTGATACCTCCAGTTATGGCTCTTGGCATTGTTCCTATGTGCTCTAATCAGATGGTGAGGATGTTTAACACAACAAGAGTTCCAGGAGTGGAAACTGACTGCCTTCAGCACTTGGTTGAAAGTCGCCATGTCTGTGTATATCACAAAGGACGGTATTATAGGTTAGCCCTGTATGAGAATGGAAACCTCCTCACTCCCCGCCAGCTCCAGGCACAGATTCAGTACATCCTGGATGACTCCAGTCCCCCTCAGCCTGGGGAGGAGAAGTTGGCAGCTCTAACTGCAGGGAACAGGGTCCATTGGGCTCAGGCTCGCACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                                 Xt7.1-CABI6156.5                                     AAAATAATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGCAGGAAA
                                                  Xt7.1-CHK-1008242975                                           ATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGC
  5   1   2      seed Ovi1 FL                              CABI6156.5p   TAGTGTTTCATTCTGAAGATATCTGAAAAAGTGCAAAATAATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGCAGGAAACG
  5   1   2       bld Hrt1 PIPE in                         CAAQ9805.5p                         TTTCATTCTGAAGATATCTGAAAAAGTGCAAAATAATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGNGCTTTAAATTATGTCAGTGATTG
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ5322.5p ...........................AAAAAGTGCAAAATAATCAGGTCTGAAGATGGCAGAAGCCCATCAGGCTGTTGCCTTTCAGTTCACTGTGACACCAGATGGCATTGATTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTG
  5   1   2       bld Bone      in                        CBTC4350.fwd                                                                                                                   TTTACAGCTAAGCCATGAAGCACTACGACATCTCTGGCTGTCTGGGTTGGTTGCCTGTAGGAAACGCCTCATCACACTTAAGAGCTCTGTGCTGAGTGGAGTGTACCCAGCTAGCCCTTCTACATGGTTTGCTGTGGTGGCTATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCTCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCT
  5   1   2       bld Hrt1      in                         CAAQ6996.5p                                                                                                                                                                                                                                                                TATGACTCTTGGTTCATTATATGGCAAGTTGGATCCATCTCTAGGACTTATCACTAAGATCAACAGCATTCTCCCAGGAAAGTCAATTTTAGCACCAGTTTCCCGCACAGTCCTCAGTGCTGTGATCTTTTCCTCTGGTGTCTGGGTATCTGGAATCCTGATCTACCGTCAGACTCTTCGTATACTTTTATCTTATCATGGATGGATGTTTGAACCACATAAGAAAACAAGTATGAAAACCAAAATCTGGGCGGGTTGTATGAAGATAATGTCCAGCCGTCAACCAATGCTCTACAGCTTTCAGATGTCCCTTCCAAAGTTGCCTGTTCCCCCACTGGAGGATACAATAGAGAGGTATCTGCAGTCGGTGCGTCCTTTACTGGACGATGACAAATTCAGTGAAATGAAGATCCTGGCTGAGGAATTCCAGAAAGATCTGGGGCGGAAGTTACAAAAATACTTGCACCTTAAGTCCTGGTGGGCTTTAAATTATGTCAGTGATTGGTGGGAAGAATACATATACTTGAGAGGTCGAGGACCAATAATGGTGAACAGCAACTATTATGCAATGGATTATTTATACGTGACCCCATCCACAAATCAAGCTGCCCGGGCAGGAAACGTTATTCATGCCATGCTACTCTATCGCCGAAAGCTGGAAAGGGGCTTGATACCTCCAGTTATGGCTCTTGGCATTGTTCCTATGTGCTCTAATCAGATGGTGAGGATGTTTAACACAACAAGAGTTCCAGGAGTGGAAACTGACTGCCTTCAGCACTTGGTTGAAAGTCGCCATGTCTGTGTATATCACAAAGGACGGTATTATAGGTTAGCCCTGTATGAGAATGGAAAACTCTTCAC
  5   1   2      ests                                 Xt7.1-CAAQ8861.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACT
                                                  Xt7.1-CHK-1008230640                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAA
  5   1   2       bld Hrt1      in                         CAAQ4640.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGCTGGAAAGGGGCTTGATACCTCCAGTTATGGCTCTTGGCATTGTTCCTATGTGCTCTAATCAGATGGTGAGGATGTTTAACACAACAAGAGTTCCAGGAGTGGAAACTGACTGCCTTCAGCACTTGGTTGAAAGTCGCCATGTCTGTGTATATCACAAAGGACGGTATTATAGGTTAGCCCTGTATGAGAATGGAAACCTCCTCACTCCCCGCCAGCTCCAGGCACAGATTCAGTACATCCTGGATGACTCCAGTCCCCCTCAGCCTGGGGAGGAGAAGTTGGCAGCTCTAACTGCAGGGAACAGGGTCCATTGGGCTCAGGCTCGCACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGNGACATTCCTCNCAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTGGGAA
  5   1   2       bld Int1      in                         CAAP2037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTC
  5   1   2       bld Int1      in                         CAAP2229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAAACTTCTTCAGTAATGGAATAAACAGAACAGCTCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAGAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGG
  5   1   2       bld Ski1      in                         CABJ3160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGATTCAATTCGGCACGAGGCTGAGTTGTGTGGAACGTGCAGTATTCTTTATCAGTCTTGATGAGGAGGAAGCTGGGTATAATGAAGAAGACAAGTCCTCTTTAAGTGCTTATTCCAAGGCCTTGTTACATGGAAACTGTTACAACAGGTGGTTTGATAAGTCATTTAGTTTGGTTGTGTTCCGTAATGGAAAGTTGGGTCTCAATGCCGAGCATTCTTGGGCAGATGCACCAATCATTGGACATCTGTGGGAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGNGACTGACTCCGCTTTCCTCCAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGT
  5   1   2       bld Hrt1      in                         CAAQ8861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAAATGTTGTTACATATATAATAAGCCATATGCTTGTAACAGTATAAGGCACACATGAATTAGCTGCATTGAGTTTATTAAAGAAAAAATGCATACATTCCTCTATTCTTTATTTTTATTAAGATTTCTTCTGTATTCACAGTTTCTCTGCTTGTTTCTTCTCTTTTAATCCTTAGTTCACACTGGCAACAGACTGCTTTGAACTGGGTTATACAGAGGATGGCAACTGCCGTGGGGATGCTGGGTCCCCTCTTCCCCCTCCTTACAGACTGCAATGGGACATTCCTCCAAAGTGCCGTGAGGTCATTGAACGCTCTTATGTCACAGCTAAGGCAATAGCAGACGATGTGGATTTCCACTGCCTCTGTTTCAGTGATTTTGGAAAAGGATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGNGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCNAACTCCACAGCAACAGTTAAAATTATTTGACTTGNACAAGTTCCCCGACCACGTGTCTGCA
  5   1   2       bld Tad5                                 XZT26728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTAATCAAAAAATGCAGGAGCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGANATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCA
  5   1   2       bld Bone      in                        CBTC9983.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGCCCGGATGCCTTCTTTCAGATTGCACTACAGCTGGCACATTACCGGGAGAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGC
  3   1   2       bld Hrt1      in                         CAAQ8861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGCACTACAGCTGGCACATTACNGGGAGAAAGGGCCATTTCTGCCTGACCTATGAGGCATCCATGACTCGACTGTTCCGTGATGTTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAA
  3   1   2      seed Int1      in                         CAAP2037.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCC
  3   1   2       bld Hrt1 5g3  in                         CAAQ5322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCGTGATGGTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAAAA
  3   1   2       bld Ski1      in                         CABJ3160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGATGTTCGGACAGAGACAGTGAGATCTTGCACCACTCAGACCTCTGATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ6996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCC
  3   1   2       bld Hrt1 PIPE in                         CAAQ9805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATTTTGTGAAAGCCATGGAAGACCCTACACAAAGTCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACGCTTCCTGTATTAAACTTCCTAGACTCCC
  3   1   2       bld Int1      in                         CAAP2229.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAAGAAAAGCGCCTGGCTCTCTATCGTGCTGCTGCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCCTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCC
  3   1   2       bld Bone      in                        CBTC4350.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAAT
  5   1   2       bld Tad5                                  XZT8709.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCACCACCAATTGATGTATCGCTGGGCAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTTCTGTAATTCTCTTACTGTAATTACACTTCCCTGTATAAACTTCCTAGACTCC
  3   1   2       bld Bone      in                        CBTC9983.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATGACAGGAAAGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTAT
  3   1   2       bld Hrt1      in                         CAAQ4640.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGAATTGATCGTCATCTATTTTGTCTGTATATTGTGTCTAAGTACCTTGGGACTGACTCCGCTTTCCTCCAAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCCGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCC
  3   1   2       bld Sto1      in                        CABG12591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCC
  5   1   2       bld Sto1      in                        CABG12591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGGTACTCTCCGAGCCCTGGCGTCTCTCTACTTCTCAAACTCCACAGCAACAGTTAAAATTATTTGACTTGGACAAGTTCCCCGACCACGTGTCTGCAGGAGGGGGATTCGGACCGGTTGCTGATGATGGTTATGGTGTTTCCTACATTTTTGCCGGTGAAAATTTAATCACTTTGCACATTTCCAGCAAGTTCTCCAGCCCTGAGACGAATTCTCACCGTTTTGGACAGCGAATCTGTCAGTCTATGCGAGATCTGGCTCAGCTGCTCAGTCCCCCGGTCACAGTGAGGCCATGAAATGACTTGTTACTTCTGCTCACTTGAAGAAAGCTACAATGGTTATATACACTGCTAACATGTACATTTGATGACTGCTGTGTATCCAAATTATACTAAAGCAGGGCAGTTAATGAGTATGTTATTTTTTTTACAGTGCCTTCACTAAAATGGATGTTATTGATTGTAATCACATTGTGTCACCCAAGTATCACATAACTTACCAGCACACTCCATGCAACCTTACAAGAGAGGGCAACTGCTCTTATGGTCACAATATATATATGTGCAATGCTGTTTTATATGTGGAGCATCATTCTCTTCCTGTAATTCTCTTACTGTAATTACACTTCCTGTATTAAACTTCCTAGACTCCCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)