Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 40%

 1012154358 Xt7.1-CABC6628.3.5 - 34 ESTs
                                                                       ....-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABC6628.3.5                                                                                                                                                                                                                                                               ATATGACCCTAGTTTTAAGGGTCCCATTAAGAAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACTCTTCCAAACCAATCTCTTTAACCTGCAAATTTATAATGTAATCGGTTTCCTGTGGTGCATTAATTTTGTCATTGCTCTGGGACAGTGCGTCCTGGCTGGGACCTTTGCATCTTATTACTGGGCTTTCCACAAACCCAAAGATATCCCATTTTTCCCAGTGGCTGAATCCTTCATGCGTACCCTGCGGTATCATACTGGCTCTTTGGCATTTGGCGCTCTCATCCTCACCATTGTTCAGCTAATCCGAATAATACTGGAATACCTGGACCATAAACTTAAAGGGGCCCAGAATCCTTGTACACGTTTCCTACTTTGCTGCCTGAAATGCTGCTTCTGGTGCTTGGAAAAATTCATCAAATTCCTAAATCGCAATGCATATATTATGATTGCTGTTTATGGGAAAAATTTCTGCGTTTCTGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGATTCCAATTCCAAATCCTGCATTTCAGTCCCCAGCGTTAAACTATTACTGGATTCCTATTCTTACAGTGGTTATTGGGTCATACATGATTTCTCATGGTTTCTTTAGCGTTTACAACATGTGTGTGGACACCCTGTTCCTATGTTTCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGTAAAAAAAAA
                                                  Xt7.1-CHK-1008265999                                                                                                                                                                                                                                                                     CCCTAGTTTTAAGGGTCCCATTAAGAAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACTCTTCCAAACCAATCTCTTTAACCTGCAAATTTATAATGTAATCGGTTTCCTGTGGTGCATTAATTTTGTCATTGCTCTGGGACAGTGCGTCCTGGCTGGGACCTTTGCATCTTATTACTGGGCTTTCCACAAACCCAAAGATATCCCATTTTTCCCAGTGGCTGAATCCTTCATGCGTACCCTGCGGTATCATACTGGCTCTTTGGCATTTGGCGCTCTCATCCTCACCATTGTTCAGCTAATCCGAATAATACTGGAATACCTGGACCATAAACTTAAAGGGGCCCAGAATCCTTGTACACGTTTCCTACTTTGCTGCCTGAAATGCTGCTTCTGGTGCTTGGAAAAATTCATCAAATTCCTAAATCGCAATGCATATATTATGATTGCTGTTTATGGGAAAAATTTCTGCGTTTCTGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGATTCCAATTCCAAATCCTGCATTTCAGTCCCCAGCGTTAAACTATTACTGGATTCCTATTCTTACAGTGGTTATTGGGTCATACATGATTTCTCATGGTTTCTTTAGCGTTTACAACATGTGTGTGGACACCCTGTTCCTATGTTTCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGTAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                    2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     7     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     3     3     1     1     2     2     1     1     2     2     1     1     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     4     4     5     3     5     3     5     4     6     4     6     4     7     4     7     4     7     6     8     7     8     7     8     7     9     8    10    10    11    11    12    11    12    12    13    13    14    13    14    13    14    13    14    15    16    15    16    16    16    17    17    17    17    17    17    17    17    17    17    16    17    17    17    17    17    17    17    15    16    15    15    14    15    14    15    15    15    15    15    14    15    14    16    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    16    17    17    18    17    18    17    18    17    17    16    17    16    16    15    16    16    16    17    17    15    16    16    16    16    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    15    16    14    15    14    14    14    14    14    14    14    14    14    14    14    14    13    14    12    13    12    13    11    13    10    11     7     7     2     2
  5   1   2      ests                                 Xt7.1-CABC6628.5                                                                                                                                                                                                                                                               ATATGACCCTAGTTTTAAGGGTCCCATTAAGAAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACT
  5   1   2      ests                                 Xt7.1-CABC6628.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTTTCTGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGATTCCAATTCCAAATCCTGCATTTCAGTCCCCAGCGTTAAACTATTACTGGATTCCTATTCTTACAGTGGTTATTGGGTCATACATGATTTCTCATGGTTTCTTTAGCGTTTACAACATGTGTGTGGACACCCTGTTCCTATGTTTCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGTAAAAAAAAAAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               C-----------
                                               BLH ATG     -32      62                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sc ---- 4e-012     NP_014804.1 Hypothetical ORF; Yor161cp [Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 7e-108     NP_651670.1 CG11880-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PROTEIN --- Ce ---- 1e-138     NP_741790.2 choline transporter-like protein 2 (XF974) [Caenorhabditis elegans] ---------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED - Sp ---- 2e-150     XP_785086.2 PREDICTED: similar to Solute carrier family 44, member 4 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PREDICTED - Gg ---- 0          XP_426673.2 PREDICTED: similar to MGC78933 protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PREDICTED - Mm ---- 0          NP_076046.1 RIKEN cDNA 2210409B01 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 0          NP_116183.1 NG22 protein; choline transporter-like protein 4 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 0          NP_956707.1 hypothetical protein MGC64108 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- Xl ---- 0          AAH73678.1 MGC83045 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PROTEIN --- ?? ---- 0          NP_001086000.1 MGC83045 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABC6628.3.5                                                                                                                                                                                                                               ATG---------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------TAA------------------------ATG---------------------------ATG---TGAATG---------------ATG---------------------TAG---------------------------TGA------------------ATGTAA---------TAAATGTAA------------------------ATG------------ATG------------------------TAG------------------------------ATG---------------------------------------------------------------------------------------------TGA---------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAG------------------TAG---------------------------------------------------------------------TAA---------------------------------TGA---------------------------------------------TAA---------------TAG---------------------------------------------TAA---------------------TAATAA---------------TAATAA------------TAA
                                                                   ORF                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2      ests                                 Xt7.1-CABC6628.5                                                                                                                                                                                                                                                               ATATGACCCTAGTTTTAAGGGTCCCATTAAGAAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACT
                                                  Xt7.1-CHK-1008235925                                                                                                                                                                                                                                                                     CCCTAGTTTTAAGGGTCCCATTAAGAAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGA
  5   1   2       bld Egg  5g                        TEgg142e16.p1kSP6                                                                                                                                       TTGGGTGCTGAGTTGCGGCCAGTTTATGCGTAACCTGCCAGTTCAGTCACTGGTATAGCGGTGAGAGCCAGTGGCGAAAAAGGAAAGGATGGCATCCGATGAGTATGGTGAGCCTGCAAAATATGACCCTAGTTTTAAGGGTCCCATTAAGAAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAACTTCATTCTTT
  5   1   2       bld Spl1      in                        CABK10354.5p                                                                                                                                                                                                                                                   ATCGATTCGCAAATATGACCCTAGTTTTAAGGGTCCCATTAAGAAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAAGCAGGNGAAACAGTTGCAAATGTGGGTTTCACTTTTACCTTGGC
  5   1   2       bld Int1      in                        CAAP14097.5p                                                                                                                                                                                                                                                                                              AAACGGAGCTGCACTGATATAATCTGCTGTGTTCTCTTCATGGTATTTTTACTTGGCTACATGGTAGTGGGAATCCTAGCTTGGTTATATGGTGACCCTCGCCAGGTTATATACCCACGCAATTCTACAGGAATGTACTGTGGAATTGGGGAAAATCAGGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAA
  5   1   2       bld Te4       in                         CAAN6132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGAAAACCCAATGTGCTGTATTATGACCTGCTGAAATGCATCACCGGCACAAACATCCTGGCTGCAGCAATGAATGGCTTGCAGTGTCCCACCACACAGGTCTGTGTTGCTAATTGTCCTGCAGACTTTAAATGGGCAAAGCCTGGAAGCACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGNCAAGCAATTGGGCACATAATGTCCTCTCTCTTCTA
  5   1   2       add Neu       in                   TNeu116k06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAGACACTGGAATAATAGGAAGGTGTTCATAAATGTGTAGGGCTATTCCTACAGAAGCCATCCATTTAGTTGAATGGTCTGATACTCTGGAGcagtgatccccaatcagtggcttgtgagcaacatattgcttccccaaccccttggatgttactctcagtgcccccaataactggcaagttttggttaaataaaaacaagatttacttccagattcctagtgtgcatagaggctgcctaataaccaatcttagcccttatttggcacctccatgaacttgtatgatgcttgtgttgctctccaagtctttttacatttgactgtggctcacaagtaagaaatattggggccccctgCCCTAGAGGATGAACCAATTTATGGTCACCTTTACTCTCATTCTATCACCTACATAGGAGTTTGTGAATTTCTCTCATTGCAGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTAC
  5   1   2       bld Brn3      in                         CAAK7880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTCCAGCTGATGTATATCTCCAGGAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGNGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTC
  5   1   2      seed Fat1      in                         CABC6628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATATTGCCAGCCGAGTATTAATCTGACCAACACAGCACTTACTGTGGCAGAAATTGCAGCTAGGGAGCTGTGTCCTGTGTTCCTTGTTCCTTCAGCTTCATTCTTTAACAGGTGTTTCCCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGNGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACT
  5   1   2       bld HdA                            THdA012c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGGTTCTAATCTCAGCTTTCCTTCTAATTTCGCCATTAATGGCTTATCCGTGAATCAGTCAAAAGACAGCATCAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCAATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTCACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATCGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACTCT
  5   1   2       bld Neu                            TNeu031g05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGTAAAGCTGCTGGTCAAATTTTAGATTCCTTCATTTCCAGAATGTTGGGAAAAAAATATTTGAAGATTTTGCCAAATCTTGGCCCTGGATTATCACAGCACTGGTTATTGCAATGGTGGTCAGCCTTCTCTTCCTGATCCTGCTGCGTTTCACAGCTGGAATCCTGGTCTGGGTGCTTATCGTCGGTGTCATTGGGGTTATTGGATATGGGATATACCATTGCTACATGGAGTATGATACTCTGAACAAGCAAGGGGAAACAGTTGCAAATGTGGGTTTTACTTTTAACCTTGGCGTTTACTTCAGAGTGAAAGAAACCTGGCTGGCGATATTAATTGTCCTGGCTGTGATTGAAGCAATCCTTCTGTTAGTCTTGCTTTTCTTACGGAAGAGGATCCTCATAGCCATTGCACTGATTAAGGAAGCCAGCAAAGCAATTGGGCACATAATGTCCTCTCTCTTCTATCCTCTTGTCACATTTGTGCTGCTCATTGTCTGTGTAGCGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTAC
  5   1   2       bld Tad0      in                     NISC_no11g01.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACTCTTCCAAACCAATCTCTTTAACCTGCAAATTTATAATGTAATCGGTTTCCTGTGGTGCATTAATTTTGTCATTGCTCTGGGACAGTGCGTCC
  5   1   2      ests                                 Xt7.1-CABC6628.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGTTTCTGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGATTCCAATTCCAAATCCTGCATTTCAGTCCCCAGCGTTAAACTATTACTGGATTCCTATTCTTACAGTGGTTATTGGGTCATACATGATTTCTCATGGTTTCTTTAGCGTTTACAACATGTGTGTGGACACCCTGTTCCTATGTTTCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008229365                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGATTCCAATTCCAAATCCTGCATTTCAGTCCCCAGCGTTAAACTATTACTGGATTCCTATTCTTACAGTGGTTATTGGGTCATACATGATTTCTCATGGTTTCTTTAGCGTTTACAACATGTGTGTGGACACCCTGTTCCTATGTTTCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Fat1      in                          CABC966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGTACTGGGGAATGACCGCACTATACCTCGCTACCTCTGGGGCTCCATTATATCGAATCTCAACAGTAAACACAAGTGTCCCAGGATGTGAAAATATTACAGGAAATGAAACTTGTAATCCCATGACATTTTCAAATGCCAGCACTTCTTGCAAAGAAGCTCGCTGTATTTTCTACAGATACAATAACGAAGGACTCTTCCAAACCAATCTCTTTAACCTGCAAATTTATAATGTAATCGGTTTCCTGTGGTGCATTAATTTTGTCATTGCTCTGGGACAGTGCGTCCTGGCTGGGACCTTTGCATCTTATTACTGGGCTTTCCACAAACCCAAAGATATCCCATTTTTCCCAGTGGCTGAATCCTTCATGCGTACCCTGCGGTATCATACTGGCTCTTTGGCATTTGGCGCTCTCATCCTCACCATTGTTCAGCTAATCCGAATAATACTGGAATACCTGGACCATAAACTTAAAGGGGCCCAGAATCCTTGTACACGTTTCCTACTTTGCTGCCTGAAATGCTGCTTCTGGTGCTTGGAAAAATTCATCAAATTCCTAAATCGCAATGCATATATTATGATTGCTGTTTATGGGAAAAATTTCTGCGTTTCTGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGA
  5   1   0       add TbA       in                   TTbA035l14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATCCCATGACATATTCAAATGCCATCACTTCTTGCTGAGAAGCTCGTTGTATTTATTACAGATACGATAACGAAAGACACTTCCAAACCAATCTCTTTAACCTGCAAATTTATAATGTAATCGGTTTCCTGTGGTGCATTAATTATGTCATTGCTCTGGGACAGTACCTCCTGGCTGGGACCTTTGCATCATATTACTGGGCTTTCCACAAACCCCAAGATATCCCATTTTTCCCAGTGGCTGAATCCTTCATGCTATACCCTGCGGTATCATACTGACTCATTCGCATTTGGCGCACTCATCCTCGCCATTGTTCATCTAATCCCAATAACACTGGAATACCTGGACTATAAACTTAAAGGGGCCCAGAATCCTATGTACACGTTTCCTACTTTGCTGCCTGAAATGCTGCTTCTGGTGCTTGAAAAAATTCATCAAATTCCTAAATCGCAATGCATATATTATGATTGCTGTTTAAGGGAAAAATTTCTGCGTTTCTGCTAAAAATGCTTT
  5   1   2       bld Gas8      in                         st108o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTCTGCGTTTCTGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGATTCCAATTCCAAATCCTGCATTTCAGTCCCCAGCGTTAAACTATTACTGGATTCCTATTCTTACAGTGGTTATTGGGTCATACATGATTTCTCATGGTTTCTTTAGCGTTTACAACATGTGTGTGGACACCCTGTTCCTATGTTTCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATAACTTC
  3   1   2       bld Gas8      out                         st42b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGCTAAAAATGCTTTTAAGCTTCTAATGCGAAACATTGTAAGGGTGGTTGTCCTGGATAAAGTCACTGATTTGCTCATATTCTTTGGGAAGCTTATCGTTGTTGGAGGAGTAGGTGTATTGGCATTCTTCTTTTTCTCTGGCCGGATTCCAATTCCAAATCCTGCATTTCAGTCCCCAGCGTTAAACTATTACTGGATTCCTATTCTTACAGTGGTTATTGGGTCATACATGATTTCTCATGGTTTCTTTAGCGTTTACAACATGTGTGTGGACACCCTGTTCCTATGTTTCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATAACTCCAATA
  5   1   2       bld Egg                            TEgg101b19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTTGGAAGATTTAGAGCGTAATGATGGGTCACCAGAGAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCGTGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCT
  5   1   2       bld Neu                            TNeu027d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCGGGTTGATGGGTCACCAGTATAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGGAGAAGACAATAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTG
  5   1   2       bld Neu                            TNeu006i15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCGGGNTGATGGGTCACCAGNANAAGCCATATTACATGTCAAAATCCCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAATAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTG
  5   1   2       bld Tbd1                                 CBXT1624.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTCATGTCTATTTTAAACAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACC
  5   1   2       bld Tbd1      in                        CBXT12483.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAAAAATCGCCCACCCAAGTCTGAGGAGAAGACAAAGAAAAAGTAACCTTCGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGGAGGAGTTTCTTATAGC
  3   1   2       bld Neu       in                    TNeu116k06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACAAAGAAAAAGTAACCTTGTTACCTCCATTATCATTTCATGATTATTTCCGTTCCTAATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCNTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCCGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATAGCTTGAAATAATAAATCAACCTGAATGCTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                         CABC6628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCATTTCATGATTATTCCGTCCCTATGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATT
  3   1   2       bld Int1      in                        CAAP14097.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTAAGAAAGAGAAATGTCCTGAATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTAAAAAAAA
  3   1   2       bld Spl1      in                        CABK10354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATGTCCTGAATGGACTTCATNTTCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCCGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGT
  3   1   2       bld Te4       in                         CAAN6132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGACTTCATTTCCTGGATGTCTGTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGTATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTT
  3   1   2       bld TbA       in                    TTbA035l14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGTTTGCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATTTACAGTGCCGGCTGTGAAGGACATGACATGTAGCTGCTCACAATGCCTTTATAGTTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTTTTATAGCCATAAATATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATATGCTATTTTGTATCTGATAATATTCACTATCATACTTGAAATAATAAATCAACTTGAATGGTTAATAAAGGTATTATTATTAAA
  3   1   2      seed Brn3      in                         CAAK7880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGTCTGCATATAGATTTCAGTACTTGTCACCAGTGCCAGGTGACCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGT
  3   1   2       bld Tbd1      in                        CBXT12483.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAAAAAAAAAAAAA
  3   1   2       bld Fat1      in                          CABC966.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTGGTTTACAATTTATGTAAACTTCCCTCTAAATGTAAAAAACCTCACGCAGTGCGAGAGAGATGGATACACTTTTTATGACCTCATTTCCTGTGAGAAAGCATTAGGGTAGGCAATATGAATTCTACTATCCTGCTATGCTATACAGAATATTAACTTCCAATAGAGTATTTAAAGAGGATGACAATAATTTATTACAGAATCATTTAAAGAAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTG
  3   1   2       bld Gas8      in                         st108o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAAAACCTCNCGCAGTGCGAGAGAGAGGGATACNCTTTTTATGACCNCATTTCCTGTGNGAAAGCANTAGGGTAGGCNATATGAATTCTACTATCCTGNTATGCTATACAGAATATTAACTTCCAATAGNGTATTTAAAGNGGNTGACNATAATTTATTNCNGAATCNTTTAAAGNAAAAAAAAAATTCTTTGTATTGATTTCCCAACAGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCCGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATCAC
  3   1   2       bld Tad5      in                         XZT48502.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCCGAAGGAATTTGTGATACTGGGATAATGGAACAAGATCTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAGCCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGT
  3   1   2       bld Tad0      in                     NISC_no11g01.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGTAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Tad5      in                         XZT48502.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCATTTTGTGCCTTGGAGATTTTTAACGTAATTGTTTTTTTTATCTCTATTCTGTTACACTTCCTTTAGTTTTTACAGTTATCACTTTCATTTTCTTCCTGTGGAATATTATCTGGTTTCCATAGAACCATTTAACCACTTTCTTGCCACAGAATGTAGAATCTACAGTGCCGGCTGTGAAGGACCTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTAAAAATTAAGCCAGTGGATTTAACCCTTCCTTATGATCCGAAGGAATTTGTGATACTGGGATAATGGAACAAGATCTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAGCCTGAATGCTTAATAAAGGTCTTATTATTAAAGTGTAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld HeRe      out                    EC2CAA27DE08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAATATTATCTGGTTTCCATAGAACCATTTAACCACTTCCTTGCCACAGAATGTAGAATGTACAGTGCCGGTTGTGAAGGACTTGACATGTAGCTGCTCACACTGCCTTTCTAGCTCACCTTTAAAATTAAGCCAGTGGATTTAACCCTTCTTTATGATCCGAAGGAATCTGTGATAGTGGGATAATGGAACAACATCTGTCAGCATGAAAAGGCATCAAGAAAAATAGCCAAATATGGAGGAGTTTGTTATAGCCAT
  5   1   2       bld TbA                            TTbA005a11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCACACTGCCTTTCTAGCTCACCTTAAATATTAAGCCAGTGGATTTAACCCTTCCTTATGATCTGAAGGAATTTGTGATACTGGGATAATGGAACAACATTTGTCAGCATGAAAAGGCATCTTGAAAAATAGCCAAATATGGAGGAGTTTCTTATAGCCATAACTATGATTAATTGCACTTTAATGTGTAGATATTGTGTACATTTTTATATAGATATCTGCTATTTTGTATCTGCTAATATTCACTTTCATACTTGAAATAATAAATCAACCTGAATGCTTAATAAAGGTCTTATTATT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)