Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Nov 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:6993688.5                       9 END     4          14       50                paired box gene 3 (Waardenburg syndrome 1) [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 176.0    0Xt7.1-CABH11559.5.5                        59 PI      88       1350     1486                (no blast hit)
     3 176.0    0Xt7.1-CABJ7200.5                           27 PI      86       1350     1486                Crbn-prov protein [Xenopus tropicalis]
     4 185.0    0Xt7.1-CABA1698.5                            2 PI      90       1342     1462                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012154378 Xt7.1-THdA023a02.3.5 - 27 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-THdA023a02.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGTTATGGGTCTCCTGACTAACCATGGTGGAGTTCCACATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTGGAGCCTCCCACAGCTGTATCAGCAAGTTGTAGCCAGAGACTGGAACATATGAAGAGCTTGGATAGTCTGTCAACATCACAGTCTTACTGCCCACCAACATACAGCACCTCAGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTTGGAGAATTATTTGACAGAAAATCTTATTACAGAGTTCAAAGTAAACTATGTTTTGCAGAGCGGATTATAAGATGCCCCTTGATATTTTACATTATCATCGACTCAAGAAATTTTGGGAATGACTCAAAACAACAAAAGACGAGGAACTTTTCACATGTTCACAAAAAAGGACTAATTTTGGGAAGATAAAAGTTTAAATGACCAGGAGCAGTTATTTCAGTTTTGTTGCTGAGTAAAGGCTTGTTTGATCTGAACACAAGTTCTGACCTCTACACATAACAACAAAGTACTTTCCTTCATTATTTAGGATCCACTTAAGGAAACTGAATTACAGAATGCAGAGTAATCTGCCAAAAGAAACAGTGAGGAACACACAACACCACATTTTGACTCCAAAATATTGATTCTTTGGCTGTCAATTAACGTGCAATACCATACCTCACTTCTACTTTGTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACAGGCCCAATAAATAGTGACTGTCTATGGCATCTTACAGCAGCCCCTCTGGCATTTGCCAGAGTAAACAGATTGCTAGTCTGGGCCCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACTTGCA
                                                  Xt7.1-CHK-1008265549                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGTCTCCTGACTAACCATGGTGGAGTTCCACATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTGGAGCCTCCCACAGCTGTATCAGCAAGTTGTAGCCAGAGACTGGAACATATGAAGAGCTTGGATAGTCTGTCAACATCACAGTCTTACTGCCCACCAACATACAGCACCTCAGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTTGGAGAATTATTTGACAGAAAATCTTATTACAGAGTTCAAAGTAAACTATGTTTTGCAGAGCGGATTATAAGATGCCCCTTGATATTTTACATTATCATCGACTCAAGAAATTTTGGGAATGACTCAAAACAACAAAAGACGAGGAACTTTTCACATGTTCACAAAAAAGGACTAATTTTGGGAAGATAAAAGTTTAAATGACCAGGAGCAGTTATTTCAGTTTTGTTGCTGAGTAAAGGCTTGTTTGATCTGAACACAAGTTCTGACCTCTACACATAACAACAAAGTACTTTCCTTCATTATTTAGGATCCACTTAAGGAAACTGAATTACAGAATGCAGAGTAATCTGCCAAAAGAAACAGTGAGGAACACACAACACCACATTTTGACTCCAAAATATTGATTCTTTGGCTGTCAATTAACGTGCAATACCATACCTCACTTCTACTTTGTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACAGGCCCAATAAATAGTGACTGTCTATGGCATCTTACAGCAGCCCCTCTGGCATTTGCCAGAGTAAACAGATTGCTAGTCTGGGCCCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     3     4     3     4     3     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     4     5     4     5     4     7     5     8     5     8     6     9     7     9     7     9     7     9     7    10     8    11     9    11    10    14    11    15    12    16    14    17    15    18    15    18    15    18    15    18    15    18    15    18    15    19    15    19    15    20    15    20    15    20    15    20    17    20    18    19    18    19    18    19    18    19    18    19    17    19    18    19    18    19    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    17    19    18    19    17    18    18    18    16    16    16    16    16    16    16    16    16    16    16    16    18    18    18    18    18    18    18    18    17    18    16    17    17    17    17    18    16    18    16    18    16    18    16    18    16    18    16    18    15    18    15    18    15    17    14    17    13    16     5     7
  5   1   2      ests                               Xt7.1-TNeu058i11.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACATCTATACCACTTTCTGTGTCTGATCCAAGCAACACAGGCCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCAGAGAGCAGTTCGGCCTACTGCTTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGGGCCCAGCCATTGGCAACGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGAGTTCCACATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTGGAGCCTCCCACAGCTGTATCAGCAAGTTGTAGCCAGAGACTGGAACATATGAAGAGCTTGGATAGTCTGTCAACATCACAGTCTTACTGCCCACCAACATACAGCACCTCAGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTTGGAGAATTATTTGACAGAAAATCTTATTACAGAGTTCAAAGTAAACTATGTTTTGCAGAGCGGATTATAAGATGCCCCTTGATATTTTACATTATCATCGACTCAAGAAATTTTGGGAATGACTCAAAACAACAAAAGACGAGGAACTTTTCACATGTTCACAAAAAAGGACTAATTTTGGGAAGATAAAAGTTTAAATGACCAGGAGCAGTTATTTCAGTTTTGTTGCTGAGTAAAGGCTTGTTTGATCTGAACACAAGTTCTGACCTCTACACATAACAACAAAGTACTTTCCTTCATTATTTAGGATCCACTTA
  5   1   2      ests                               Xt7.1-THdA023a02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAAAAGAAACAGTGAGGAACACACAACACCACATTTTGACTCCAAAATATTGATTCTTTGGCTGTCAATTAACGTGCAATACCATACCTCACTTCTACTTTGTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACAGGCCCAATAAATAGTGACTGTCTATGGCATCTTACAGCAGCCCCTCTGGCATTTGCCAGAGTAAACAGATTGCTAGTCTGGGCCCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                       ...PROTEIN --- Dr ---- 7e-026     NP_571400.1 paired box gene 7 isoform 1; paired box homeotic gene 7a; paired box homeoticgene 7c; paired box homeotic gene 7d; paired box homeotic gene 7e; paired boxgene 7a [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Mm ---- 2e-045     XP_991742.1 PREDICTED: similar to paired box gene 3 isoform PAX3d [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-046     NP_852123.1 paired box gene 3 isoform PAX3d; paired box homeotic gene 3; paired domain gene3; paired domain gene HuP2; PAX3/FKHR fusion gene [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-046     NP_989600.1 paired box gene 3 (Waardenburg syndrome 1) [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 5e-050     AAV31938.1 paired-box 3 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 5e-050     NP_001088994.1 paired-domain transcription factor Pax3delta isoform [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-050     CAJ82363.1 paired box protein 3 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                  Xt7.1-THdA023a02.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------TAA---------------------------------ATG---------------------------------------------------------------------------------------ATG------------TAG---------------------------TAA---------------------------------------------------------ATG---------------TAA---------------------ATG------------------------------------------------------------------------------------------TAA---------TGA------------------------------------ATG---------------------------------ATG---------------TAA------------------------------------------------------TGA------------------TGA---------------------------------------------------TAG------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------ATG------------TAG------------------------------------------------------------------TGA------------------------------------ATG---TGA---------------------------------------------------------TAAATG---------TAA------TAA------------------TAA---------------------------------TAG------------------------------------------TAA---------------------------------------------------TAA---------TAG------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------TGA------TGA---------------TAG------------------------------------------------------------------TAG------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                             ]
  5   1   2      ests                               Xt7.1-TNeu058i11.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACATCTATACCACTTTCTGTGTCTGATCCAAGCAACACAGGCCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCAGAGAGCAGTTCGGCCTACTGCTTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGGGCCCAGCCATTGGCAACGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGAGTTCCACATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTGGAGCCTCCCACAGCTGTATCAGCAAGTTGTAGCCAGAGACTGGAACATATGAAGAGCTTGGATAGTCTGTCAACATCACAGTCTTACTGCCCACCAACATACAGCACCTCAGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTTGGAGAATTATTTGACAGAAAATCTTATTACAGAGTTCAAAGTAAACTATGTTTTGCAGAGCGGATTATAAGATGCCCCTTGATATTTTACATTATCATCGACTCAAGAAATTTTGGGAATGACTCAAAACAACAAAAGACGAGGAACTTTTCACATGTTCACAAAAAAGGACTAATTTTGGGAAGATAAAAGTTTAAATGACCAGGAGCAGTTATTTCAGTTTTGTTGCTGAGTAAAGGCTTGTTTGATCTGAACACAAGTTCTGACCTCTACACATAACAACAAAGTACTTTCCTTCATTATTTAGGATCCACTTA
                                                  Xt7.1-CHK-1008246098                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTATACCACTTTCTGTGTCTGATCCAAGCAACACAGGCCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCAGAGAGCAGTTCGGCCTACTGCTTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGGGCCCAGCCATTGGCAACGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGAGTTCCACATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTGGAGCCTCCCACAGCTGTATCAGCAAGTTGTAGCCAGAGACTGGAACATATGAAGAGCTTGGATAGTCTGTCAACATCACAGTCTTACTGCCCACCAACATACAGCACCTCAGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTTGGAGAATTATTTGACAGAAAATCTTATTACAGAGTTCAAAGTAAACTATGTTTTGCAGAGCGGATTATAAGATGCCCCTTGATATTTTACATTATCATCGACTCAAGAAATTTTGGGAATGACTCAAAACAACAAAAGACGAGGAACTTTTCACATGTTCACAAAAAAGGACTAATTTTGGGAAGATAAAAGTTTAAATGACCAGGAGCAGTTATTTCAGTTTTGTTGCTGAGTAAAGGCTTGTTTGATCTGAACACAAGTTCTGACCTCTACACATAACAACAAAGTACTTTCCTTCATTATTTAGGATC
  5   1   2       bld Neu       in                   TNeu129k16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACATCTATACCACTTTCTGTGTCTGATCCAAGCAACACAGGCCACAGGCCCCAGCCGCTCCCTCCAAGCAGTGTGCACCAAAGCAGTCTTCCTTCCAACCCAGAGAGCAGTTCGGCCTACTGCTTGCCCAGCGGCCGGCATGGATTTTCCAGCTACACAGACAGCTTTGTGCCCCCATCTGGGCCTTCCAACCCTATGGGCCCAGCCATTGGCAACGGCCTTTCACCTCAGGTTATGGGTCTCCTGACTAACCATGGTGGAGTTCCACATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTGGAGCCTCCCACAGCTGTATCAGCAAGTTGTAGCCAGAGACTGGAACATATGAAGAGCTTGGATAGTCTGTCAACATCACAGTCTTACTGCCCACCAACATACAGCACCTCAGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAG
  5   1   2       bld Neu       in                   TNeu058i11.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTATTTCCTGCAGGTTATGGGTCTCCTGACTAACCATGGTGGAGTTCCACATCAGCCTCAGACGGATTATGCCTTATCTCCTTTAACTGGAGGCCTGGAGCCTCCCACAGCTGTATCAGCAAGTTGTAGCCAGAGACTGGAACATATGAAGAGCTTGGATAGTCTGTCAACATCACAGTCTTACTGCCCACCAACATACAGCACCTCAGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTGGAGAATTATTTGACAGAAAATCTTATTAC
  5   1   2      seed Neu       in                   TNeu076d04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGTTACAGCATGGAGCCTGTCACAGGATACCAATATCCCCAGTATGGACAGAGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTTGGAGAATTATTTGACAGAAAATCTTATTACAGAGTTCAAAGTAAACTATGTTTTGCAGAGCGGATTATAAGATGCCCCTTGATATTTTACATTATCATCGACTCAAGAAATTTTGGGAATGACTCAAAACAACAAAAGACGAGGAACTTTTCACATGTTCACAAAA
  5   1   2       bld Gas7      in                         XZG22454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCTTTGCATTGTCTTTACTGCTCTAATAATCTTTTTTTCTTGCTTGCAGGTGCCTTTCATTATCTGAAGCCAGATATTGCATAAAGGAGATGTCCCTCTTGTGCTCTAACACTCAGAATGGATACCCATCATTGTACAAGTGGCTCAAACTGCAAGACAGAAACACAGCGAACATTTATCCGTTACTCATGGATAGTGCGGGATTCCATGCTGATTGATGGTTAGATTCTGCAATGGACCTGGTGTTTTGGCTAAAGACAATGTGATTCCACATATGGCATTCCAAGGGCTGACGCCACAAACTGTTTACAAATGAACTTGAAGCCTAAATAAGTCTTACAAACTGTATTTGCCATGTCCCAAGAACCAACTTCCTTTTTGGAGAATTATTTGACAGAAAATCTTATTACAGAGTTCAAAGTAAACTATGTTTTGCAGAGCGGATTATAAGATGCCCCTTGATATTTTACATTATCATCGACTCAAGAAATTTTGGGAATGACTCAAAACAACAAAAGACGAGGAACTTTTCACATGTTCACAAAAAAGGACTAATTTTGGGAAGATAAAAGTTTAAATGACCAGGAGCAGTTATTTCAGTTTTGTTGCTGAGTAAAGGCTTGTTTGATCTGAACACAAGTTCTGACCTCTACACATAACAACAAAGTACTTTCCTTCATTATTTAGGATCCACTTAAGGA
  5   1   2      ests                               Xt7.1-THdA023a02.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAAAAGAAACAGTGAGGAACACACAACACCACATTTTGACTCCAAAATATTGATTCTTTGGCTGTCAATTAACGTGCAATACCATACCTCACTTCTACTTTGTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACAGGCCCAATAAATAGTGACTGTCTATGGCATCTTACAGCAGCCCCTCTGGCATTTGCCAGAGTAAACAGATTGCTAGTCTGGGCCCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAG
                                                  Xt7.1-CHK-1008229745                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAAACAGTGAGGAACACACAACACCACATTTTGACTCCAAAATATTGATTCTTTGGCTGTCAATTAACGTGCAATACCATACCTCACTTCTACTTTGTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACAGGCCCAATAAATAGTGACTGTCTATGGCATCTTACAGCAGCCCCTCTGGCATTTGCCAGAGTAAACAGATTGCTAGTCTGGGCCCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACTTGC
  5   1   2       bld TbA       in                   TTbA001a16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATTTCAGTTTTGTTGCTGAGTAAAGGCTTGTTTGATCTGAACACAAGTTCTGACCTCTACACATAACAACAAAGTACTTTCCTTCATTATTTAGGATCCACTTAAGGAAACTGAATTACAGAATGCAGAGTAATCTGCCAAAAGAAACAGTGAGGAACACACAACACCACATTTTGACTCCAAAATATTGATTCTTTGGCTGTCAATTAACGTGCAATACCATACCTCACTTCTACTTTGTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTNCACAGTATAGCAAAGTAATAATGAAGT
  5   1   2       bld Gas7      in                         XZG36712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAAAAGAAACAGTGAGGAACACACAACACCACATTTTGACTCCAAAATATTGATTCTTTGGCTGTCAATTAACGTGCAATACCATACCTCACTTCTACTTTGTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTT
  5   1   2       bld Gas8      in                         st114k16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACCTCACTTCTACTTTGNTAAGAAACCTCTGTATCATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACAGGCCCAATAAATAGTGACTGTCTATGGCATCTTACAGCAGCCCCTCTGGCATTTGCCAGAGTAAACAGATTGCTAGTCTGGGCCCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATT
  3   1   2      seed HdA  5g3  out                   THdA023a02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATGCTTTGCAAATATAGTGGTTTTATATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACT
  3   1   2       bld Neu       in                    TNeu129k16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCATGCTTGCAAATATAGTGGTTTTATATTTTATGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgccagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACTGCAA
  3   1   2       bld Neu       in                    TNeu058i11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTATATTTTATGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACCAGTGTTGTTTGTTGAAGGATCTCCTCCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATAAGGGTCATGTACAAAAAAAATGCAGTATATATTTACTCCTGGGAGGGAATAAACAAGTATAAAGACTTGCAATGCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  out                  THdA025m11.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTTTATTGGTTCAAAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTANAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACCAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCCACAGgcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACT
  5   1   2       bld Gas7      in                         XZG39800.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAAATGTTTGAGTTTGGATAGACACTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTTATATAAATAAA
  3   1   2       bld TbA       in                    TTbA001a16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTTTACATTTTAAAAACTTTCTACTCTCTAAGGGAAGACACATTCCACAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACCAAGTATAAAGACTGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       in                    TNeu075l15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGCCACAGTGTTGTTTGTTGAAGGATCTCCTCCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCCACCAGgcccaataaatagtgactgtttatggcatcttacagcagcccctctggcatttgccagagtaaacagattgccagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTCCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGGGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACTTGCAA
  5   1   2       bld Neu       in                   TNeu075l15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTGTTGTTTGTTGAAGGATCTCCTCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgccagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGTTTAGATA
  3   1   2       bld Gas7      in                         XZG22454.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCAGACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgccagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGAC
  3   1   2       bld Gas7      in                         XZG39800.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTCCAGACTTTCAGGGGTGATTTGACTATGGCTGATTCAGGTATTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACTTGCAATGCAAAAAAAAAAAAAAAGG
  3   1   2       bld Neu       in                    TNeu076d04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTTTCAGGGGTGGATTTGACTATGGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCCACAGgcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGAC
  3   1   2       bld Gas7 5g3  out                        XZG25765.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTGACTATGGCTTGATTCAGGTATNTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTAT
  3   1   2       bld Gas8                                 st115k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCTTGATTCAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTTCNTAAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACA
  3   1   2       bld Gas8      in                         st114k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGTATTTAAAAGGAATAGTTCAGATCACTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCACAGGCCCAATAAATAGTGACTGTCTATGGCATCTTACAGCAGCCCCTCTGGCATTTGCCAGAGTAAACAGATTGCTAGTCTGGGCCCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCAACAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGT
  3   1   2       bld Gas7      in                         XZG36712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTCAGTTCCCTGTAGCAGGAAGTGGGTTAGGGATCTAAATGTTGAGTACTTAAGTTATATAACAAAATGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGACTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaataaatagtgactgtttatggcatcttacagcagcccctctggcatttgccagagtaaacagattgctagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCACCAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTCCAGGGGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATCCATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTTTTAGAGGTGATGGAAGAAGTTCCATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTCCAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGCCTTGC
  3   1   2       bld TbA                             TTbA014j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGTAAATTTTCCTAATGGGCTAATTCAGGGCCAGCCTGGGATTCAAAATAGGCCCTagtacacagaggcccaaacagccccccacaggcccaagaaatagtgactgtttatggcatcctacagcagcccctttggcatttgccagagtaaacagattggtagtctgggccCAGGATAGTCGGAGTCAAACAGGCATTCATGTTATGTTCCATGGCTGTCGGTAAAATATTTACAAAATGTGGCCCAAAAATTTGCATGGATAAGTGGGGTTTAACTTTCAGCAGAAATAGAAAAGTAATAACGAAGTCAATACCATGAAAGTACTGAAATGGAGATTTGGTTTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTAATTGTGTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTATTAAATTAGGGGGAAAGATAGGAAAAAGGCTAGTGTGGAAATCAGGCTTTTGTATAAGAGGAAAGGAAGAAGTTACATTTTATATGTGTTTTGCCGGATTTTCTGGCAACAAATGAAGCAATGGGCCCACGTACAAAAAAAATGCGGTATCTTTTTAAAGTTTAAAATAAAAAAAACAAAGTAAAAGACTAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA  5g3  out                   TTbA066h12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCAGGGCCAGACTGGGATTCAAAATAGGCCCTAGTACACAGAGGCCCAAACAGCCCCCCCCCCAGgcccaataaatagtgactgtctatggcatcttacagcagcccctctggcatttgccagagtaaacagattgccagtctgggccCAGGCTAGTTGGAGTCAAACCTACATTCCATGTTATGTTCCATTGCTGTCGGTAAAATATTTACAAAATGTGGCCCAGTTATTTGCATTGATAAGTGGGGTTTAACTTTCACCAGTTATAGCAAAGTAATAATGAAGTCACTGCCATGAAAGTACTGAAATGGAGATTTGGATTAGGTAAAGGGGTGGGAATTACAGGTGGTTTTATTTATTTGTCTGTTTTACCCAATCAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACTTGCAATGCAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas       in                    TGas125c22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACT
  5   1   2       bld Gas       in                   TGas125c22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAGAAAACGAGGTAGAAAGCATACATTCCTTCAAGAATTATGGGTAATAAATTAGGGGGTTTAGATAGGAAAAAGGTAGTGTTGAAATCAGGCTTTCGTCTTAGAGGTGATGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACTGGCAACAAATGCTGCAATATGTTTCATGTACAAAAAAAATGCAGTATATATTTACTATTTATAATAAATAAACAAGTATAAAGACTTGCG
  5   1   2       bld Neu                            TNeu029a17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGCTTTCGTCTTAGAGGTGATGGGAAGAAGTTACATTTTATCTGTGCTTTGCCGGATTTACCTGGCAACAAATGCTGCAATATGTTTCATGTACCAAAAAAAATGCCAGTATATATTTACTATTTATAATAAATAAACAAGTCTAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)