Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ11265.5                           5 END     5          17      100                beta-1,4-galactosyltransferase [Gallus gallus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 233.0    0Xt7.1-XZT61656.3                          253 PI      100         1      122                spectrin, beta, non-erythrocytic 1 isoform 1 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012154448 Xt7.1-CAAJ11265.3.5 - 29 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAJ11265.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAATGCCTTCCGCGCAGTTTGAAGGTTTCTTGCACCGCAAACATGAATGGGAGGGTCACAACAAGAAAGCTTCAAGCAGATCTTGGCATAATGTGTACTGTGTGATCAACAACCAGGAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTTTCTCTTAATATTGTTCCCTATGGTCAGCATTGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTACTGCAGACTCATACTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTTGACCACCTGGGAATATGAATAAAGCACCTCGACCCACAGCCCCTTGCTCTGGCTACCAGCTTAGGAAGATGGACTGGGATGGCAAAAAGAAAATGTGGGCCTTAGTTGTCCTATAATATGTCTCAACCTAGAGAACTACATTTTTTTTTTTTTACCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAAAACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGCAGGTCACTGCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTC
                                                  Xt7.1-CHK-1008265113                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTTCCGCGCAGTTTGAAGGTTTCTTGCACCGCAAACATGAATGGGAGGGTCACAACAAGAAAGCTTCAAGCAGATCTTGGCATAATGTGTACTGTGTGATCAACAACCAGGAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTTTCTCTTAATATTGTTCCCTATGGTCAGCATTGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTACTGCAGACTCATACTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTTGACCACCTGGGAATATGAATAAAGCACCTCGACCCACAGCCCCTTGCTCTGGCTACCAGCTTAGGAAGATGGACTGGGATGGCAAAAAGAAAATGTGGGCCTTAGTTGTCCTATAATATGTCTCAACCTAGAGAACTACATTTTTTTTTTTTTACCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAAAACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGCAGGTCACTGCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAGAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     8     8     8     8     6     8     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     4     6     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     5     5     7     6    10     7    11     6    11     7    11    12    12    13    13    13    13    16    16    16    16    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    14    13    14    13    14    13    14    13    14    13    14    13    14    12    13    12    13    12    13    12    13    12    13    12    13    12    13
  5   1   2      ests                                 Xt7.1-CABC4479.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAATGCCTTCCGCGCAGTTTGAAGGTTTCTTGCACCGCAAACATGAATGGGAGGGTCACAACAAGAAAGCTTCAAGCAGATCTTGGCATAATGTGTACTGTGTGATCAACAACCAGGAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTTTCTCTTAATATTGTTCCCTATGGTCAGCATTGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTACTGCAGACTCATACTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTT
  5   1   2      ests                                Xt7.1-CAAJ11265.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTACCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAAAACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGCAGGTCACTGCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 2e-007     BAB00635.1 beta 4 galactosyltransferase [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 9e-008     AAH75452.1 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-015     NP_787030.2 spectrin beta 2 isoform 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 9e-016     NP_003119.2 spectrin, beta, non-erythrocytic 1 isoform 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 2e-016     XP_690684.1 PREDICTED: similar to beta-1,4-galactosyltransferase [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                     PROTEIN --- Gg ---- 3e-017     NP_990534.1 beta-1,4-galactosyltransferase [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                   Xt7.1-CAAJ11265.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------ATG------------------------------------------------------TAA------------------------TGA------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------TAATGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TGA---------------------TAA---------------------TGA------------TAA---------------ATG------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------------ATG---------TAA---------------------------------TAA---TAG---------------------------TAA------------------------------------TGA---------------------------------ATGTAG---------------------------TAA------------------ATG---------------TAG---------------------------------------------------TAG---------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------TAG---------------------------------------------------------------------------ATG---------------------------------TAA---------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------ATG------------------------------TGA------TGA---------------------------------------TAG------------------TAA---ATG---------------------------------------------------------------------------------------------------------------------ATG------------------TAA------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAA------ATG---------TGA------------------TAGATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------TAG------------ATGTAA------ATG------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------ATG---ATG------------------------------ATG---------------------------------------------------------ATG------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                    ]
  5   1   2      ests                                 Xt7.1-CABC4479.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAATGCCTTCCGCGCAGTTTGAAGGTTTCTTGCACCGCAAACATGAATGGGAGGGTCACAACAAGAAAGCTTCAAGCAGATCTTGGCATAATGTGTACTGTGTGATCAACAACCAGGAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTTTCTCTTAATATTGTTCCCTATGGTCAGCATTGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTACTGCAGACTCATACTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTT
                                                  Xt7.1-CHK-1008235282                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTTCCGCGCAGTTTGAAGGTTTCTTGCACCGCAAACATGAATGGGAGGGTCACAACAAGAAAGCTTCAAGCAGATCTTGGCATAATGTGTACTGTGTGATCAACAACCAGGAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTTTCTCTTAATATTGTTCCCTATGGTCAGCATTGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTACTGCAGACTCATACTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTTGACCAC
  5   1   2       bld Brn3      in                         CAAK8804.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAATGGCTTTCCCAATGAGTACTGGGGATGGGGAGGAGAAGATGATGATATTTATAACAGAATAACCCTCAATGGCATGAAAATTTCCCGGCCTGATATCCGCATTGGACGTTATCGGATGATCAAACATGAACGAGACAAGCACAATGAGCCCAACCCTCAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCANATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACAC
  5   1   2       chi Te1       in                         CBWN9916.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAATGCCTTCCGCGCAGTTTGAAGGTTTCTTGCACCGCAAACATGAATGGGAGGGTCACAACAAGAAAGCTTCAAGCAGATCTTGGCATAATGTGTACTGTGTGATCAACAACCAGGAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCAAAAAAAAAAAAAAA
  3   1   2       chi Te1       in                         CBWN9916.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAATGCCTTCCGCGCAGTTTGAAGGTTTCTTGCACCGCAAACATGAATGGGAGGGTCACAACAAGAAAGCTTCAAGCAGATCTTGGCATAATGTGTACTGTGTGATCAACAACCAGGAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5x3  out                  TGas118h21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGCAAAGATTTACAAAGATTCAGAATACGAAGATGACAATGAAGAAAGATGGAATCAATTCATTGCACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGA
  5   1   2      seed Fat1      in                         CABC4479.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACTACCGTGTGATCCACTCCGCCAAATACCCCATGTACACAAACATCACAGTTGATATTGGGAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTCTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGCAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGGCAGCTNNAACAGTTATACT
  3   1   2       bld Gas  5x3  ?                     TGas118j23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACACAAACATCACAGTTGATATTGGGAAAACCACCGCCCAGACCTGCCCGGGGATAACGTAATGCACTCACTGGCACTTCTTGAGAACAGCGCGTCTCTTCCTCCTTTCATTTTGGAAGAAGGGGAAATGCAGTTAAACCCTTCCTTTTGCCTCCTGCAGGGTTTCCGTTACAGGATGCGCGGCGATTTGCCTGGTTCTTCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAAATAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATAAGGGAGACTGTTATAAAATATCAAATGTGGCAAGCAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT34674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGCACCCCACGGAAGGACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATTTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTTTCTC
  5  -1   2       bld Ovi1      out                        CABI5076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGACCTATTCTCATAATGAATAAATGAACTTGGTGCTCATGTGCGACAGTGTGCTGTACCTGCCAATGTTCCGCATGCTCAGAAAGGCAGAATCCGTCTGCTACATNTTAGTACTTCCTTGCTCTTCTTTTTCTTGAAACCTTTAATAAACGTCAGATTGTTTCACCCTCTCAGTTCCAGAAGAGGGAGCGACCATACTGCCACTGTGATGTTGACACAGAAAGTTGCAAGGAAAATATTCTATAACAAATTTACAAATATTCAGTTTTCTTTATCAACAGCACAGTGACTCAAATCTACTAATAGCCTATAAGAGAAAGGTCACTTTGGATGCTGAAACATACACTTTTAATCCAGTCCTGAACACATGTGCTACAGGGCAACACTGAGAGCTAAAACTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATCGAATCGAT
  5   1   2       bld Te3       in                         CAAM4202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAATGTAACCTTGGCATATCCACAATGTTCAAGATTGCTTTGCAGTTACTGTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGCAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATCTTGGCAAGCTAAACAAGTTATACTGTAAAGATGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATAGACAATGTCATTAATATATAATTGTTTTCTCTTAATATTGTTCCCTATGGTCAGCATTGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTATTGCAGACTCATACTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTACTGGTATGTATTTGCCCAGTTTGACCACCT
  5   1   2       bld Tad5                                 XZT48715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTCTATTGACACTCATAGACTTATACATTGACAGTTTTTGCATATCCTTGTTAAACTAACACTGTCTAGGCTGTGTTTGTTGGAAGTCTGTTACATGTGTGAATGTTATAAAATATCAAATGTTGGCAAGCTAAACAAGTTATACTGTAAAGTTGGAAGGGAAAAGAAAATGTTTGAACCTCAAAAGATGCAACTCCCTTAACTGCTTTGCTGCATTGAAGGTACCTGCCTTGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTTTCTCTTAATATTGTTCCCTATGGTCAGCATTGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTACTGCAGACTCATACTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTTGACCACCTGGGAATATGAATAAAGCACCTCGACCCACAGCCCCTTGCTCTGGCTACCAGCTT
  5  -1   2       bld Te1       out                        CBWN9658.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATCGATTCGAATTCGTCGACCCACGCGTCCGACCTGCCTTGCATAATGCTAGAGATTTATATTAATGACATGGTATATAAATCTCTAGCATTATGCAAGGCAGGTACCTTCAATGCATAATGCTAGAGATTTATATACAATGTCATTAATATATAATTGTTGTCTCTTAATATTGTTCCCTATGGTCAGCATNGAACTCCTGGGTGTGTGAGCTCTGATACATGGGTTATGTAGCACAGTGGAGAGTGGAGGGGCTGCTGGTAAAACTGTACTGCCTATAAAATGTATTGGATAAGGGTATAGCTACTGCAGACTCATACTGCTCTA
  5   1   2      ests                                Xt7.1-CAAJ11265.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTTTTTTACCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAAAACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGCAGGTCACTGCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAAT
                                                  Xt7.1-CHK-1008231308                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTTACCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAAAACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGCAGGTCACTGCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAGA
  5   1   2       bld Te5       in                        CAAO10356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTGCACTATTAATTACATCTATACAGACACATCACTAGACAGACATAGTAATCTTGCAGAGAAAGGACAGTTCTCACAACAAGAATCAGATTCTCCCATTAATTTATGTAAAGGCCATCTAAAAAGCCCCAATATATCATCCTTGTCTTCCTGGTAGCATAGAGCTGCTGTTTAAGTTCCCATGTATAGTAAAGTCCATAGTATAGTCCAATACATATATTCTGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTTGACCACCTGGGAATATGAATAAAGCACCTCGACCCACAGCCCCTTGCTCTGGCTACCAGCTTAGGAAGATGGACTGGGATGGCAAAAAGAAAATGTGGGCCTTAGTTGTCCTATAATATGTCTCAACCTAGAGAACTACATTTTTTTTTTTTTACCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAANACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGC
  5   1   2       bld Te5       in                         CAAO6275.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTGATCTCCTCAACCCCCATATATTTTCTTTCTGCCTGCCCTTTTCTTCCTTCTGGTATGTATTTGCCCAGTTTGACCACCTGGGAATATGAATAAAGCACCTCGACCCACAGCCCCTTGCTCTGGCTACCAGCTTAGGAAGATGGACTGGGATGGCAAAAAGAAAATGTGGGCCTTAGTTGTCCTATAATATGTCTCAACCTAGAGAACTACATTTTTTTTTTTACCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAAAACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGCAGGTCACTGCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCC
  5   1   2       bld TpA                            TTpA019f03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCCGCTTTTTTTTTTTTCCTAAAGACAGAATCCAGAGCATACTTTTTTCCAGTTAATCTAGTGAATTTGCCAAATTTAGAATTCAGTTTCTCTCTTACTATATGCTGGAAACATTTGGCTCTGATCAATCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTACTGACCCTTAGTATAGTTTTGCCTTTGCATAAAATATGAAATGGGCAAACAGTTTGCTGC
  5   1   2       bld Te5       in                        CAAO12738.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAAACATNTTGGCTCTGATCAGTCTTTCTGATGTTACTGACAGCATAGCAAATGGAAGAACGGTAATGTTATTGACCCTTAGTATAGTTTTGCCTTTGCTTAAAATATGAAATGGGCAAACAGTTTGCTGCACCACAATAAGGTATTGGTGTTGGTATTGGTGATTTGTTCAGATAACCAAGGACTGCATGAGAATTCTTCTTTAAAACAAAGATGCTGTTGTGTCATGCATGTGGGTCTCATATTATAATCTGGCAGGTCACTGCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATG
  3   1   2       bld Brn3      in                         CAAK8804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGACACGGGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAG
  3   1   2       bld Brn3 5g3  out                        CAAK6111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCAGTGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTGCATGGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAGAAACGG
  3   1   2       bld Fat1      in                         CABC4479.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCAGTGGAACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATAGGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCTAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTC
  3   1   2       bld Te3       in                         CAAM4202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATGGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTNTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTC
  3   1   2       bld Brn2 5g3  out                       CAAJ11265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAGAAAC
  3   1   2       bld Te5       in                        CAAO10356.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCACAAATAAGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATAGGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCTAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAG
  3   1   2       bld Te5       in                         CAAO6275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATAAGCTGCAAAAAGTGTATGTGAGCATACATGGGACTGGATATTGGTGGAGAAAAAAGGTGCATGGGACATTCTGCCTANTCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAG
  3   1   2       bld Te5       in                        CAAO12738.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTGCAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAGAAACGG
  5   1   2       bld Tad5      in                         XZT47975.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAAAAAGTGTATGTGAGCATAACATGGACTGGATATTGGTGGAGAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATAGGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCTAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTC
  3   1   2       bld Brn2      out                       CAAJ12645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAAAAGGTTGCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAGAAACGG
  3   1   2       bld Tad5      in                         XZT47975.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCATGGACATTCTGCCTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATAGGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCTAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAG
  3   1   2      seed Brn3                                 CAAK7361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTATCTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTC
  3   1   2       bld Tad5      in                         XZT34674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTAATTACATGATTTAGAAAGTGAACTTTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATAGGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCTAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCCGG
  3   1   2       bld Brn3 5g3  out                        CAAK4297.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAATTACATGATTTAGAAAGTGAACTNTGTGGCCTGGGCCCTCTAACATAATTCTGGATGTACAGTACCTGAAGTACAGGTGACGTGAAGTAGATGGAGCTTTTTACGGAGAATCAGTTTTGGAAGCAAGGAAGCAAGTGTGCACAATGGACTTCCTGGCTTCATGGATCACAGAACTTGGAACATGGGGGGCATGGTTACTGTCTGCAGGTTTGGGGATTGGTGCGTTGCTGTGCAATGCATTGCTAGAGGATTCTCAGAATGTAAGGCCTGATGCAATTCCTTTTGTATGCAAGGAACCCATGCAAAAAGGTTACTGCAGCAATTCTAGGGCTTTTTTGTTTTTTATTTCATTTTTCTCGCCATGTCAAACATTTAATTAACAGATACGTTTTGTAAACTTTACATCAAGCACCATGCTTAAGAGAAACCCACAGGTTCCTAGTATTGCTGCTTTCAGGTCTCATAAATGGTACAAGTGCACTGAGGAGCCAAACTGCAAAACAGGGCCAGGCACTTGTGCAACGGTAACTAGTGGCCTCGTTCTGCAGTCGGGCATCGTCCTGTGCCAACTTCTGTGTTTGCATAGTTTTAGCTCTTCTTTGTATGTTCATGTTGAGAGGAGGATCTGTCCATCCACTTTGGATGTGTCTGCTTGTTATTTGTCTTTTTCTACAACTGTGGGAAACGAGATCTAAAAACGATATGCTGTTGCAATCTCTGCCTTTACAGTTTTCATAAAATAATTCAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)