Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAL7580.3                           10 END     1           3       10                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 233.0    0Xt7.1-CABI14381.3                          20 PI      77        407      771                homer 1b-1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012154463 Xt7.1-TGas123a17.3.5 - 28 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas123a17.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGGGTGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAAAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAACACTAAGAGAGAACAACGCCAGGCTGTCAACTGCCCTTCAGGAATCCATTGCCAGTGTAGAACATTGGAAGCGACAGTTTCTGAGCTGTAAGGATGAGAGTGATCAGCTCAGAAATAAGATTGGAGAACTTGAGGCACAATGTGATGAGATAGAGAAGGAAAAAGAGAGGAACAAGGAGCTCAGCAACAGATTACAAGAACTGGAAGTTGAAATCCAAGACAAAGAAGCAGAACTGGAAGACCTCAGGAAACAAAGTGAACTTCTTCCCCAGCTGATGGCAGAGTGTGAATCTATGACTGAAAAGCTTCAGGATACTGAGATGAGGAATCAGGAGCTGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATCGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTTGGAGGATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008265116                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAAAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAACACTAAGAGAGAACAACGCCAGGCTGTCAACTGCCCTTCAGGAATCCATTGCCAGTGTAGAACATTGGAAGCGACAGTTTCTGAGCTGTAAGGATGAGAGTGATCAGCTCAGAAATAAGATTGGAGAACTTGAGGCACAATGTGATGAGATAGAGAAGGAAAAAGAGAGGAACAAGGAGCTCAGCAACAGATTACAAGAACTGGAAGTTGAAATCCAAGACAAAGAAGCAGAACTGGAAGACCTCAGGAAACAAAGTGAACTTCTTCCCCAGCTGATGGCAGAGTGTGAATCTATGACTGAAAAGCTTCAGGATACTGAGATGAGGAATCAGxxxxxGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATCGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTxGxxGGATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTxxxAxxAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     5     7     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     4     2     4     2     4     2     4     2     5     3     6     4     7     4     7     6     7     8     8     8     9     9     9    10    10     9    10    10    10    10    10    10    10    11    11    11    11    12    12    12    12    11    12    13    13    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    14    13    14    13    14    13    14    13    14    13    15    14    15    15    16    15    16    16    16    15    16    15    15    15    15    15    16    15    16    16    16    15    16    15    15    15    15    15    15    14    15    15    15    15    15    14    15    15    15    15    15    15    15    15    16    15    16    15    16    14    16    15    16    15    16    15    16    14    15    13    14    13    14    13    14    12    13    11    12    11    12    10    12     6    10     4     5     2     2
  5   1   2      ests                               Xt7.1-THdA046j13.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGGGTGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAAAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAAC
  5   1   2      ests                               Xt7.1-TGas123a17.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTGGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATCGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTGGAGGAATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                               BLH ATG     406    1325                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     406     138                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     322     529                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     322      73                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Ci ---- 8e-007     FAA00138.1 TPA: zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 9e-009     NP_001024128.1 EEA1 (Early Endosome Antigen, Rab effector) homolog family member (eea-1) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 4e-010     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dm ==== 2e-058     NP_477396.1 CG11324-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 4e-080     XP_788792.1 PREDICTED: similar to homer 2 isoform 1, partial [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 2e-109     NP_001018470.1 hypothetical protein LOC553661 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 2e-157     AAH46847.2 Homer2 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 2e-157     NP_001080709.1 homer homolog 2 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 8e-149     NP_036113.1 homer homolog 2 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 3e-150     NP_955362.1 homer 2 isoform 2; homer, neuronal immediate early gene, 2; homer homolog 3(Drosophila); cupidin [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 3e-159     XP_413836.2 PREDICTED: similar to homer-2b [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          CAJ83422.1 homer homolog 2 (Drosophila) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas123a17.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAG------------TAG------------------------------ATG---------------------------------------TAG------------------TAG------------------TAG------------------TAG---------------------------TGA------------------------------------------------------------------------------------------------TGATAA---------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------ATG------------------------TAA------TGA------------ATG---------------ATG------TGA---------------------TGAATG------ATG---------ATG------ATG------------------------------------------------------------------------ATG---------------------------------------ATG---------------TGA---------------------------------------------------------------------------TAA---------------------------------------TAG---TAG------------------------TGA---TAG---------TAAATG------------------------------------------------------------------------TAAATG------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------TGA------------------------------------ATG------------TAA------TAA---------------------------------------------------TAA------------TGA---------ATG---TAA---------------TAA------------------------------------------------------------------------------------------TAA------TAA---------------------------------------------------------------------------------------TAA---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  0   1   1           Gas  FL                     TGas141j04.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCGGGGATCGCAGCCGAACTCCGGAGATCACTTCCCACACTCCCATGCCAGGCAAAGAGTGGGGTGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAGAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGTGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAACACTAAGAGAGAACAACGCCAGGCTGTCAACTGCCCTTCAGGAATCCATTGCCAGTGTAGAACATTGGAAGCGACAGTTTCTGAGCTGTAAGGATGAGAGTGATCAGCTCAGAAATAAGATTGGAGAACTTGAGGCACAATGTGATGAGATAGAGAAGGAAAAAGAGAGGAACAAGGAGCTCAGCAACAGATTACAAGAACTGGAAGTTGAAATCCAAGACAAAGAAGCAGAACTGGAAGACCTCAGGAAACAAAGTGAACTTCTTCCCCAGCTGATGGCAGAGTGTGAATCTATGACTGAAAAGCTTCAGGATACTGAGATGAGGAATCAGGAGCTGGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATGGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTGGAGGATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATTAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTTTGATAAAAAAAAAAAAAAAAAAAAA
  5   1   2      ests                               Xt7.1-THdA046j13.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGGGGTGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAAAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAAC
                                                  Xt7.1-CHK-1008238263                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAAAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAACACTAAG
  5   1   2       bld Gas  FL   in                   TGas141j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGATCGCAGCCGAACTCCGGAGATCACTTCCCACACTCCCATGCCAGGCAAAGAGTGGGGTGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAAAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGA
  5   1   2   22  bld Tad5 5g                              XZT16739.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGAGGCTGCTGCTGCTGGAAGCAGGTGGGATCCGTATCGCAGCCGAACTCCGGAGATCACTTCCCACACTCCCATGCCAGGCAAAGAGTGGGGTGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAGAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGTCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCCAGCAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGA
  5   1   2       chi TpA  5g3  in                   TTpA077a13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCAAAGAGTGGGGTGCCGGCAGTACCTAGGCAGGCAGAGGTTAGGATCGCACTAACCCAGAGCCCGGCGTTTGTATGAATGGGAGGGCACTGCTAAAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGTGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCAC
  5   1   2       bld HdA  5g3  in                   THdA046j13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCTGCTATAGCCTGGGAGGGTGCTGCTATGCGAGCAGTGAAGCAGCGGGAGGAGATCGCTGGATAGAAGCCTCTCACGCCTACTGGAGCGCTCCTGTGCCGGCTGGAGCCTGCCCGATGGGGATTTAAATAGCAGCTGATAAGCCCAAGCGCACCGTATGCACGAAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGTGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTG
  5   1   2       bld Egg                            TEgg140f17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTCCAGAGCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAACACTAAGAGAG
  5   1   2      seed Gas7      in                         XZG32694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGTCCCTTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAACACTAAGAGAGAACAACGCCAGGCTGTCAACTGCCCTTCAGGAATCCATTGCCAGTGTAGAACATTGGAAGCGACAGTTTCTGAGCTGTAAGGATGAGAGTGATCAGCTCAGAAATAAGATTGG
  5   1   2       bld Egg       in                   TEgg031p07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGGGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTATTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGA
  5   1   2       bld Gas       in                   TGas123a17.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAGGGGAGCAAGGAGATCGCCTGCCTGTGTGGGAGAGGCTACTGCCGAGCCGCCAAACATGGGGGAACAACCGATCTTCACCACAAAAGCACATGTCTTCCAAATTGATCCCAGCACTAAGAAGAATTGGGTCCCTGCAAGTAAACAGGCAGTTTCAGTTTCTTACTTCTATGACAGCACAAGGAACAGCTATAGAATTATCAGCGTCGATGGGACCAAGGTAATTATAAACAGCACAATATCGCCCAATATGACCTTTACTAAGACATCTCAGAAGTTTGGGCAGTGGGCAGACAGCAGAGCAAATACAGTCTTTGGCCTGAGATTTGCCTCTGAACAGCAGCTGTCAAAGTTTGCAGACAAATTTCAAGAAGTCAAAGAAGCAGCAAAGTTAGCACGGGACAGATCTCAAGAAAAGATGGAGACCTCAAGCAATCACTCCCAGGAGTCTGGACGGGAAACTCCATGTTCAACTCGCGCATCAAGTGTTAATGGAACAGATGATGAAAAAGCTTCTCATGGGGAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGA
  5   1   2      ests                               Xt7.1-TGas123a17.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCTGGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATCGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTGGAGGAATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTT
                                                  Xt7.1-CHK-1008230643                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATCGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTxGxxGxATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTT
  5   1   2       bld Ova1      in                        CABE12193.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCCGCCTGATGCAGAGCTGAAGATTGAGAATGATAAACTGAAGACTGCCCTAGCACAAAGCTCCTCCAATGTGAAGAAATGGGAGACTGAGCTGGAAACACTAAGAGAGAACAACGCCAGGCTGTCAACTGCCCTTCAGGAATCCATTGCCAGTGTAGAACATTGGAAGCGACAGTTTCTGAGCTGTAAGGATGAGAGTGATCAGCTCAGAAATAAGATTGGAGAACTTGAGGCACAATGTGATGAGATAGAGAAGGAAAAAGAGAGGAACAAGGAGCTCAGCAACAGATTACAAGAACTGGAAGTTGAAATCCAAGACAAAGAAGCAGAACTGGAAGACCTCAGGAAACAAAGTGAACTTCTTCCCCAGCTGATGGCAGAGTGTGAATCTATGACTGAAAAGCTTCAGGATACTGAGATGAGGAATCAGGAGCTGGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATGGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTGGAGGATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGNGCGTAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGT
  5   1   2       bld Tbd1      in                         CBXT6613.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGATGAGATAGAGAAGGAAAAAGAGAGGAACAAGGAGCTCAGCAACAGATTACAAGAACTGGAAGTTGAAATCCAAGACAAAGAAGCAGAACTGGAAGACCTCAGGAAACAAAGTGAACTTCTTCCCCAGCTGATGGCAGAGTGTGAATCTATGACTGAAAAGCTTCAGGATACTGAGATGAGGAATCAGGAGCTGGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATCGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTGGAGGATGCTGTGCTCACTGCTTTGAACCTTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAG
  5   1   2       bld HdA                            THdA042h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCAGGATACTGAGATGAGGAATCAGGGAGCTGGAAGAGAAAGTAAGGACTCTGAAAAAGGATATGGATGAGAGCAGGCACAGACATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATGGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTACAAATTGATAACTAGTCCCACTAGGGTGTTGTGGATATGTCTTCACATGGTAGGGTGTGCAAACCACTTGAAACACAGGGTTGGAGGATGCTGTGCTCACTGCTTTGAACCTTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCANCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAAAATGAATGCACTGCAATAAAACAACTAAGCCCATAGCCAGGAACATGATTATTTTACTGCTTCAAT
  5   1   2       bld Te1       in                        CBWN10163.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTCTGTGCCTGCTCTCATCCATGGGCACTTGAAATTGGAACTCAAACATTTTTTGAATGTATTTGATGGAAAAATGGATGACTTGCATGAATTACGTCAAGGACTTTCCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGA
  5   1   2       bld Kid1      in                         CABA4821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGAAACACAGGGTTGGAGGATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTANATTTGTGAAATATAATAATAATANATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAG
  3   1   2      seed Gas       in                    TGas123a17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTGGAGGATGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE12193.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTGTGCTCACTGCTTTGAACCTTTTCTATTACATGCAAATTGCTGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATT
  3   1   2       bld Kid1      in                         CABA4821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATGCAAATGCTGGGGATTCAGACTGTGTTTTNTAATTCAGATTGGCAACCAATAGCTGCNTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTT
  3   1   2       bld Gas  FL   in                    TGas141j04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGGATTCAGACTGTGTTTTTTTAATTCAGATTGGCAACCAATAGCTGCATAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATTAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAANATTTCTCTTCCATTTTTAGTT
  3   1   2       bld TpA  5g3  in                   TTpA077a13.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATTCAGATTGGCAACCAATAGCTGCCTAAGACTCTAAGCCATTTGTTTCAATTACTACAGAATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATTAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTTGATAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG32694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATCTGTCTAGGGTTAGACTCGGTGTAATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTT
  3   1   2       bld Egg       in                    TEgg031p07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGTGACGGACAAGTGATCATAGCACTCGGCGTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTTTGATAATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te1       in                        CBWN10163.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTAAATGGATAGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTTGAAAAAAAAAAAAAAA
  3   1   2       bld HdA  5g3  in                    THdA046j13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGACACAAAAGTGGCATGGTAATTGTTCCTGTCACAGCACATATTCCTTTGCTCACATCAGTGCAGAGTAAATGAAGCAGGTCAGAAGGTCTGTGGAAGGGCTGGAGAGTGGTAGGCCCCAGTGCAAAAATGTTTCTCAGCCCTTGCTTCATAGGAAAAGAAAAATCACATAGAGTGCCCCTAAAGTGCAGGGCCACAGTTTAGCACCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATTAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Egg                             TEgg033g22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTTTAGCACCACCAGCTATAAGAAAGGCATGCTCCACCTTGAATCTACACCTGCCTCCTATAGCCCCAGGAAGACTAGAAAGTAATGCACTGCAATGAACAAACTAAGCACATAGCCAGGAACATGATTATTTTTCTGCTTCAAATACCAAGTTGGAGTAATCGGAGATACAGTGGCAGAGGCAGATGCCATAAACACTATTCATCTTGGAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTTCTTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTGAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCGATTATATATCAAATTTGTGAAATATCAATAATAATAAATTGTACACTTCTGGTATACATTTTTACATATTAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAAAATAGACACTGTTAGTGATTAATAGTAAATATAACCATTCCTCGATGTCTTATTTATAATAAAATTTCTCTTCCATTTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3      out                       CAAK12358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTAAAGCACCAGCTATAATAAAGGCAGCTCCACCTTGAATCTACACTGCCTCCTATAGCCCCAGGAAGACTAGAATGAATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Tbd1      in                         CBXT6613.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCTATAGCCCCGGGAAGATTAGAATGAATGCATTGCAATAAACAAACTAAGCACATACCCAGGAACAGGATTATTTTATTGCTTCAAATCCCAAGTGGGGGTAATTAAAGATTCCTTGACGGGGGCGGAGGCCATAAACATTTTTTTTTTTTTAAGGGATAAGGTTTTTTTTTGAATACCAGGGGTCCTTTCCCTTTGGGTTTGATTTAAATGCAGGTTCCCCTGTTTTTAATGGTTGCTCCCCTTAATCCCCTTAAATACAAGGGCATTTTTTCTTTTTTTATTTTAAATTTGTGAAATATAATAATAAAAAATTGTACACTTTTAGTATACATTTTTACATATAAATTGGGGCAAAGCGGGCTAATTTAATTTTAGTTCCCCAATTAGACACTTTTTGGGATTAAAGTAAAT
  5   1   2       bld Tad5                                 XZT68106.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGCACTGCAATAAACAAACTAAGCACATAGCCAGGAACATGATTATTTTACTGCTTCAAATACCAAGTTGGAGTAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTTTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld TpA                            TTpA050n11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAATCAGAGATACACTGACAGAGGCAGATGCCATAAACACTATTCATCTTCTAAGTGATAAGGTTTCTTTCTGAATACCAGGGGTCCTTTACCTATGGGTCTGATCTAAATGCAGGTTGCCATGCTCTTAATGGTTGCTCACCATAATCCCCTTAAATACAATGGCATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGAC
  5   1   2       bld Tad5                                 XZT46040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTATTTCCTATTATATATTAAATTTGTGAAATATAATAATAATAAATTGTACACTTCTAGTATACATTTTTACATATAAACTGGTGCAAAGCTGACTAACTTAATTTTAGTTCCCCAACTAGACACTGTTTGTGATTAAAGTAAATATAATTATTCCTCATGTCTTATTTATAATAAAATTTCTCTTCCATTTTTAGTTTGATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)