Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CAAL19212.3                          37 END     1           3        2                receptor-type protein tyrosine phosphatase beta.11 [Xenopus laevis]
     2   2.0    0Xt7.1-CAAO9040.3                           13 END     1           3        8                Unknown (protein for IMAGE:7668780) [Xenopus tropicalis]
     3   2.0    0Xt7.1-CAAN459.5                             3 END     2           6       66                PREDICTED: similar to DENN/MADD domain containing 4B [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012154467 Xt7.1-CABJ7074.3.5 - 30 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABJ7074.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCTACGCTGGGCCAAGCTGCGCAATGTGGTTCTGGGAGCCGCACAGTTCCGCCAGCCCCTCAAACGGAAAAGGAGACAGGCCGGACTCAGCCTTTCCCAGACCGAAAGCCATTTGCCAAGGAACTGCGCCTCTGAGCTGCCCCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCATGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGCGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGAAAAACCGTCCCCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCCCTCCTGAACGTCAGGGTCACCGACCTGCAGAGCCGGCACAGTGCTTCCAAGGACTCCTCTGCCTCCCCCCAGCCTTCCACAAATGGAGACTCCCCAGTCCCTGGGGGGGCGGGGCCAGTGCTGAGCGACCGCTTCCAGTGTTTGGTGCTCGATGACCAAGGGACTGTGCGCCCCCCGTGCAATGGATACACCGACACCCAATTACAGCTGCCTGGGCCCAGTGCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008265570                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTGGGCCAAGCTGCGCAATGTGGTTCTGGGAGCCGCACAGTTCCGCCAGCCCCTCAAACGGAAAAGGAGACAGGCCGGACTCAGCCTTTCCCAGACCGAAAGCCATTTGCCAAGGAACTGCGCCTCTGAGCTGCCCCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCATGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGCGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGAAAAACCGTCCCCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCCCTCCTGAACGTCAGGGTCACCGACCTGCAGAGCCGGCACAGTGCTTCCAAGGACTCCTCTGCCTCCCCCCAGCCTTCCACAAATGGAGACTCCCCAGTCCCTGGGGGGGCGGGGCCAGTGCTGAGCGACCGCTTCCAGTGTTTGGTGCTCGATGACCAAGGGACTGTGCGCCCCCCGTGCAATGGATACACCGACACCCAATTACAGCTGCCTGGGCCCAGTGCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     5     6     5     6     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     6     8     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     5     5     8     8     9     9     9     9     9     9    10    11    10    11     9    10     9    10    12    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    17    16    17    16    17    17    19    17    19    17    19    16    19    16    19    16    19    16    19    17    19    17    19    16    19    16    19    15    18    16    18    15    17    16    17    15    17    14    16    15    16    14    15    13    15    14    15    14    15    11    15    11    15    12    16    12    16    12    16    12    16    12    16    12    16    13    16    13    16    13    16    12    16    13    16    13    16    12    16    13    16    13    16    13    16    13    16    13    16    13    16    12    15    12    15    12    15     3     5     3     4
  5   1   2      ests                                 Xt7.1-CAAM4312.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCTACGCTGGGCCAAGCTGCGCAATGTGGTTCTGGGAGCCGCACAGTTCCGCCAGCCCCTCAAACGGAAAAGGAGACAGGCCGGACTCAGCCTTTCCCAGACCGAAAGCCATTTGCCAAGGAACTGCGCCTCTGAGCTGCCCCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCATGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGCGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGAAAAACCGTCCCCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCC
  5   1   2      ests                                 Xt7.1-CABJ7074.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGTGCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAAAA
                                                                       ...PROTEIN --- Ce ---- 4e-022     NP_500145.2 CRAG protein (4C711) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 2e-032     XP_001194248.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 7e-035     NP_727281.2 CG12737-PB, isoform B [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 8e-053     XP_424821.2 PREDICTED: similar to DENN/MADD domain containing 4C [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 3e-058     XP_691058.1 PREDICTED: similar to c-myc promoter binding protein [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 4e-059     XP_686492.1 PREDICTED: similar to c-myc promoter binding protein [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Hs ---- 5e-135     XP_001130684.1 PREDICTED: similar to DENN/MADD domain containing 4B [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-137     NP_958809.2 DENN/MADD domain containing 4B [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABJ7074.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------ATGATG---------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------TAG------------ATG------------------------------------------ATG------------------------------------TAA------------------------------------ATG---------------ATG------ATG------------------------------------------------------------ATG------------TAA------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2      ests                                 Xt7.1-CAAM4312.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCTACGCTGGGCCAAGCTGCGCAATGTGGTTCTGGGAGCCGCACAGTTCCGCCAGCCCCTCAAACGGAAAAGGAGACAGGCCGGACTCAGCCTTTCCCAGACCGAAAGCCATTTGCCAAGGAACTGCGCCTCTGAGCTGCCCCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCATGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGCGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGAAAAACCGTCCCCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCC
                                                  Xt7.1-CHK-1008242297                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCTGGGCCAAGCTGCGCAATGTGGTTCTGGGAGCCGCACAGTTCCGCCAGCCCCTCAAACGGAAAAGGAGACAGGCCGGACTCAGCCTTTCCCAGACCGAAAGCCATTTGCCAAGGAACTGCGCCTCTGAGCTGCCCCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCATGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGCGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGAAAAACCGTCCCCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCCCTCCTG
  3  -1   2       bld Fat1      in                         CABC9367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTCAGAGCGGGCGCCTACGCTGGGCCAAGCTGCGCAATGTGGTTCTGGGAGCCGCACAGTTCCGCCAGCCCCTCAAACGGAAAAGGAGACAGGCCGGACTCAGCCTTTCCCAGACCGAAAGCCATTTGCCAAGGAACTGCGCCTCTGAGCTGCCCCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCATGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGCGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGAAAAACCGTCCCCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGGTGAGTAAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGA
  5   1   2       bld Te3       in                        CAAM14637.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCCTACGCTGGGCCAAGCTGCGCAATGTGGTTCTGGGAGCCGCACAGTTCCGCCAGCCCCTCAAACGGAAAAGGAGACAGGCCGGACTCAGCCTTTCCCAGACTGAAAGCCATTTGCCAAGGAACTGCGCCTCTGAGCTGCCCCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCATGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGTGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGANAAACCGTCCCCTCTCAGCTTCCCCGGNGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAAT
  5   1   2      seed Te3                                  CAAM4312.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGCGGCTGAGCCTCCTGCGCCAAGCTACATGGGCGGGGAGCTCACACAGGGAATTCCACGAGAGCTGCGCCGGGAAACTGGTAAAGAGCTGGAGCGTCAGTGGCGCCGGGAGTGATGGCGACATGGTGGAGAGCTCGTTGGCGCACATGATGGAAGATGCGGAGGGTATGAAGATGGGCAGAAGAGGAGAGGGAAGCCCGTCGCTAAGGAGGCCGTGTGGGACCCCCCTGGCCCTGGGCCCCTCGGAGAACGGGAGCCTATCCAACGTCAGTCTGCAGACCGATGCCACCGGCAGCGACGTGGCTGTAACTTCAGAAGACTCGGAAGCCCTGATGACGGAGAGTTCCACGGAGGCCTTGCCCTGCCGGCCGGCCAGAGACCTGGGAGACTCCTCCTCCACCGGTACCAACGGCAAACGGCACAGCTTGGCCGGCAAGATACAGCAGCTTCTCTCCCCGGCCCGGAAGCCTGGAAGGGTCACGTTACTGCGCAAAAAGTCCTCCATGTCTGAAAAACCGTCCCCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGG
  5   1   2       bld Gas7      in                         XZG29255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTCTCAGCTTCCCCGGGGATCAGAGCTGGAGGAGCTACAAGGAAAGCATTGGGCGCCCAGAGTCCACGGCCTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGTGCCAGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTGTACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCCCTCCTGAACGG
  5   1   2       bld AbdN                               IMAGE:7021800                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCCCTCCTGAACGTCAGGGTCACCGACCTGCAGAGCCGGCACAGTGCTTCCAAGGACTCCTCTGCCTCCCCCCAGCCTTCCACAAATGGAGACTCCCCAGTCCCTGGGGGGGCGGGGCCAGTGCTGAGCGACCGCTTCCAGTGTTTGGTGCTCGATGACCAAGGGACTGTGCGCCCCCCGTGCAATGGATACACCGACACCCAATTACAGCTGCCTGGGCCCAGTGCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGGTGGCCTTCNAAACACGTTCCGGCAGCAGTCACAGGTGCTTGGAAGTTGCGGCAGGTGGAGGGTTGCGACTTCTGGGGGGGACGTGGTTAATGCAGGAACCCCGGAACCGGGTGGCCTTCCTTCTCCTACCTCCCCTCCTGGAAAACCTCAAACCAAAAAAACTTTCCCCAACCCAAATTTTTAATTTCTTGGGAAACCACCGCCCCCCCCCCCCCTTTTTACCCCTTGGAAAAATTTCCTTGGAAAAAAAAAATCCTCTGGAAAATTTTTCCGGAAGGGCCCTCCTACACAAGGGGTTTTCCTTAAAAAGAGACAAATTTTTTT
  5   1   2      ests                                 Xt7.1-CABJ7074.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGTGCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008229261                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas7      in                         XZG17795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGACGCGTGGGTCCGAGAGCTCCGTCTCTCTGGGAAGCGAAGTGGACTTGTCCGACACCTCCGTCTGCAGCTTCACCCTACACAAATCCACCGACCGACTGACCGACGGGGGGCAGGAAGCGCCGGCGGCAGAGGTGATGCTGTCCGGCTGCTCCCTGTGCCCGGTGTGCCACTCCCTGGTATACGACGAGGACATCATGGCCGGCTGGACCTCCGATGACTCCAACCTGAAAACCGTCTGCACCTTCTGCGGCAAATACTTTGTGCCCCTCCTGAACGTCAGGGTCACCGACCTGCAGAGCCGGCACAGTGCTTCCAAGGACTCCTCTGCCTCCCCCCAGCCTTCCACAAATGGAGACTCCCCAGTCCCTGGGGGGGCGGGGCCAGTGCTGAGCGACCGCTTCCAGTGTTTGGTGCTCGATGACCAAGGGACTGTGCGCCCCCCGTGCAATGGATACACCGACACCCAATTACAGCTGCCTGGGCCCAGTGCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCA
  5   1   2       bld Lun1      in                         CABD8134.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGTGCGAGCTCCGAGGTGGTTACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGG
  5   1   2       bld Lun1      in                         CABD7591.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACAT
  5   1   2       bld Ski1      in                         CABJ7074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGTGGCCTACCTTTGCCCGCTGGTTCTGCGCAAGGAGCTGGAGAGCCTACTGGAGAATGAAGGTGGAGATGTCCTTTCCCAGCCAGAGCTGGTCAACAGCCACCCAATCATCTACTGGAACCTTGTGTGGTACTTCAAGCGTATGGCACTGCCCAGTAACCTCCTTCAGCTGGTGTTGGCCTCCAAACACGTCCGGCAGCAGTCACAGGTGCTGGAGGTGCCGCAGGTGAGGGTGCGACTTCTGTGGGACGTGTTAATGCAGGACCCGGAGCGGTGGCCTCCTCTCTACGTCCTCTGGAAACTCAACAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGT
  5   1   2       bld Liv1      in                         CAAR7602.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAACCTCCCCACCCACCTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGGTTGTTTTTTATTTTTATTGTAAAATGGGACTGGTCCCGGGGNTCAGACT
  5   1   2       bld Gas7      in                         XZG33985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCATTCCTGGAACCACGCCCACCCCTTTACCCTGGAAGTTCTGGAGAAGATCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCACAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGAGTGCTGAGTGTGGCTCTTTGCAAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCGTGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCGGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCACCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGNGGGTGTTTTTATTTTATTGTAAATGGGACTGTCCTGGGGTCAGACTCACCGGCCCCCAGTTTATGTTGTCAGTATTAAGCAACGTGTAAATGT
  5   1   2       bld Ovi1      in                        CABI12713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCGGCACGAGGCTTGAATTTCGTAGGCCTCAACGAGGTTCATAAAGCAATTTCCCTGATCATAGGAATCTTACAGGAGCAGCCCTCCCCACCCCAGAGTATGCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGTAGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCC
  5   1   2       bld Tad5      in                         XZT39265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAGAGGGGAATATACCGGGAACTGCTACTCCTAACACTGGCTGCCCTCGGGAAGGATCACATGGATATTGGTGCATTTGATAATAAATACAAGACGGCCTTCAAGAAGCTAAGCAGCTCATTGGGGAAGGAAGAACTGAGAAGAAGAAGGGCCCAGTTCCCCACTCCCAAGGCGCTAGACTGTCGGAGAACCTTTGGGGCCACCCTGGATTGCTGAGTGTGGCTCTTTGCGAGCAGAACCAGGTAGTGGGTTTGCAACATGCACAGGAGAAAGTCTTCTGCTCCGCGTAGGAGGGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAC
  3   1   2       bld Ski1      in                         CABJ7074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTCAAAA
  3   1   2       bld Lun1      in                         CABD8134.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTCAAAAAA
  5  -1   2      seed Fat1      in                         CABC9367.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGAGATGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Lun1      in                         CABD7591.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGGGGCTGAGGAGCATCACTGTGATTGGCCCTCCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCACCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Ovi1      in                        CABI12713.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTGTGTAAATAGGTAACGCCCATCTCCACGTGCACATTCCCTCCATGACCGCTCGTCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Ski1      out                        CABJ3097.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATGTAATTTTAGACTGTTAAAAATAAAATGGTTTTAAATATCTTTAAAAAAAAAAAAAAAAAACAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Te4       out                        CAAN9455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Liv1      in                         CAAR7602.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCATCAAATGCCAGTTATGCCGTGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGGGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Gas7      in                         XZG33985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCATCAAATCCCAGTTATGCCGTGCAGCGGGATTCATAGGAAGGAGAAGACTGGTCCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTTTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCACCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCTGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAACTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCGGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Te4       out                         CAAN459.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGCAGGAGTCATAGGAAGGAGAAGACTGGTGCATGCTGGGATAGATGTAGGCCAATGGGGCAGCAGCTCTAATGGCCAATAGCAGAAGACATGGAGCCGTGGGCGTGTCTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Te3  PIPE out                        CAAM2915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGGGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTGGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGTGGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Te3       in                        CAAM14637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAAAGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGGGTCCCCGACGCGATTGGGCTCGTCTGGGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTTTTGTAAATGGGACTGTCCCGGGGTCAGACTCCCCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGGGTAAATGTTCCTTTATTTATTTCAACTTCGGTATTGGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGTGGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTC
  3   1   2       bld Tad5      in                         XZT39265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGCCCCCGAGCCGCCACGTGACCAGTGTTCATACTACTGCCATCACTTGCCAAAGCCGAACCCATTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGTGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAATGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCAGTATTAAGCAAACGTGTAAATGTTCCTTTATTTATTTCAACTTCTGTATTTGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCAGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas7      in                         XZG17795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGCCATCTCTTGCCAAAGCCGAACCCTTTAGCCAACCGGGCGTCCCCGACGCGATTGGGCTCGTCTGGGGGTCATGTGATCTTCTTGGCTGTCACATTTGGTTTTATAGGGGGGTTGTTTTTATTTTATTGTAAAGGGGACTGTCCCGGGGTCAGACTCACCGGCCCCAGTTTTATGTTGTCGGTATTAAGCAAACGGGTAAATGTTCCTTTATTTATTTCAACTTCGGTATTGGGTTTCTCCCCAGTCCCAGTATTTTACCCCCCCCCCCCCCGTATTGTTTACCCCCCCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAATTGTAACCCTTAGCTTGCCGAACACAAAGAGGAGGTGCCACTGCATAGGGGGCGGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAGGATTCATATGTTTCAAAAAAAAAAAAAAAGGGCGGCCGCAA
  3   1   2       bld Gas7      in                         XZG29255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATCCCTTCCCAAAGCGGAACCCTTTACCCACCCGGGGTTCCCCGACGGGATGGGGTTCTTTTGGGGGCCATGGGTTTTTTTGGGCTGTCCCATTGGGTTTTATAGGGGGGTGGTTTTTTTTTTTTTTAAAAGGGGACTTTCCCGGGGTCAGACTCCCCGGCCCCAGTTTTTTGTTGTCGGTTTTAACCAAAGGGGAAAAGGTCCCTTTTTTTTTTTCAACTTCGGTATTGGGTTTCCCCCCAGTCCCAGTTTTTTCCCCCCCCCCCATTTTGTTTCCCCCCCCGGGGGGTTACCCCGTTACTTTTTAGCCCCGGGGGGGGACAGTGGGCCCCCCCCCCGGGCCCCTTCATAGATTTTGCGGCCCA
  3   1   2       bld HeRe      in                     EC2CAA40DG10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGAGTGTTACCCCGTTACTCTTTAGCCCCAGGGACGGACAGTCGGCCCCACACACAGGCACCTTCATAGATTTTGCTGCTCAATCTTCCATTAAAGGGAACTGTAACCCTTAGCTTGCCGAGCACAAAGAGGAGGTGCCACTGCATAGGGGGCGGGGCAAGTGCCGCAGAACTGTCCCTCCCTGGCGCTCAGTGCAATATGATTGGAGCTTCGCTTTCCGAAGCTTTTTAT
  5   1   2       bld HeRe      in                     EC2CAA40DG10.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCTGCTCCATCTTCCCTTAAAGGGAACTGTAACCCTTATCTTGCCGAGCACAAAAAGGAGGTGCCACTGCATAAGGGGCGGGGCAAGTGCCGCAAAACTGTCCCTCCCTGGCGCTCACTGCAAAAAGAATGGAGCTTCGCTTTCCGAAGCTTTTTATTGTTTTGGAATTTGCTGGAAATAAAAAGATTCATATGTTTCTTATTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)