Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAL19929.5                           3 END     1           2       33                novel protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012154479 Xt7.1-CAAK5836.5.5 - 37 ESTs
                                                                       .......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAK5836.5.5                                                                                                  ATAGGCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAATAATATCGTTTTTCTTTTGTACAAAAGCACTAGAGAACGCACAGATCTACTTTGTGGACCAATCAATAAGTTATATATATATATATATTATAAATAGATAAATATATATATACTGATGAGAAGAGCTCTTAGTTACAGCGTGCACAAAAAAAAGTTGCACGATTTATTTATGTTTTATAAGAAAATGGAGGAAAAATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACTAAAAAAAAAATAAATAAATAAAAAAAAAGCAGCAGATTCGACCTACTGTGATCTGCCTTAGATGTGAGTCGATATTTTGTGTGCAACCAATTCTTAATCTAATTTCGAGCGAGTATTATGAGAACACACCTCTCTCTAACTAGGAAACTGATGTGTTATTTCAAGTGTGCAAAGTTTGTATGAATAAATTTTTGTA
                                                  Xt7.1-CHK-1008266483                                                                                                        AGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAATAATATCGTTTTTCTTTTGTACAAAAGCACTAGAGAACGCACAGATCTACTTTGTGGACCAATCAATAAGTTATATATATATATATATTATAAATAGATAAATATATATATACTGATGAGAAGAGCTCTTAGTTACAGCGTGCACAAAAAAAAGTTGCACGATTTATTTATGTTTTATAAGAAAATGGAGGAAAAATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACTAAAAAAAAAATAAATAAATAAAAAAAAAGCAGCAGATTCGACCTACTGTGATCTGCCTTAGATGTGAGTCGATATTTTGTGTGCAACCAATTCTTAATCTAATTTCGAGCGAGTATTATGAGAACACACCTCTCTCTAACTAGGAAACTGATGTGTTATTTCAAGTGTGCAAAGTTTGTATGAATAAATTTTTGTAAACAAC
                                                      consensus depths                                                                                                       5     6     6     7     6     8     6     8     6     8     7     8     7     8     7     8     7     9     7     9     7     9     8    10     8    10     8    10     9    10     9    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    16    16    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    17    18    16    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    17    18    16    17    16    16    15    15    15    15    13    13    11    11    10    11    10    11    10    11     9     9     7     9     7    10     7    10     7    10     7    10     5     8     5     8     5     8     6     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     8     7     8     7     8     7     7     7     7     6     6     6     6     6     6     6     7     6     7     6     7     5     7     5     6     3     4     1     3     1     3     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     4     5     5     6     5     6     5     6     5     7     5     7     5     8     5     8     5     8     4     7     6     8     6     8     6     8     6     8     6     9     6     9     6     9     6     9     6     9     6     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     4     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     4     4     4     4     7     7     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     4     6     6     7     6     7     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     3     3     2     3     3     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2      ests                                 Xt7.1-CAAK5836.5                                                                                                  ATAGGCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAAT
  5   1   2      ests                                Xt7.1-CAAL18560.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACTAAAAAAAAAATAAATAAATAAAAAAAAAGCAGCAGATTCGACCTACTGTGATCTGCCTTAGATGTGAGTCGATATTTTGTGTGCAACCAATTCTTAATCTAATTTCGAGCGAGTATTATGAGAACACACCTCTCTCTAACTAGGAAACTGATGTGTTATTTCAAGTGTGCAAAGTTTGTATGAATAAATTTTTGTAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------A--
                                               BLH ATG     660     337                                                                                                  
                                               BLH MIN     657      49                                                                                                  
                                               BLH MPR     654      49                                                                                                  
                                               BLH OVR     660     704                                                                                                  
                                               CDS MIN     660      49                                                                                                  
                                               EST CLI     -12      16                                                                                                  
                                               ORF LNG     660      23                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ---- 6e-036     NP_001001291.1 growth hormone-releasing hormone/pituitary adenylate cyclase-activating polypeptide precursor [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 1e-046     NP_001108.1 adenylate cyclase activating polypeptide precursor [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 3e-051     NP_033755.1 adenylate cyclase activating polypeptide 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ==== 7e-054     NP_999880.1 adenylate cyclase-activating peptide 1 like [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 2e-071     AAI36095.1 Unknown (protein for MGC:122889) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 2e-095     AAD56956.1 pituitary adenylate cyclase-activating peptide [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 2e-095     NP_001081947.1 pituitary adenylate cyclase-activating peptide [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAK5836.5.5                                                                                                                                                           TAG------------------TGA------TAG---TAG---------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------TAG---TGA------------------------------------------------------TGA------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------TAG------------------ATG---------------------------------------------------ATG------------ATG---------TAA---------------TAG------------------------TGA---TAA---------------------------------------------------ATG------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA------------TGA------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------TAATGA---------------------------------------TGA---------------------------------ATGATG------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------TGA------TAG------ATGTAG------TAG---TAA------------ATG------------TGA------------------------------------------------------TAGTAG------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------TAGATGTGA---------------------------TAA---------------------TGA---------------TAA---------TGA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  0   1   1           Brn4 FLsh                        CAAL9097.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                             GACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCACCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAATAATATCGTTTTTCTTTTGTACAAAAGCACTAGAGAACGCACAGATCTACTTTGTGGACCAATCAATAAGTTATATATATATATATATTATAAATAGATAAATATATATATACTGATGAGAAGAGCTCTTAGTTACAGCGTGCACAAAAAAAAGTTGCACGATTTATTTATGTTTTATAAGAAAATGGAGGAAAAATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAAAAAAAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAACAAAAAAAAAAAAAAA
  0   1   1           BrSp FL                   EC2BBA12AC03.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGTAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCattaaatgaatattttgataataaaaaaaaaaaaaaa
  5   1   2      ests                                 Xt7.1-CAAK5836.5                                                                                                  ATAGGCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAAT
                                                  Xt7.1-CHK-1008230540                                                                                                        AGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAATAATATC
  5   1   2       bld Brn3      in                         CAAK2803.5p CAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGAC
  5   1   2   14  bld Brn3 5g3  in                         CAAK5324.5p .....................................................................................CATGGAAAGGTAATAGGCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGNTTGAGAACGACCCTCTGGGCAT
  5   1   2   14  bld Brn4 5g3  in                        CAAL11993.5p .......................................................................................TGGAAAGGTAATTGGCAGACAAGCACTGACACAGCCAGCTAAAAGAGCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATGCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCC
  5   1   2   14  bld Brn3 5g3  in                        CAAK10847.5p ..........................................................................................AAAGGTAATAGGCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGG
  5   1   2   14  bld Brn3 5g3  in                         CAAK9964.5p ...........................................................................................AAGGTAATAGGCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCA
  5   1   2   14  bld Brn4 5g3  in                        CAAL20327.5p ...............................................................................................TAATAGGCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTANGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAA
  5   1   2   14 seed Brn3 5g3  in                         CAAK5836.5p .....................................................................................................GCAGACAAGCACTGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATATTGAGACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCC
  5   1   2       bld Tad5                                 XZT13485.5p                                                                                                                    TGACACAGCCAGCTAAAAGCCCTCTGCCTATTGCATGTGTGTAGGTATATATATATATATTGACACACATAGAAATAGCTGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGANAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGG
  5   1   2       bld BrSp 5g3  in                     EC2BBA34AC08.g1                                                                                                                                                                                           GGGGCATCCATTTATACAGATACACACGCAAGCAGACAAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGATAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCCAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATG
  5   1   2   14  bld Brn3 5g3  in                        CAAK11996.5p .....................................................................................................................................................................................................................................CAGAACAAGGGCTGGCCAAGTTGAATAAGCAGCAGCCCCAGCCCCAGCCTCAGCCCCAGCAGCAGCAGCAGAAGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCT
  5   1   2   14  bld Brn3 5g3  in                         CAAK2178.5p .............................................................................................................................................................................................................................................................................................................AGAAGAAAGCAGCTAGAGGACCGCCTCAGGAGAAGTATCTCAGAGAGGATCTCATCTCATTGTCAGCATCTCTGCCCAAGACTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGANAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCA
  5   1   2       bld Brn4 FLsh in                         CAAL9097.5p                                                                                                                                                                                                                                                                                                                                                                                               CTCATCACAGGCTGTTCCAGCTCTCGCTGCCTCCCTGGCTCCTTTGCTTTTCTAATCCTTTTATTCCCCACTATCTGCTTCTTTTACCTATACAGTAGCTAGGGAGCTTAGATCTATCCCCCCCACCACCCCTCTTTTGTCATTCGTCTGCCCCCTTTCCTCTGCTCAGCCGGAATCCACCTAATATTTTCCTTCTGGATTTGTGGCTTACATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCACCCAGTCATCCCCCAACTGACTGAACAAT
  5   1   2       bld BrSp 5g3  in                     EC2BBA14AE04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATCAAACTTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTA
  3   1   2       bld Brn4 5g3  in                        CAAL11993.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTTTAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTACNAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAACTAAAGCCATTAAATGAATATTTTGATAAT
  3   1   2       bld BrSp FL   in                     EC2BBA12AC03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGTAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATAAGTAAAGCC
  5   1   2       bld BrSp FL   in                     EC2BBA12AC03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGAATCGAAACCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGTAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCC
  3   1   2       bld Brn4 5x3  out                       CAAL19929.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCACAGCAACCTGCCAACTGTGAGACAGAACGATGCAGCTGCCCACTTTCTAACAGACAGGGGCACAAACTTACCGGGCACTTGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGAT
  3   1   2       bld Brn4 5g3  in                        CAAL20327.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGACAGAACGATGCAGCTGCCCACTTTCTACNAGACAGGGGCACAAACTTACCGGGCACTGGGCTCAATTCGAACCCAGGCAGCTCTCTGTACAGAAGGACTTGCTCTTTTATATGAAAGACAATGTGTAGGAAAGCGCTGCTCGCCTGGCTTCTGCTCTATGGCATCATGCGCTGCAGCGTCCACTCCTCACCTGCTGCGCTCAAGTACCCAGCACTTAGGCTAGAAGATGAAGTATATGATGAAGACGGCAACACTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGACATGCTGATGAACTATTAAACAAAGTCTATAGGAATGTGCTGGGGCATTTGTCTGCAAGAAAATACCTGCATACTCTGATGGCCCAACGCTTAGGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCCCCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGAT
  5   1   2       bld Tad5                                 XZT19901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTCCCAGACTTTGCGTTTGAGAACGACCCTCTGGGCATGGGGAACCCCTCCTCGGTCCTAGACGATATGTACTCATTTTATTACCCGCCGGAAAAGAGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCACCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                 XZT32719.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCATTGCAGAACGGTGAGTAGCAGCTTGGAAGACGAGTCGGAACCCTTATCTAAACGGCATTCAGATGGCATCTTCACCGACAGCTACAGTCGCTACAGAAAACAAATGGCTGTCAAGAAATACTTGGCAGCAGTGCTGGGGAAAAGGTATAAACAGAGAATTAAAAACAAAGGACGGCGTGTAGCATATTTGTAGCGATGAGTCTCCAGCAGCCACCTCGTGTGTACAGCCCTATCCACCCAGTCATCCCCCAACTGACTGAACAATCATCGCTCCTGTGTTATCTACAAACATGTATTTATGTATGAAGTAAAGCCATTAAATGAATATTTTGATAATAATATCGTTTTTCTTTTGTACAAAAGCACTAGAGAACGCACAGATCTACTTTGTGGACCAATCAATAAGTTATATATATATATATATTATAAATAGATAAATATATATATACTGATGAGAAGAGCTCTTAGTTACAGCGTGCACAAAAAAAAGTTGCACGATTTATTTATGTTTTATAAGAAAATGGAGGAAAAATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCCT
  5   1   2      ests                                Xt7.1-CAAL18560.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACTAAAAAAAAAATAAATAAATAAAAAAAAAGCAGCAGATTCGACCTACTGTGATCTGCCTTAGATGTGAGTCGATATTTTGTGTGCAACCAATTCTTAATCTAATTTCGAGCGAGTATTATGAGAACACACCTCTCTCTAACTAGGAAACTGATGTGTTATTTCAAGTGTGCAAAGTTTGTATGAATAAATTTTTGTAA
                                                  Xt7.1-CHK-1008231481                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACTAAAAAAAAAATAAATAAATAAAAAAAAAGCAGCAGATTCGACCTACTGTGATCTGCCTTAGATGTGAGTCGATATTTTGTGTGCAACCAATTCTTAATCTAATTTCGAGCGAGTATTATGAGAACACACCTCTCTCTAACTAGGAAACTGATGTGTTATTTCAAGTGTGCAAAGTTTGTATGAATAAATTTTTGTAAACAACG
  3   1   2       chi Brn4                                CAAL23529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       cacacacaggcagggtagggcaggcagcgtatggcacacataggcagcgtggggcaggcatagtatgctgcctgtgggaggtgaacctagcaggggtttgttctgggagtttgtcagcagttgtcaccattaaatggtccctaaaatgtgtaattatgtgatggggttgctgtgctatccacgggggaggtggaggcatatggatttaagggtatgtcttaacatgacataatataattctttcacatatgaatgacagttgatatccctgcagtgaggaccaagcatttgggtttttgctgcactgccaccattgtgataaaatgggtgtggtttgaagtgggtgtggcttaaagggggagtggtcaaattggcttccattagcagccctccaccatgtattctagagaaattccggccctcggcaccgcagaagttggacagcactgcactacTTGAATAAAGCACTTGTCTGATTCAGAATGCTCCAACCATCATCCTCCAACAAAAAACAGACAGCTGCAGACTCTACTAAAAAAAAAAAAAAAGGGCGGCCGCCCTTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGAC
  5   1   2       bld BrSp      in                    EC0CBA005DH11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCTCTTAGTTACAGCGTGCACAAAAAAAAAGTTGCACGATTTATTTATGTTTTATAAGAAAATGGAGGAAAAATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGA
  3   1   2       bld BrSp      in                    EC0CBA005DH11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGGAAAAATAAGGACAATCACTGTTTTAGAGATGTTCCTATTATTTTTGTAACTGAGATTAAAAGGATAGTATTTTTATCCACGACAGGGTCGAAGACATTACTATTGACCAAATGCAACTGGACATAAGTATTGATGCCCTTCTACAGGGGAGCTTTGATGCTAATGTTTGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn3 5g3  in                         CAAK2178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATAAGTATTGATGCCCTTCTACAGAGGAGCTTTGATGCTAATGTTTGGGGGGGAATGCTGAAGCAGATTCTTCCCTTGGGTGAGTCTNGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTATTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTAT
  3   1   2       bld BrSp 5g3  in                     EC2BBA14AE04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGCAGATTCTTCCCTTGGGTGAGTCTTGGATCAGGAGCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTTGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTTCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGT
  3   1   2       bld Brn4 FLsh in                         CAAL9097.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCCTAGTGAGACTGTTATGTCTATGGAGCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAAAAAAAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAAC
  3   1   2      skin Brn3 5g3  in                         CAAK5836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCCTGAACAACCTTTTTATCTAATTCTATTCCCTTTGCCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAAAAAAAAAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAAC
  3   1   2       bld Brn3 5g3  in                         CAAK5324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCTTTTGATTCTACCTTTATTTAGTTGTTTCTTCCAGCTGGGACTCGGTCCGTTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTATTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACGGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAAC
  3   1   2       bld BrSp 5g3  in                     EC2BBA34AC08.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGGTCAAATTCTCCCTTGCTGGCCAAGCAGCTCTGCCAAATTCTAAGCACTCTCTCCCAGATCCATTTAACTTTATGGGGAGAAGGAATACCACTCCAGCTTCTTATTGATTGGACCAGGCCAAAGTTTATAGCAACACTGACTGTATAATAATTGCCAGTTCTTTGACGAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTTCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCCGCTGCTCTTGTTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACAGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTCTACAT
  5   1   2       bld Brn4      in                        CAAL18560.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAAAAAAAACAACTGGAAGAGATACAGTTCAGATTGAAAAGAAACCGCCCAAAATGAAGTTATTGGTTCTGGGCTTGTTAATCCCTATAGGATTCAACAGAATTCCCACTGGGGGAGTCCTTTACCTAACTGACAATGGGCAGCTTGGTACTGCATGCAAAGTACTATGTGTTTCTCTCCGGTGCTGTCCATGCTATTCTCCATCATGTGGAAAACCCAACCTTCTCTCCTCCTCCTGAGCTTGTCATTGGCCACATTGCCTTGTTTTGCTTCCAGTAGAATTCTACCCACACCACCTGTCCTGCACTGACTACTGTTCCCCCCTCTCTCCATTGTAAGCAAGTCTGACTTTGTTTTGTTCTGCTGCTCTTATTGTAACCGTAGGAATCCCTGTTGTAGCTACGACTAAATAATGATGCACTACTATAACTGACGGTTTTGTTTCTTTGTTTTCTTGAGTCTTAAAGGTAAAAAGAAATGTATTTTTCTACATGATGGCTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATNGTGCTGATTNACAGTTATAATTCAGTACCCGCTGGGGTGGC
  3   1   2      seed Brn4      in                        CAAL18560.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACT
  5   1   2       bld Brn4      ?                          CAAL6442.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACTAAAAAAAAATAAATAAATAAAAAAAAAGCAGCAGATTCGACCTACTGTGATCTGCC
  3   1   2       bld Brn3 5g3  in                         CAAK9964.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGCTTAGTAAAAAGTTCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACT
  3   1   2       bld Brn3      in                         CAAK2803.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAGTCCATAAAAACAACGTTTTGTCATAATAGAATTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTCCCCGCTGGGGTGGCGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTAACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACT
  3   1   2       bld Brn3 5g3  in                        CAAK10847.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGTCATAATAGAANTTGTAAAATCCATCGATTCTTACCCCCTCCCCCTTCTCAAAAAGAAACAAAAATGTAGTCTTTCCAATGAAAGGTCTGTAGCCTCATCTTTTACAAAGGGATCATTGCTATGAAGCTGTTAGAGATTTATGTAGATTATTTAGCAGTAAATCACTTTAAAGATGAATGATTTGGAGTGAGAGCAGCGTGCGAGTCGCCAGTGTTTACAGATCAGGGCTGCGACAGGAAAGATTTAGTAGACGTCGCACCTGGACAGTCTGATCAGGAATCTCCCAATCTGTCACCTCCCTGATGTTGCTGATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACT
  3   1   2       bld Brn3 5g3  in                        CAAK11996.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTACAGTTATAATTCAGTACCCGCTGGGGTGGCAGATTGGAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGGGAATCAATCTTCCTCTAATTCTGCATTCTCCCCCTCAGGCAAAAGTGTGACCCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCCCGAATCGCAGATGGCTTGTTAGGGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGGGTATGCCTTGATAGGGGGTAGGTTTCCCGGTATTTTTGTATTAGCGGTAGGGTTCAAATAGGGGTTTCAGTTGAATTTTTTTTCAAACCTTTTCTATTTAGTACAGGGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTTTTTCAGAAGCGCCAAGAGCCTTTCTTCTAAAAAAAAAATAAATAAATAAAAAAAAAGCGGCGGATTCGCCCTACTGTGATCTGCCTTAGATGGGAGTCGATATTTTGGGGGCAACCAATTTTTAATTTAATTTCGGGGGGGTTTTATGGGAACCCCCCTCTCTTTAACTAGGAAACTGATGTGTTTTTTCAAGTGTGCAAAGTTTGTAGGAATAAATTTTTGTAAACACCGC
  5   1   2       bld Brn2                                 CAAJ6152.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAGCCCTGAGGCTATAGACACGGCTTTGTATTCCCTAGCGGATTCCCACATATCCTGCTGCAAACAGTTAATTGCAGAGAATCAATCTTCCTCTAATTCTGCATTCTCCACCTCAGGCAAAAGTGTGACGCAGGATGCAGGTTGCAGCTCCCGTGCCTTCCCCTCGCCTTTTATATCGCCACGAATCGCAGATGGCTTGTTAGTGGCCCTATGATGCTGCAAAACATCAGCTTGTATTTTAGTCTCCTCTGTGTATGCCTTGATAGTGGGTAGGTTTCCCTGTATTTTTGTATTAGCTGTAGTGTTCAAATAGGGGTTTCAGTTGAATTTTCTTTCAAACCTATTCTATCTAGTACAGTGGTTTTTCCGTATTTACCTAGCAAACCCTTTGTACATTATTTCAGAAGCGCCAAGAGCCTTACTACTAAAAAAAAAATAAATAAATAAAAAAAAAGCAGCAGATTCGACCTACTGTGATCTGCCTTAGATGTGAGTCGATATTTTGTGTGCAACCAATTCTTAATCTAATTTCGAGCGAGTATTATGAGAACACACCTCTCTCTAACTAGGAAACTGATGTGTTATTTCAAGTGTGCAAAGTTTGTATGAATAAATTTTTGTAAACAACGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)