Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 94%

 1012154489 Xt7.1-IMAGE:7003172.3.5 - 31 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     4     5     3     5     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     5     6     4     6     3     6     4     6     5     7     5     7     4     6     3     4     3     4     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     5     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     8     6     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     6     7     7     8    10    10     9    10    10    11    10    11    12    13    12    14    12    14    12    14    13    15    13    15    13    15    13    15    13    15    13    15    14    15    15    16    15    16    15    16    16    17    16    16    16    16    15    16    16    16    16    16    16    16    16    16    16    16    16    16    16    16    18    18    18    18    18    18    18    18    18    18    17    18    18    18    18    18    18    18    18    18    18    18    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    15    17    14    17    15    17    14    16    14    16    11    15    13    15    13    15    13    15    12    14    12    14    11    14    10    14     9    13     6    10     6    10     3     7     4     4
  5   1   2       e50                            Xt7.1-IMAGE:7003172.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCATTGTCCTCCAATAGTTCCTATTGGGTATGCCTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAAAAAAAAAAAAAAAAAAA
                                               BLH ATG     275     489                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     272     117                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     275     119                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       0      71                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     275      17                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Sc ---- 5e-014     NP_012529.1 Required for START A of cell cycle, and glucose and nitrogen repression ofsporulation; Cyr1p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Sp ---- 3e-023     XP_784844.2 PREDICTED: similar to Slit-1 protein [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Br ---- 2e-025     ABI32403.1 amphioxus leucine-rich repeat containing protein [Branchiostoma belcheri tsingtaunese] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Bf ---- 6e-026     AAM18891.1 unknown [Branchiostoma floridae] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ==== 6e-025     NP_491035.1 Protein with 11 leucine rich repeats, enriched in embryos (59.3 kD)[Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ci ==== 3e-028     AAX68499.1 type I transmembrane receptor [Ciona intestinalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 3e-030     NP_524055.2 tartan CG11280-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 3e-031     CAE54087.1 fibronectin leucine rich transmembrane protein 2 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 6e-039     XP_426419.1 PREDICTED: similar to KIAA1580 protein [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 1e-118     XP_692472.1 PREDICTED: similar to slit-like 2 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Dr ---- 5e-124     XP_697484.1 PREDICTED: similar to slit-like 2 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Mm ---- 3e-152     NP_647468.2 Slit-like 2 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Hs ---- 1e-156     NP_612449.2 slit-like 2 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          AAH76888.1 MGC88956 protein [Xenopus tropicalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                               Xt7.1-IMAGE:7003172.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAG------TGA---------------TAA------TGA---------------------------TAG---TGA---------------TAA---------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------TAA------------------------------------------------------------TAA------------------------------------ATG------------------------------------------------TAA---TGA------TAA------------------------------------------ATG------------------ATG---------TAG---------------------TAA------------------------------------------------------TAG------------------------TGA------------------TGA---------------TAG------------------------------TAG---TGA---ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2   22  bld Tad5 5g                              XZT23090.5p ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCGAGAGACACACAGAGAGAGAAGGAAAAGCTGGATTTAGCCAGGAGAGGGGGAAAGAGGGGGGAACTGGCTGAGGGAAATCAGAAACACTGAGAGAAAGAAAAACAATAAGTGAGCTGAGTGAGAGAGGGAACAGAAAGGGGAACATAGAAGTGAAGAAGAGAAAATATCTAAGGAAAGGTAGCAGGGAATAGAGCGGTGACATTCCCATCATCTGGATGCCATTTGTCTGTTGGAACCTGTACACAGTGCCAAGCCGTAAGGTCTCCCAAGATGTGGCATCTGCTAGTATGGATTATTCTGCTTGCCACTGCCCAACAGATGATTACTGAAGGTTGCCCAGCTGGCTGCCAGTGCAATACGCCACAGACCGTGTTCTGCCTTGCACGCAAGAACTCAAACTTCCCACGAAGTGTGCCCCCTGACACTCTCAATCTGTATGTATTTGAGAATGGCATCAGCTCCATCGAGGAGAGCAGTTTTATTGGGCTAAATGGTTTACATCTCCTAGACCTCTCTCACAACCAATTATCTAGTCTCCCAGGTGGAGTATTCAGGAACTTGGCCAACCTGAGCAACCTAGACCTTACATCCAACCAGCTGACAGAGATCTCTGCAGACACCTTTCAGGGTCTGAGCCGGCTGGAGAGGCTGTACCTCAATGGAAACCGTATCCGCAGCATTCACCCAGAAGCTTTTAAGGGTATTGAAAGTCTGCTGGAAACTCAGCTGAGNCACAACCAACTGGTAACACCTCCAGCTTTTTCTCTGCCCCATCTCTTGCTCCTTGATCTGAGCTAC
  5   1   2   10  bld Limb 5g3  in                        CBSU7614.fwd ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCGAGAGACACACGGAGAGAGAAGGAAAAGCTGGATTTAGCCAGGAGAGGGGGAAAGAGGGGGGAACTGGCTGAGGGAAATTAGAAACACTGAGAGAAAGAAAAACAATAAGTGAGCTGAGTGAGAGAGGGAACAGAAAGGGGAACATAGAAGTGAAGAAGAGAAAATATCTAAGGAAAGGTAGCAGGGAATAGAGCGGTGACATTCCCATCATCTGGATGCCATTTGTCTGCTGGAACCTGTACACAGTGCCAAGCCGTAAGGTCTCCCAAGATGTGGCATCTGCTAGTATGGATTATTCTGCTTGCCACTGCCCAACAGATGATTACTGAAGGTTGCCCAGCTGGCTGCCAGTGCAATACGCCACAGACCGTGTTCTGCCTTGCACGCAAGAACTCAAACTTCCCACGAAGTGTGCCCCCTGACACTCTCAATCTGTATGTATTTGAGAATGGCATCAGCTCCATCGAGGAGAGCAGTTTTATTGGGCTAAATGGTTTACATCTCCTAGACCTCTCTCACAACCAATTATCTAGTCTCCCAGGTGGAGTATTCAGGAACTTGGCCAACCTGAGCAACCTAGACCTTACATCCAACCAGCTGACAGAGATCTCTGCAGACACCTTTCAGGGTCTGAGCCGGCTGGAGAGGCTGTACCTCAATGGAAACCGTATCCGCAGCATTCACCCAGAAGCTTTTAAGGGTATTGAAAGTCTGCTGGAACTNCAGCTGAGCAACAACAACTGGTAACACCTCCAGCTTTTTCTCTGCCCCATCTCTTGCTCCTTGATCTGAGCTACA
  5   1   2   10  bld Tbd1 5g3  in                        CBXT20627.b1 ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAGCGAGACACACACGGAGAGAGAAGGAAAAGCTGGATTTAGCCAGGAGGGGGAAAGAGGGGGGAACTGGCTGAGGGAAATTACAAACACTGAGAGAAAGAAAAACAATAAGTGAGCTGAGTGAGAGAGGGAACAGAAAGGGGAACATAGAAGTGAAGAAGAGAAAATATCTAAGGAAAGGTAGCAGGGAATAGAGCGGTGACATTCCCATCATCTGGATGCCATTTGTCTGCTGGAACCTGTACACAGTGCCAAGCCGTAAGGTCTCCCAAGATGTGGCATCTGCTAGTATGGATTATTCTGCTTGCCACTGCCCAACAGATGATTACTGAAGGTTGCCCAGCTGGCTGCCAGTGCAATACGCCACAGACCGTGTTCTGCCTTGCACGCAAGAACTCAAACTTCCTACGAAGTGTGCCCCCTGACACTCTCAATCTGTATGTATTTGAGAATGGCATCAGCTCCATCGAGGAGAGCAGTTTTATTGGGCTAAATGGTTTACATCTCCTAGACCTCTCTCACAACCAATTATCTAGTCTCCCAGGTGGAGTATTCAGGAACTTGGCCAACCTGAGCAACCTAGACCTTACATCCAACCAGCTGACAGAGATCTCTGCAGACACCTTTCAGGGTCTGAGCCGGCTGGAGAGGCTGTACCTCAATGGAAACCGTATCCGCAGCATTCACCCAGAAGCTTTTAAGGGTATTGAAAGTCTGCTGGAACTCAAGCTGAGCAACAACCAACTGGTAACACCTCCAGCTTTTTCTCTGCCCCATCT
  5   1   2       bld Abd0 FL   in                       IMAGE:7003172                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGACACACACGGAGAGAGAAGGAAAAGCTGGATTTAGCCAGGAGGGGGAAAGAGGGGGGAACTGGCTGAGGGAAATTACAAACACTGAGAGAAAGAAAAACAATAAGTGAGCTGAGTGAGAGAGGGAACAGAAAGGGGAACATAGAAGTGAAGAAGAGAAAATATCTAAGGAAAGGTAGCAGGGAATAGAGCGGTGACATTCCCATCATCTGGATGCCATTTGTCTGCTGGAACCTGTACACAGTGCCAAGCCGTAAGGTCTCCCAAGATGTGGCATCTGCTAGTATGGATTATTCTGCTTGCCACTGCCCAACAGATGATTACTGAAGGTTGCCCAGCTGGCTGCCAGTGCAATACGCCACAGACCGTGTTCTGCCTTGCACGCAAGAACTCAAACTTCCCACGAAGTGTGCCCCCTGACACTCTCAATCTGTATGTATTTGAGAATGGCATCAGCTCCATCGAGGAGAGCAGTTTTATTGGGCTAAATGGTTTACATCTCCTAGACCTCTCTCACAACCAATTATCTAGTCTCCCAGGTGGAGTATTCAGGAACTTGGCCAACCTGAGCAACCTAGACCTTACATCCAACCAGCTGACAGAGATCTCTGCAGACACCTTTCAGGGTCTGAGCCGGCTGGAGAGGCTGTACCTCAATGGAAACCGTATCCGCAGCATTCACCCAGAAGCTTTTAAGGGTATTGAAAGTCTGCTGGAACTCAAGCTGAAGCACAACCAACTGGTAACACCTCCAGCTTTTTCTCTGCCCCATCTCTTGCTCCTTGATCTGAGCTACAATGCAATTTCCTGTAATCCAAACAGGGGGTCCTTTAATGCCAGGCAATATTTGA
  5   1   2       bld HdA  5g3  in                  THdA024j05.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGACCACAGAGAGAGAAGGAAAAGCTGGATTTAGCCAGGAGAGGGGGAAAGAGGGGGGAACTGGCTGAGGGAAATCAGAAACACTGAGAGAAAGAAAAACAATAAGTGAGCTGAGTGAGAGAGGGAACAGAAAGGGGAACATAGAAGTGAAGAAGAGAAAATATCTAAGGAAAGGTAGCAGGGAATAGAGCGGTGACATTCCCATCATCTGGATGCCATTTGTCTGTTGGAACCTGTACACAGTGCCAAGCCGTAAGGTCTCCCAAGATGTGGCATCTGCTAGTATGGATTATTCTGCTTGCCACTGCCCAACAGATGATTACTGAAGGTTGCCCAGCTGGCTGCCAGTGCAATACGCCACAGACCGTGTTCTGCCTTGCACGCAAGAACTCAAACTTCCCACGAAGTGTGCCCCCTGACACTCTCAATCTGTATGTATTTGAGAATGGCATCAGCTCCATCGAGGAGAGCAGTTTTATTGGGCTAAATGGTTTACATCTCCTAGACCTCTCTCACAACCAATTATCTAGTCTCCCAGGTGGAGTATTCAGGAACTTGGCCAACCTGAGCAACCTAGACCTTACATCCAACCAGCTGACAGAGATCTCTGCAGACACCTTTCAGGGTCTGAGCCGGCTGGAGAGGCTGTACCTNCATGGANACCGTATCCGCAGCATTCACCCAGAAGCTTTTAAGGGGTATTGGAAAGTCTGCTGGAACTCAAGCTGAGCAANCACCNACTGGNTACACCTCCAGCTTTTTCTCTGCCCCATCTCTTGCTCCTTGATCTGAGCTACAATGCAATTCCTGTA
  5   1   2       bld Tad5      in                         XZT18879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAACCAGCTGACAGAGATCTCTGCAGACACCTTTCAGGGTCTGAGCCGGCTGGAGAGGCTGTACCTCAATGGAAACCGTATCCGCAGCATTCACCCAGAAGCTTTTAAGGGTATTGAAAGTCTGCTGGAACTCAAGCTGAGCAACAACCAACTGGTAACACCTCCAGCTTTTTCTCTGCCCCATCTCTTGCTCCTTGATCTGAGCTACAATGCAATTCCTGTAATCCAACAAGGGGTCTTTAATGCAGGCAATATTGAGTCTCTTCGTCTTGCTGGTCTTGGTTTGAAAGAAGTACCAGAAGAGTTGCTGAGTGGCCTCAAGAACCTTCATGAACTTGACCTGTCTGACAACCAGCTGGACAAAGTACCTCCTGGGCTGCATGGGTTGACAAAACTAAACATTGCTGGTAATGTGGGATTCTCTCAGATCCAAGTGGATGACCTTTCAAACCTTCCTGCACTACAAGAGCTAGATTTAAGTGGGCTCAGCCTACAAACCCTGCCAAAGGGTCTATTTAGATCTTCCAAACGCCTGCGGGCTGTGAGCCTGGCACAAAATCCATTCAACTGTGTTTGCTCGCTAGGCTGGTTATCAGAATGGATGCGGGTTAGTGGAGTGGTACTGCTGCGGCCAGATGAGACACGCTGCCATTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCNCACAACAATGCCACCAAGCACCACCACTGGGCCCACCACAACCACTAAGCACTTGCAGACT
  5   1   2       bld Tbd0      in                       IMAGE:6976296                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCCAGCTTTTTCTCTGCCCCATCTCTTGCTCCTTGATCTGAGCTACAATGCAATTCCTGTAATCCAACAAGGGGTCTTTAATGCAGGCAATATTGAGTCTCTTCGTCTTGCTGGTCTTGGTTTGAAAGAAGTACCAGAAGAGTTGCTGAGTGGCCTCAAGAACCTTCATGAACTTGACCTGTCTGACAACCAGCTGGACAAAGTACCTCCAGGGCTGCATGGGTTGACAAAACTAAACATTGCTGGTAATGTGGGATTCTCTCAGATCCAAGTGGATGACCTTTCAAACCTTCCTGCACTACAAGAGCTAGATTTAAGTGGGCTCAGCCTACAAACCCTGCCAAAGGGTCTATTTAGATCTTCCAAACGCCTGCGGGCTGTGAGCCTGGCACAAAATCCATTCAACTGTGTTTGCTCGCTAGGCTGGTTATCAGAATGGATGCGGGTTAGTGGAGTGGTACTGCTGCGGCCAGATGAGACACGCTGCCATTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCCATCAACAATGCCACCAAGCACCACCACTGGGCCACCCACAACCACTAAGCACTTGCAGACTGAAGCCCCAACTACTGCCTCCACTACAACTACCACCATCCCTCACCAGGAGCAGGAAGAAGACACTCAACCATTTCAATTTGACTTTGAAGACACTTTGTGCCCACCCCAGACTTGTCTGAATGGAGGTTCCTGCCATCTAGATCCCCACTGGCCAACTGGAATGTGAATGCCCACCCTGGATTTCAGGGCACCCTATTGCGAAAACTGGTCCAGTCCCACCAGCTTGTTAGTTAC
  5   1   2       bld HeRe      in                     EC2CAA17CH11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGACAAAACTAAACATTGCTGGTAATGTGGGATTCTCTCAGATCCAAGTGGATGACCTTTCAAACCTTCCTGCACTACAAGAGCTAGATTTAAGTGGGCTCAGCCTACAAACCCTGCCAAAGGGTCTATTTAGATCTTCCAAACGCCTGCGGGCTGTGAGCCTGGCACAAAATCCATTCAACTGTGTTTGCTCGCTAGGCTGGTTATCAGAATGGATGCGGGTTAGTGGAGTGGTACTGCTGCGGCCAGATGAGACACGCTGCCATTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCCAACAACAATGCCACCAAGCACCACCACTGGGCCACCCACAACCACTAAGCCCTTGCAGACTGAAGCCCCAACTACTGCCTCCACTACAACTACCACCATCCCTCACCAGGAGCAGGAAGAAGACACTCAACCATTTCAATTTGACTTTGAAGACACTTTGTGCCCACCCCAGACTTGTCTGAATGGAGGTTCCTGCCATCTAGATCCCACTGGCCAACTGGAATGTGAATGCCCACCTGGATTTCAGGGCACCTATTGCGAGACTGGTCCAGTCACACCAGCTGTAGTTACAGAGATGTAC
  5   1   2       bld Abd0                               IMAGE:7017702                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAATGTGGGATTCTCTCAGATCCAAGTGGATGACCTTTCAAACCTTCCTGCACTACAAGAGCTAGATTTAAGTGGGCTCAGCCTACAAACCCTGCCAAAGGGTCTATTTAGATCTTCCAAACGCCTGCGGGCTGTGAGCCTGGCACAAAATCCATTCAACTGTGTTTGCTCGCTAGGCTGGTTATCAGAATGGATGCGGGTTAGTGGAGTGGTACTGCTGCGGCCAGATGAGACACGCTGCCATTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCCATCAACAATGCCACCAAGCACCACCACTGGGCCACCCACAACCACTAAGCACTTGCAGACTGAAGCCCCAACTACTGCCTCCACTACAACTACCACCATCCCTCACCAGGAGCAGGAAGAAGACACTCAACCATTTCAATTTGACTTTGAAGACACTTTGTGCCCACCCCAGACTTGTCTGAATGGAGGTTCCTGCCATCTAGATCCCACTGGCCAACTGGAATGTGAATGCCCACCTGGATTTCAGGGCACCTATTGCGAGACTGGTCCAGTCACACCAGCTGTAGTTACAGAGATGTACATAGAACAGGTGAAAATCATTGAAGTGACCGTTAGCTCTATTCGAGTTGATCTTCAAAGTTACAGCCAAAACAAAGAAAAGCTAG
  5   1   2       bld Eye       in                         CCAX6532.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCTACAAACCCTGCCAAAGGGTCTATTTAGATCTTCCAAACGCCTGCGGGCTGTGAGCCTGGCACAAAATCCATTCAACTGTGTTTGCTCGCTAGGCTGGTTATCAGAATGGATGCGGGTTAGTGGAGTGGTACTGCTGCGGCCAGATGAGACACGCTGCCATTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCCATCAACAATGCCACCAAGCACCACCACTGGGCCACCCACAATCACTAAGCACTTGCAGACTGAAGCCCCAACTACTGCCTCCACTACAACTACCACCATCCCTCACCAGGAGCAGGAAGAAGACACTCAACCATTTCAATTTGACTTTGAAGACACTTTGTGCCCACCCCAGACTTGTCTGAATGGAGGTTCCTGCCATCTAGATCCCACTGGCCAACTGGAATGTGAATGCCCACCTGGATTTCAGGGCACCTATTGCGAGACTGGTCCAGTCACACCAGCTGTAGTTACAGAGATGTACATAGAACAGGTGAAAATCATTGAAGTGACCGTTAGCTCTATTCGAGTTGATCTTCAAAGTTACAGCCAAAACAAAGAAAAGCTAAGGGCAATCAGACTAACTGTGCGTAATCTGTATGGTGCAGACCGTCGGCCTATGATATATAAGTTACCTCCTACTCTGCCTGAATACACAGTGAGGGCAT
  5   1   2       bld Tbd1      in                        CBXT13744.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTAGATCTTCCAAACGCCTGCGGGCTGTGAGCCTGGCACAAAATCCATTCAACTGTGTTTGCTCGCTAGGCTGGTTATCAGAATGGATGCGGGTTAGTGGAGTGGTACTGCTGCGGCCAGATGAGACACGCTGCCATTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCCATCAACAATGCCACCAAGCACCACCACTGGGCCACCCACAACCACTAAGCACTTGCAGACTGAAGCCCCAACTACTGCCTCCACTACAACTACCACCATCCCTCACCAGGAGCAGGAAGAAGACACTCAACCATTTCAATTTGACTTTGAAGACACTTTGTGCCCACCCCAGACTTGTCTGAATGGAGGTTCCTGCCATCTAGATCCCACTGGCCAACTGGAATGTGAATGCCCACCTGGATTTCAGGGCACCTATTGCGAGACTGGTCCAGTCACACCAGCTGTAGTTACAGAGATGTACATAGAACAGGTGAAAATCATTGAAGTGACCGTTAGCTCTATTCGAGTTGATCTTCAAAGTTACAGCCAAAACAAAGAAAAGCTAAGGGCAATCAGACTAACTGTGCGTAATCTGTATGGTGCAGACCGTCGGCCTATGATATATAAGTTACCTCCTACTCTGCCTGAATACACAGTGAGGGCATTGTCCTCCAATAGTTCCTATTGGGTATGCCTT
  5   1   2      seed Ovi1      in                         CABI5443.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACGCCTGCGGGCTGTGAGCCTGGCACAAAATCCATTCAACTGTGTTTGCTCGCTAGGCTGGTTATCAGAATGGATGCGGGTTAGTGGAGTGGTACTGCTGCGGCCAGATGAGACACGCTGCCATTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCCATCAACAATGCCACCAAGCACCACCACTGGGCCACCCACAACCACTAAGCACTTGCAGACTGAAGCCCCAACTACTGCCTCCACTACAACTACCACCATCCCTCACCAGGAGCAGGAAGAAGACACTCAACCATTTCAATTTGACTTTGAAGACACTTTGTGCCCACCCCAGACTTGTCTGAATGGAGGTTCCTGCCATCTAGATCCCACTGGCCAACTGGAATGTGAATGCCCACCTGGATTTCAGGGCACCTATTGCGAGACTGGTCCAGTCACACCAGCTGTAGTTACAGAGATGTACATAGAACAGGTGAAAATCATTGAAGTGACCGTTAGCTCTATTCGAGTTGATCTTCAAAGTTACAGCCAAAACAAAGAAAAGCTAAGGGCAATCAGACTAACTGTGCGTAATCTGTATGGTGCAGACCGTCGGCCTATGATATATAAGTTACCTCCTACTCTGCCTGAATACACAGTGAGGGCATTGTCCTCCAATAGTTCCTATTGNGTATGCCTTGNGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAA
  5   1   2       bld In62                            IMAGE:8953469.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGATTAAAGAAAGAGATGAAAAGAATTCGAATTCGTCCCTTTTCCTCCTAAAAATGCTGGCAAGACTTTGAGGCAGCTGCGGGATTCTGAGTATGGATGCCCAGCACCAACAACTATTCAGATGCCAACAACAATGCCACCAAGCACCACCACTGGGCCACCCACAACCACTAAGCACTTGCAGACTGAAGCCCCAACTACTGCCTCCACTACAACTACCACCATCCCTCACCAGGAGCAGGAAGAAGACACTCAACCATTTCAATTTGACTTTGAAGACACTTTGTGCCCACCCCAGACTTGTCTGAATGGAGGTTCCTGCCATCTAGATCCCACTGGCCAACTGGAATGTGAATGCCCACCTGGATTTCAGGGCACCTATTGCGAGACTGGTCCAGTCACACCAGCTGTAGTTACAGAGATGTACATAGAACAGGTGAAAATCATTGAAGTGACCGTTAGCTCTATTCGAGTTGATCTTCAAAGTTACAGCCAAAACAAAGAAAAGCTAAGGGCAATCAGACTAACTGTGCGTAATCTGTATGGTGCAGACCGTCGGCCTATGATATATAAGTTACCTCCTACTCTGCCTGAATACACAGTGAGGGCATTGTCCTCCAATAGTTCCTATTGGGTATGCCTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAAGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCATCCCAAGAAAGAAACCTTTACCCTTGTGCTAGTGCCTGCGTTGCTGCTGGGATCCTTCTGTCTGCAGCATAACAGCGCACTGCTATGCTAGAAAACGTAAGGAAAGGGACCCCTGTTGAGATTGTGGTCCTCTAGAATGATGGAGTATAAAAGAACTAGATGGCACGGTGAGGTCAATACTTATCATGATCCACTGTGACCTGAACATGTGTTAATCCAGGACCTAATGATCACCAGGATGGGGTACCAACTAAGGTATGC
  5   1   2       e50                            Xt7.1-IMAGE:7003172.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCATTGTCCTCCAATAGTTCCTATTGGGTATGCCTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008231367                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCCTCCAATAGTTCCTATTGGGTATGCCTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAAAAAAAAAAAAA
  3  -1   2       bld Tbd1 5x3  out                       CBXT18741.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGCGATCTAGAACTAGTGACCGTCGGCCTATGATATATAAGTTACCTCCTACTCTGCCTGAATACACAGTGAGGGCATTGTCCTCCAATAGTTCCTATTGGGTATGCCTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAG
  3   1   2       bld Tbd0      in                       IMAGE:6976296                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATTATAAGAGTTAACCTGGCCTAAATTACGGCCCTGAATAACCCCCAGGAGAGGGGCATTGTTCCCTTCCAAATAATTTCCCTAATTGGGGAATCGCCTTGGGGTCACCAAGGGTGAAGGGAGGTCCCAGAAGAAGGATCTGTGCCCTGAAAACTCACACTTAGGGAGAACCTCCAAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAACCCTTACCCCGGTGTTAGTGCCTGCGGTGGCTGCTGGGATCTTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTC
  5   1   2       bld Tbd1      in                        CBXT12589.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTGAGGGCATTGTCCTCCAATAGTTCCTATTGGGTATGCCTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCT
  3   1   2       bld Abd0 FL   in                       IMAGE:7003172                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATTGGGTATGCCNTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACTTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAA
  3   1   2      seed Ovi1      in                         CABI5443.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATGGGGTATGCCTTGGGTCACAGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCNCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGG
  5   1   2       bld HdA       in                  THdA013l02.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCGGGGCCCGGGGGTGAGGGAGGTCCAGAAGAGGATCTGTGCACTGAAACTCACACTTTAGGAGAACCTCCAAAGCACAGTCCCCAAGTCACCCAATCCCAAGAAGGAAACCTTACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAG
  3   1   2       bld Limb 5g3  in                        CBSU7614.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACCTTACCCTGGTGCTAGTGCCTGCAGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTAC
  3   1   2       bld Tad5      in                         XZT18879.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCCTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGACAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTAAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAACCCTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Tbd1      in                        CBXT12589.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGTGCTAGTGCCTGCGGTGGCTGCTGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1 5g3  in                        CBXT20627.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGGATCCTTCTGTCTGCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAACAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA17CH11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCCGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGGCTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCACAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTAAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTATTCATGCCAGGATACAAAACT
  3   1   2       bld HdA  5x3  out                   THdA009c24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGCAGTAGCAGCCGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTTTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGAGTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGCCCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGAATGGCGCCTTTTAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tbd1      in                        CBXT13744.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCAGCTTGCTATGCTAGGAGACGTAAGGGAAAGGGACACTCTGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX6532.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTGAGGATGGTGGTCCTCTAGAAATGGATGGAGTAAAAAAAGGACTAGATGGGAAGGGTGAGGTCAAAAAACTATCAGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATAATGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTAC
  3   1   2       bld HdA  5g3  in                    THdA024j05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGAGGATCCAACTGGGCCTGAAAAAACTGGTGCAGAATCAGAGGAGCCTCTAATGGACTCAACAAGGATTGGGAACAATATTGATGCACCCACAGGCAGACTCCCTCATTCATATTTCTAACCAAGGCACAGATATGGTGACTGTGAAATCTTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAAGCTTATTTCCATTTAATAAAGACTTTCTTCAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld HdA       in                    THdA013l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCCTCTAATGAGCTCAACAAGGATTGGGAACAATAGAGATGCACCCACAGGCGAAATCCCTCATTCATATTTCTAACCAAGGCACAGATAAGGTGACTGTGAAATATTTTATTTGGTCGGTATACACTCCCAGTCATAAGATGATTGGACTTTGAGAACATCTTGGTGCAAGGCAATGAAAAGTGCAACAACAGCTTTATCATCTTTGGTGAAGAGTGCCCCAAAGTAAGCCTGACGAGCTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCCCAGTGTTACACATGATACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTGAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATCCCCTACCAATTTTGGAGAGACCGTAGGGATTTTCATTCAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGCCCTGGATTTTTAGGTGCC
  5   1   2       bld Neu       in                   TNeu089g09.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTACAACCC
  3   1   2       bld Neu       in                    TNeu089g09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCCAGTCATAAGATGATTGGACTTTGAGAACATCATGGTGCAAGGCAATGAAAAGTGCAACAACTGCTTTCTCATCTTTGGTGAAGAGTGCCAGAAAGTAAGCCTGACGTACTTAAGCACTGCTTTGGAGCTTCTGCCGTCGCAGCACAGTGTTACACATGCTACCGCTTGGAGAGGCAATGTCCAAGAGATAGTTATTCACAGACTCTAAACATTAAGGAACAGTTGGTCTTTTTTTTCAGACTGATACCCTACCAAGTTTGGAGAGACTGTAGGGATTTTCATTTAGGCTGGACCTGTGAAGGGGAAAAGTCAAGTTTTGATTGGGCCTGGATTTTTAGGTGCCTATTGCTGGACAAGATGGCGCCTTATAGTATTGATTCATGCCAGGATACAAAACTTATTTCCATTTAATAAAGACTTTCTTNAACCCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (