Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK12890.5                           4 END     4          14      100                Unknown (protein for MGC:80884) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012154532 Xt7.1-CABD2529.5.5 - 28 ESTs
                                                                       .........-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABD2529.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACCTGAGGGTAACCAGGCTTCTGTCCGGGGAGAGTACGGGCAGCGAATCGTCTATAGAGAGCAACCAGGATGCTGGCCCCATCACTAACGGGTTCGAAGAGTGCAGAGAACCAGAGACTGTATGAGTAGGGCCACATGGGCCCAGGGACTGTCTCATACAGACTCACTGTGACCCATTTAAAGCCAGAGGCTCTGCCCAGATCAGTGGCACCTGGGGGGATTCATTTCTTTCAGCAGGGGTGCCAACCTGGTCCTTTCTTTTCATCTTCAGAACAGACCACTAACATGCAGTTTCCAATAGGTGATTTAATTTAAAATGACCTGGTACCATATTTTATTGAGATTTGATTCCCTTGTGGCACCTCTATCCTACAGGAAATGCCATTTGCCATGGAACTGAAGGAGCCCATAGAACCTGTGTGATTGTCAGGATCCTTATTGCTGATATAGATTGGGGTTCACCAACTAGCAGCCCTCTGCTTGTATGAATTATACCCAGACTTAAGCTGTTGGGGGTATCAGGTGGCCAGGCATCCTTGAGTAGCTATAATGCCTTGCACTTAATGTAATTTTGTTAAAATGAATGCTGAATTATGAAACTTGAGGTGGTGGAGAGGAAAGGGAGCACCAGTGGAATACATGCTGACAACAGTATGGGTGTATGCAAGGGATCTATTTATAAAATGGGGAGGGGAAGGTGAATGCCATGAAAATAGAAACCAGGTTCCGTTACTGGCCAGTAACAGATTTGTGATGTTAGTGAGTGTCAGATGACTGTACATTGCACTGTGTTGCATATGTTTCTGACACTCTGGTTTAACTACCCTTTGTAGCAGTGAATGTGTTGAGGTGAATTAATGTGTAAGCCCCTATGTCTTACAGAATATAGAGTCTTTATCTATGGGAAAAATCTAATTATAATATCACCCAAAGCTATTACATGTAGTAAAAACTGGTTCACTGCTATAGATTCCAGGGTCACAGGGGCCAAAGGGCGAAGAGACAATCCTGCACAGATGTCTCCAAGAGCTTATGCAAATAAATAAGGTTTAGAGGAGTACTCTTAGCAAATTGTCTCTTCACCTTATGATCAATATACCCCTGACTAGTGTGGTGAAGATGCAGAGGATTTGTGGAAGTGATTATAAGATGTACATGGCTTACATCTCCTAGTAAGGAATGTGTTACAGCAAAGTCATGGATAACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAGTTAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008265134                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGGTAACCAGGCTTCTGTCCGGGGAGAGTACGGGCAGCGAATCGTCTATAGAGAGCAACCAGGATGCTGGCCCCATCACTAACGGGTTCGAAGAGTGCAGAGAACCAGAGACTGTATGAGTAGGGCCACATGGGCCCAGGGACTGTCTCATACAGACTCACTGTGACCCATTTAAAGCCAGAGGCTCTGCCCAGATCAGTGGCACCTGGGGGGATTCATTTCTTTCAGCAGGGGTGCCAACCTGGTCCTTTCTTTTCATCTTCAGAACAGACCACTAACATGCAGTTTCCAATAGGTGATTTAATTTAAAATGACCTGGTACCATATTTTATTGAGATTTGATTCCCTTGTGGCACCTCTATCCTACAGGAAATGCCATTTGCCATGGAACTGAAGGAGCCCATAGAACCTGTGTGATTGTCAGGATCCTTATTGCTGATATAGATTGGGGTTCACCAACTAGCAGCCCTCTGCTTGTATGAATTATACCCAGACTTAAGCTGTTGGGGGTATCAGGTGGCCAGGCATCCTTGAGTAGCTATAATGCCTTGCACTTAATGTAATTTTGTTAAAATGAATGCTGAATTATGAAACTTGAGGTGGTGGAGAGGAAAGGGAGCACCAGTGGAATACATGCTGACAACAGTATGGGTGTATGCAAGGGATCTATxTxTAxAATGGGGxGGGxAAGGTGAATGCCATGAAAATAGAAACCAGGTTCCGTTACTGGCCAGTAACAGATTTGTGATGTTAGTGAGTGTCAGATGACTGTACATTGCACTGTGTTGCATATGTTTCTGACACTCTGGTTTAACTACCCTTTGTAGCAGTGAATGTGTTGAGGTGAATTAATGTGTAAGCCCCTATGTCTTACAGAATATAGAGTCTTTATCTATGGGAAAAATCTAATTATAATATCACCCAAAGCTATTACATGTAGTAAAAACTGGTTCACTGCTATAGATTCCAGGGTCACAGGGGCCAAAGGGCGAAGAGACAATCCTGCACAGATGTCTCCAAGAGCTTATGCAAATAAATAAGGTTTAGAGGAGTACTCTTAGCAAATTGTCTCTTCACCTTATGATCAATATACCCCTGACTAGTGTGGTGAAGATGCAGAGGATTTGTGGAAGTGATTATAAGATGTACATGGCTTACATCTCCTAGTAAGGAATGTGTTACAGCAAAGTCATGGATAACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAxxxAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     5     4     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     6     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     5     5     5     7     7     6     6     6     6     6     6     6     6     6     6     8     9     8     9     9    11     9    11    10    12    12    12    14    14    14    14    14    15    14    16    15    17    15    17    16    18    16    18    16    18    16    18    16    18    15    17    15    17    15    17    15    17    15    17    15    19    15    19    17    19    17    19    16    19    16    19    16    19    16    19    16    18    15    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    18    17    18    18    18    17    17    17    17    17    17    17    17    17    17    17    17     8    17     8    17     8    17     8    17     8    17     8    17     8    17     8    17     8    17     8    17     8    17     8    17     9    17     8    17     8    17     8    17     8    16     8    16     8    16     5    13     4     4
  5   1   2      ests                                 Xt7.1-CAAQ2947.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGGCGGACCTGAGGGTAACCAGGCTTCTGTCCGGGGAGAGTACGGGCAGCGAATCGTCTATAGAGAGCAACCAGGATGCTGGCCCCATCACTAACGGGTTCGAAGAGTGCAGAGAACCAGAGACTGTATGAGTAGGGCCACATGGGCCCAGGGACTGTCTCATACAGACTCACTGTGACCCATTTAAAGCCAGAGGCTCTGCCCAGATCAGTGGCACCTGGGGGGATTCATTTCTTTCAGCAGGGGTGCCAACCTGGTCCTTTCTTTTCATCTTCAGAACAGACCACTAACATGCAGTTTCCAATAGGTGATTTAATTTAAAATGACCTGGTACCATATTTTATTGAGATTTGATTCCCTTGTGGCACCTCTATCCTACAGGAAATGCCATTTGCCATGGAACTGAAGGAGCCCATAGAACCTGTGTGATTGTCAGGATCCTTATTGCTGATATAGATTGGGGTTCACCAACTAGCAGCCCTCTGCTTGTATGAATTATACCCAGACTTAAGCTGTTGGGGGTATCAGGTGGCCAGGCATCCTTGAGTAGCTATAATGCCTTGCACTTAATGTAATTTTGTTAAAATGAATGCTGAATTATGAAACTTGAGGTGGTGGAGAGGAAAGGGAGCACCAGTGGAATACATGCTGACAACAGTATGGGTGTATGCAAGGGATCTCTATTTATAATGGAGGGGGCAAGGTGAATGCCATGAAAATAGAAACCAGGTTCCGTTACTGGCCAGTAACAGATTTGTGATGTTAGTGAGTGTCAGATGACTGTACATTGCACTGTGTTGCATATGTTTCTGACACTCTGGTTTAACTACCCTTTGTAGCAGTGAATGTGTTGAGGTGAAATTATGTTGTAGCCCCTATGTCTT
  5   1   2      ests                                 Xt7.1-CABD2529.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAGGATTTGTGGAAGTGATTATAAGATGTACATGGCTTACATCTCCTAGTAAGGAATGTGTTACAGCAAAGTCATGGATAACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAA
                                                                       PROTEIN --- Xl ---- 1e-014     AAH79698.1 Unknown (protein for MGC:80884) [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================
                                                                       PREDICTED - ?? ---- 1e-014     NP_001090242.1 hypothetical protein LOC779147 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================
                                                    Xt7.1-CABD2529.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------TGA------------TGA------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------ATGTAA------TAA---------TGA---ATG---------------------------------------------------------ATG---------------------------ATG------------TGAATG---TGA---TAG------------------------TAA---------------------------ATG------------------------ATG------------------------------TAG---TGAATG---TGA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TAA------------------TAG---------------------------------------TAG------------------------------TGA---TAA------------------------------------------------------TAA------------------TAA---------------ATG---------TGA------------------------------------------------------------------------------------ATG---TAA---------------------TAG------------------------------TGA------------TAA---------TAA------------------TAG---ATG---------------------TAA---------------------------------------------TGA---------------TAGATG------------------------TAG------------------------------------------TAG---------------------------------------------------------------------TAA------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------ATG---TAG---------------------------------TAA------------------------------------------TAG---------------------------------------------------ATG------------------------TAA---------------------------------------------------TGA---TGA------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------TAAATGTAG---------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------TAA------------------TAA------------------------------------------------------------------------------------------------TGA------------------------------------------------------TAAATGTAA---------------------TAA------TAA---TAAATG------------------------------------------TAA------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                      ]
  5   1   2      ests                                 Xt7.1-CAAQ2947.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGGCGGACCTGAGGGTAACCAGGCTTCTGTCCGGGGAGAGTACGGGCAGCGAATCGTCTATAGAGAGCAACCAGGATGCTGGCCCCATCACTAACGGGTTCGAAGAGTGCAGAGAACCAGAGACTGTATGAGTAGGGCCACATGGGCCCAGGGACTGTCTCATACAGACTCACTGTGACCCATTTAAAGCCAGAGGCTCTGCCCAGATCAGTGGCACCTGGGGGGATTCATTTCTTTCAGCAGGGGTGCCAACCTGGTCCTTTCTTTTCATCTTCAGAACAGACCACTAACATGCAGTTTCCAATAGGTGATTTAATTTAAAATGACCTGGTACCATATTTTATTGAGATTTGATTCCCTTGTGGCACCTCTATCCTACAGGAAATGCCATTTGCCATGGAACTGAAGGAGCCCATAGAACCTGTGTGATTGTCAGGATCCTTATTGCTGATATAGATTGGGGTTCACCAACTAGCAGCCCTCTGCTTGTATGAATTATACCCAGACTTAAGCTGTTGGGGGTATCAGGTGGCCAGGCATCCTTGAGTAGCTATAATGCCTTGCACTTAATGTAATTTTGTTAAAATGAATGCTGAATTATGAAACTTGAGGTGGTGGAGAGGAAAGGGAGCACCAGTGGAATACATGCTGACAACAGTATGGGTGTATGCAAGGGATCTCTATTTATAATGGAGGGGGCAAGGTGAATGCCATGAAAATAGAAACCAGGTTCCGTTACTGGCCAGTAACAGATTTGTGATGTTAGTGAGTGTCAGATGACTGTACATTGCACTGTGTTGCATATGTTTCTGACACTCTGGTTTAACTACCCTTTGTAGCAGTGAATGTGTTGAGGTGAAATTATGTTGTAGCCCCTATGTCTT
                                                  Xt7.1-CHK-1008260087                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGGACCTGAGGGTAACCAGGCTTCTGTCCGGGGAGAGTACGGGCAGCGAATCGTCTATAGAGAGCAACCAGGATGCTGGCCCCATCACTAACGGGTTCGAAGAGTGCAGAGAACCAGAGACTGTATGAGTAGGGCCACATGGGCCCAGGGACTGTCTCATACAGACTCACTGTGACCCATTTAAAGCCAGAGGCTCTGCCCAGATCAGTGGCACCTGGGGGGATTCATTTCTTTCAGCAGGGGTGCCAACCTGGTCCTTTCTTTTCATCTTCAGAACAGACCACTAACATGCAGTTTCCAATAGGTGATTTAATTTAAAATGACCTGGTACCATATTTTATTGAGATTTGATTCCCTTGTGGCACCTCTATCCTACAGGAAATGCCATTTGCCATGGAACTGAAGGAGCCCATAGAACCTGTGTGATTGTCAGGATCCTTATTGCTGATATAGATTGGGGTTCACCAACTAGCAGCCCTCTGCTTGTATGAATTATACCCAGACTTAAGCTGTTGGGGGTATCAGGTGGCCAGGCATCCTTGAGTAGCTATAATGCCTTGCACTTAATGTAATTTTGTTAAAATGAATGCTGAATTATGAAACTTGAGGTGGTGGAGAGGAAAGGGAGCACCAGTGGAATACATGCTGACAACAGTATGGGTGTATGCAAGGGATCTxTxTxTATAATGGxGxGGGCAAGGTGAATGCCATGAAAATAGAAACCAGGTTCCGTTACTGGCCAGTAACAGATTTGTGATGTTAGTGAGTGTCAGATGACTGTACATTGCACTGTGTTGCATATGTTTCTGACACTCTGGTTTAACTACCCTTTGTAGCAGTGAATGTGTTGAGGTGAAATTATGTTGTAGCCCCTA
  5   1   2      seed Hrt1      in                         CAAQ2947.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAAGGCGGACCTGAGGGTAACCAGGCTTCTGTCCGGGGAGAGTACGGGCAGCGAATCGTCTATAGAGAGCAACCAGGATGCTGGCCCCATCACTAACGGGTTCGAAGAGTGCAGAGAACCAGAGACTGTATGAGTAGGGCCACATGGGCCCAGGGACTGTCTCATACAGACTCACTGTGACCCATTTAAAGCCAGAGGCTCTGCCCAGATCAGTGGCACCTGGGGGGATTCATTTCTTTCAGCAGGGGTGCCAACCTGGTCCTTTCTTTTCATCTTCAGAACAGACCACTAACATGCAGTTTCCAATAGGTGATTTAATTTAAAATGACCTGGTACCATATTTTATTGAGATTTGATTCCCTTGTGGCACCTCTATCCTACAGGAAATGCCATTTGCCATGGAACTGAAGGAGCCCATAGAACCTGTGTGATTGTCAGGATCCTTATTGCTGATATAGATTGGGGTTCACCAACTAGCAGCCCTCTGCTTGTATGAATTATACCCAGACTTAAGCTGTTGGGGGTATCAGGTGGCCAGGCATCCTTGAGTAGCTATAATGCCTTGCACTTAATGTAATTTTGTTAAAATGAATGCTGAATTATGAAACTTGAGGTGGTGGAGAGGAAAGGGAGCACCAGTGGAATACATGCTGACAACAGTATGGGTGTATGCAAGGGATCTATTTATAATGNGGAGGGGGCAAGGTGAATGCCATGAAAATAGAAACCAGGTTCCGTTACTGGCCAGTAACAGATTTGTGATGTTAGTGAGTGTCAGATGACTGTACATTGCACTGTGTTGCATATGTTTCTGACACTCTGGTTTAACTACCCTTTGTAGCAGTGAATGTGTTGAGGTGAAATTATGTTGTAGCCCCTATGTCTTAC
  5   1   2       bld Tail      in                         CBSW9630.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACCTGAGGGTAACCAGGCTTCTGTCCGGGGAGAGTACGGGCAGCGAATCGTCTATAGAGAGCAACCAGGATGCTGGCCCCATCACTAACGGGTTCGAAGAGTGCAGAGAACCAGAGACTGTATGAGTAGGGCCACAGGGGCCCAGGGACTGTCTCATACAGACTCACTGTGACCCATTTAAAGCCAGAGGCTCTGCCCAGATCAGTGGCACCTGGGGGGATTCATTTCTTTCAGCAGGGGTGCCAACCTGGTCCTTTCTTTTCATCTTCAGAACAGACCACTAACATGCAGTTTCCAATAGGTGATTTAATTTAAAATGACCTGGTACCATATTTTATTGAGATTTGATTCCCTTGTGGCACCTCTATCCTACAGGAAATGCCATTTGCCATGGAACTGAAGGAGCCCATAGAACCTGTGTGATTGTCAGAATCCTTATTGCTGATATAGATTGGGGTTCACCAACTAGCAGCCCTCTGCTTGTATGAATTATACCCAGACTTAAGCTGTTGGGGGTATCAGGTGGCCAGGCATCCTTGAGTAGCTATAATGCCTTGCACTTAATGTAATTTTGTTAAAATGAATGCTGAATTATGAAACTTGAGGTGGTGGAGAGGAAAGGGAGCACCACAATGGAATACATGCTGACAACAGTATGGGTGTATGCAAGGGATCTATTTATAATGGGGAGGGGGCAAGGTGAATGCCATGAAAATAGAAA
  5   1   2      ests                                 Xt7.1-CABD2529.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAGGATTTGTGGAAGTGATTATAAGATGTACATGGCTTACATCTCCTAGTAAGGAATGTGTTACAGCAAAGTCATGGATAACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228925                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTGTGGAAGTGATTATAAGATGTACATGGCTTACATCTCCTAGTAAGGAATGTGTTACAGCAAAGTCATGGATAACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAAAAAAAA
  3  -1   2       bld Lun1      in                         CABD2529.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGAAACCAGGTTCCGTTACTGGCCAGTAACAGATTTGTGATGTTAGTGAGTGTCAGATGACTGTACATTGCACTGTGTTGCATATGTTTCTGACACTCTGGTTTAACTACCCTTTGTAGCAGTGAATGTGTTGAGGTGAATTAATGTGTAAGCCCCTATGTCTTACAGAATATAGAGTCTTTATCTATGGGAAAAATCTAATTATAATATCACCCAAAGCTATTACATGTAGTAAAAACTGGTTCACTGCTATAGATTCCAGGGTCACAGGGGCCAAAGGGCGAAGAGACAATCCTGCACAGATGTCTCCAAGAGCTTATGCAAATAAATAAGGTTTAGAGGAGTACTCTTAGCAAATTGTCTCTTCACCTTATGATCAATATACCCCTGACTAGTGTGGTGAAGATGCAGAGGATTTGTGGAAGTGATTATAAGATGTACATGGCTTACATCTCCTAGTAAGGAATGTGTTACAGCAAAGTCATGGATAACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGT
  5   1   2       bld TpA       in                   TTpA053j03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAGGATTTGTGGAAGTGATTATAAGATGTACATGGCTTACATCTCCTAGTAAGGAATGTGTTACAGCAAAGTCATGGATAACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGCATGTTATAGCACTGGAA
  5   1   2       bld Tad5                                 XZT13660.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATACTCAGATGGTGTGTGCAATAATTATTTTGGGGCCTAATGCAAGTTGTTTGAACCTGTGGTGCTTATTCACCAGAGAGCAGTATTATTTCTAGCACATCCTATAATTACTGTAATGAAACCTTGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGNGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGA
  5   1   2       bld Ski1      in                        CABJ10138.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGAAACCTTGGTTTCAGAAAAAAATGCCCTAAGACCTAGCTTGTGTTACAGGCTAGAGCAGAGCAGACTTGCTACTTGGGGCATTATGAACCTATATAGTATAACTACTTTTATAATTGCCCAACCTAGTTATTTAGTTAATGGATTTGGCAGGGCTGAGGGCTTAACGTAAACAGCCTTGTGTTTTATTGAGGATCTTTGTGCCATTCTTTTGAAAGAAACCCCAAGGCTAGATGGGATTAAGACTAGCTTTATATGCCTAGACAGAGTACCCAAGGCATACACGCACATGTAAGCACTTTCTTTAGGGTTCGGCTGCTCACACAAATAGGAAAAGTGGGCTGCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTNCATATCTCTGCAGTAATCTACAGAAATGATGTCCATGCC
  5   1   2       bld Eye       in                         CCAX6411.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAAATTACAATCACATGGGATAATGTGAGATTTTAAGTGCAATGGCAGGGAGAATAGGCAGTGCCACTTGTAGATATACTGATTTTGCACACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTAATACATCATTACCTA
  5   1   2       bld Hrt1      in                         CAAQ5145.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGCCGAGGGATATACTGATTTTGCCACTTCTTTCTGTGCTAAGGTTAGTGGCAATAGCTTTCTTTTGGCAACACACACTCCAATATCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCAAAACAAGCTGCAGTACATGTGCCTGCATTGNTGCCATTGTGCCCTGTAATGCA
  5   1   2       bld Gas       in                   TGas098c14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGGCTTTTTCTAATATCTTGTATCTGGGACATTGGTGTACATGTAACGGTGGTATGTTATAGCACTGGAATGGCCAGACTCTTTCATTGTTTAGGTAAACCCTTAGCCATTGGGGAAAGTTCACTGAGATTCATGCAGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAA
  5   1   2       bld Liv1      in                         CAAR6043.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCGATTCGTGTAGAGGTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGNGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCCTTATATGTTTACACTTTG
  5   1   2       bld Egg                            TEgg140p19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTAACAGCATACAGTGGAGCACCCATGTAGCAATACATGCACTCACTATGGTGAATGGTACAATTAGAGCTAACTAAGTAAAAGTGGGCTTGTGTCACTGTACTGATGGTATCCCATCACATGGTTTCTGATTGTGATCTATTATCCATTTAGCAGTGCTGACTATACATCATTACCTATTCAATATCTCTGCAGTAATCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTC
  5  -1   2      seed Lun1      in                         CABD2529.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAGTANTCTACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATCGAATCGATGG
  3   1   2       bld Gas       in                    TGas098c14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGAATTGATGTCCATGCCTTAAACTTGTATTTTATAGTACTATCCATCTAATTGCACTTTCTATCTTCTCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATANAAATAAATTAATATAAAGTTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ2947.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCATTTGCTACTAAACCTCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAGTT
  3   1   2       bld Brn3 5g3  out                       CAAK12890.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CATTTGCTACTAAACCTCTTTCCAGTCATAAATAGGCCTTGCAAGTCCACACCTGGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATAT
  3   1   2       bld Brn3 5g3  out                        CAAK5830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTTGCTACTAAACCTCATCCCAGTCATAAATAGGCCTGCAAGTCCACACCTTGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAGTT
  3   1   2       bld Liv1      in                         CAAR6043.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCATTCCAGTCATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAGTT
  3   1   2       bld TpA       in                    TTpA053j03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATAAATAGGCTTTGCAAGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAGTTAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                        CABJ10138.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCCACACCTTGGCCCTTTAGGCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAGTT
  3   1   2       bld Thy1 5g3  out                      CBST11729.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTCTAAGACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATAT
  3   1   2       bld Hrt1      in                         CAAQ5145.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTGCAGTAGTTGGGGAGTCGCAGGTTGCACATCCCCTTTCTAACTTTATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAGTC
  5   1   2       chi Te1       in                         CBWN2791.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGGGAGCAAGGCGTACGGGAGGGAGGAGCGCATTGTACATGCAATGATCGCTGCCAGGCGCTGTGTACTGACAAATCCCTGCTGCTCCCGCTACTCAGCACAATGCATTAAGTGCGCTCTGAGTGCGCCCAGCGCTTCATTCTCCGCAGCTGTAACTTGCACAGCGACATGCTGCCCTGGAAGAAAAGCAAATTCGACCTGATCGAGGAGGATCCGAAGCAGGCGAAGCAGAAGGGCTATGCAGTGAGTCTCAACTACAGCGCCCTCACCTCCTTCGCCAAGTCGTGTCCGGAGGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAAA
  3   1   2       chi Te1       in                         CBWN2791.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAGGAGCGCATTGTACATGCAATGATCGCTGCCAGGCGCTGTGTACTGACAAATCCCTGCTGCTCCCGCTACTCAGCACAATGCATTAAGTGCGCTCTGAGTGCGCCCAGCGCTTCATTCTCCGCAGCTGTAACTTGCACAGCGACATGCTGCCCTGGAAGAAAAGCAAATTCGACCTGATCGAGGAGGATCCGAAGCAGGCGAAGCAGAAGGGCTATGCAGTGAGTCTCAACTACAGCGCCCTCACCTCCTTCGCCAAGTCGTGTCCGGAGGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAAA
  3   1   2       bld Tail      in                         CBSW9630.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCCCCCTCATTTATTTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCCGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTGTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAAA
  3   1   2       bld Tail PIPE out                         CBSW540.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGGATGGGTAAATGTAGTGTGATTACTGATATGACAGTGTTTCCCTAGAAGTCATATTATGTATAGTAAGGGTTGAAATTAACAGCACAATAAGGCAACACATTGAGAGAGGGTGGCAAATCCTGATTGGCGGATTTTATACATTCAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA14DC11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGGCGGATTTTATACATTAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTTTTTTAAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACGTAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCA
  5   1   2       bld BrSp      in                     EC2BBA14DC11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGCGGATTTTATACATTAAACACTACGACTGGCCATACGTTTTACTTCCAAAACAAGCTGCAGTACATGTGCCTGCATTGGTGCCATTGTGCCCTGTAATGCATTGCAAATGTCAGGGGAAAAAGTCAATGTTTCCATTCACATGCACAGGCTTGGGATCTATCTTTATACCTCAGAAAAGCACCATCTAACAGCCAATACTCCACTTGTAAATCACCCTGGAGAATCTGGTACCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTTTTTTAAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACGTAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye       in                         CCAX6411.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCACCCCTGGAGAAATCTGGTACCCTTATTATGTTTACACTTTGTTTTTGGAACCAGCCCAAAGGGATCACTTCCTGTTTCGGTCTCATGACATTCCATGATATTTTTTTTTTTTTAATACTTGCACTGTTGTGAAGTACTTTGCCAGTGTTTCATAAATGTAAATAGATATATTTTTTTGTACATAAATCACATAAATATAAATGTTATCTTTGCTGTGCAAAAGAAAAATTGTTGTTGTTCACCTGTAAATATTTTGTGTATATAATTTCTTTTTGTTACTTTTTAAAGGACATCACTGTTCTGATGTTTGTTTGCACACATGGAAAATAAAATAAATTAATATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)