Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN9240.5                            5 END     3           8       60                ubiquitin specific protease 48 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012154648 Xt7.1-CAAM16214.3.5 - 34 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAM16214.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTACGAGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGAGAATCCCCAAAGGCCTGCGAGGAGGGGATAGATGAGGAAAAGAAGGAAGCGGATTCTGAGCTTGGGTTTAACGAAGATATTATTTGTCAGCACGGGGGTCTGAGCATTTCGGAGAGTGAGAGGAGGCTGATCTCTGAAGCAGCCTGGTACAAGCTGAAGGAGTATTTTCCTACGGCGCCTGAGTTCCGGCACAGCCAGGAGTCCTGCTCCCAGTGCAAGGTTCTGGAACAGGAAGGGGAGAGGCACGAAGCTCTGCATAAGATGATGGCAAATGACCAGAAGACGGCACTTCCCAACCTGTTTCAAGACAAGAACAGACCATTACTGGGGAGCTGGCCTCAGGATACGGCCGAGTTCTTCGTTGTGTCTCAGTTCTTTGTGGAAGAATGGAGAAAGTTCATTAGGCGACCCACAAAAAGCAACCCAGTCATGTCTATAGGGGACAGTCTACTTCTCTGCCCCCATGGGGGTCTCATGATCTCCTTTACCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTA
                                                  Xt7.1-CHK-1008265162                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGAGAATCCCCAAAGGCCTGCGAGGAGGGGATAGATGAGGAAAAGAAGGAAGCGGATTCTGAGCTTGGGTTTAACGAAGATATTATTTGTCAGCACGGGGGTCTGAGCATTTCGGAGAGTGAGAGGAGGCTGATCTCTGAAGCAGCCTGGTACAAGCTGAAGGAGTATTTTCCTACGGCGCCTGAGTTCCGGCACAGCCAGGAGTCCTGCTCCCAGTGCAAGGTTCTGGAACAGGAAGGGGAGAGGCACGAAGCTCTGCATAAGATGATGGCAAATGACCAGAAGACGGCACTTCCCAACCTGTTTCAAGACAAGAACAGACCATTACTGGGGAGCTGGCCTCAGGATACGGCCGAGTTCTTCGTTGTGTCTCAGTTCTTTGTGGAAGAATGGAGAAAGTTCATTAGGCGACCCACAAAAAGCAACCCAGTCATGTCTATAGGGGACAGTCTACTTCTCTGCCCCCATGGGGGTCTCATGATCTCCTTTACCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     3     2     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     8     8     8     8     8     8     8     9     9    10    10    10    10    10    11    13    13    13    13    13    13    13    13    15    16    15    16    17    18    18    19    18    19    19    20    19    20    20    22    21    22    21    23    20    23    21    23    21    23    21    24    22    23    19    23    20    23    16    23    19    23    20    24    21    24    19    24    21    24    18    24    20    24    21    24    17    24    19    24    20    24    19    24    21    24    19    23    20    23    19    23    17    21    19    20    15    20    13    20    15    20    15    20    16    21    14    21    14    21    13    22    16    22     8    20     8    19     8    18     7    18     6    16     6    17     6    15     6    14     6    14     3     6     3     4
  5   1   2      ests                                  Xt7.1-st43j18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATATGGATCCCTACCTCGACCAGACAGATGGTACATATTCCTATGAACTGAGTGCAGTTCTCATACATCGAGGGGTGAGTGCATACTCGGGCCATTATATTGCTCATGTCAAGGACCCACAGACAGGCGAGTGGTACAAATTTAACGACGAGGACATAGAAAAGATGGAAGGGAAGAAGCTGCAGCTTGGAATTGAGGAAGATCTAGAACAATCCAAAACGGCGCCCCGCAAACCCAAATGTGGCAAAGGAATCCACTGTTCTCGCAATGCCTACATGTTAGTCTATAGGCTAAAGACGGTTGAAAAACAAGATGTTACTTTCGAAGTTCCAGCTTTCCTACAGAAGCTGGTGGAACTGGATAACTGCAAGTTTGAGGAGTGGTGCGTGGAGATGGTGGACATGCGTAGAGAAAGCGTAGTTAGAAGCGTGTTGTTCCTGCATAGCTACATCTTCTCTCTCTGTCATTCTCTGCTTCTTCCAGACAGTGCCTACGAGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGAGAATCCCCAAAGGCCTGCGAGGAGGGGATAGATGAGGAAAAGAAGGAAGCGGATTCTGAGCTTGGGTTTAACGAAGATATTATTTGTCAGCACGGGGGTCTGAGCATTTCGGAGAGTGAGAGGAGGCTGATCTCTGAAGCAGCCTGGTACAAGCTGAAGGAGTATTTTCCTACGGCGCCTGAGTTCCGGCACAGCCAGGAGTCCTGCTCCCAGTGCAAGGTTCTGGAACAGGAAGGGGAGAGGCACGAAGCTCTGCATAAGATGATGGCAAATGACCAGAAGACGGCACTTCCCAACCTGTTTCAAGACAAGAACAGACCATTACTGGGGAGCTGGCCTCAGGATACGGCCGAGTTCTTCGTTGTGTCTCAGTTCTTTGTGGAAGAATGGAGAAAGTTCATTAGGCGACCCACAAAAAGCAACCCAGTCATGTCTATAGGGGACAGTCTACTTCTCTGCCCCCATGGGGGTCTCATG
  5   1   2      ests                                Xt7.1-CAAM16214.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTTCTCTGCCCCCATGGGGGTCTCATGATCTCCTTTACCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T--T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T-T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T-T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                       ...PROTEIN --- Ce ---- 3e-010     NP_492524.2 ubiquitin thiolesterase, family 2 and ubiquitin interacting motif (144.2 kD) (1K87) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Dr ==== 6e-031     XP_700895.1 PREDICTED: similar to ubiquitin specific protease 48 [Danio rerio] =============================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 9e-079     XP_001201536.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_570949.2 ubiquitin specific protease 48 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_115612.4 ubiquitin specific protease 48 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 0          NP_001073211.1 ubiquitin specific peptidase 48 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAM16214.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------ATG---------ATG---------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------TAA---ATGTAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  5   1   2      ests                                  Xt7.1-st43j18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATATGGATCCCTACCTCGACCAGACAGATGGTACATATTCCTATGAACTGAGTGCAGTTCTCATACATCGAGGGGTGAGTGCATACTCGGGCCATTATATTGCTCATGTCAAGGACCCACAGACAGGCGAGTGGTACAAATTTAACGACGAGGACATAGAAAAGATGGAAGGGAAGAAGCTGCAGCTTGGAATTGAGGAAGATCTAGAACAATCCAAAACGGCGCCCCGCAAACCCAAATGTGGCAAAGGAATCCACTGTTCTCGCAATGCCTACATGTTAGTCTATAGGCTAAAGACGGTTGAAAAACAAGATGTTACTTTCGAAGTTCCAGCTTTCCTACAGAAGCTGGTGGAACTGGATAACTGCAAGTTTGAGGAGTGGTGCGTGGAGATGGTGGACATGCGTAGAGAAAGCGTAGTTAGAAGCGTGTTGTTCCTGCATAGCTACATCTTCTCTCTCTGTCATTCTCTGCTTCTTCCAGACAGTGCCTACGAGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGAGAATCCCCAAAGGCCTGCGAGGAGGGGATAGATGAGGAAAAGAAGGAAGCGGATTCTGAGCTTGGGTTTAACGAAGATATTATTTGTCAGCACGGGGGTCTGAGCATTTCGGAGAGTGAGAGGAGGCTGATCTCTGAAGCAGCCTGGTACAAGCTGAAGGAGTATTTTCCTACGGCGCCTGAGTTCCGGCACAGCCAGGAGTCCTGCTCCCAGTGCAAGGTTCTGGAACAGGAAGGGGAGAGGCACGAAGCTCTGCATAAGATGATGGCAAATGACCAGAAGACGGCACTTCCCAACCTGTTTCAAGACAAGAACAGACCATTACTGGGGAGCTGGCCTCAGGATACGGCCGAGTTCTTCGTTGTGTCTCAGTTCTTTGTGGAAGAATGGAGAAAGTTCATTAGGCGACCCACAAAAAGCAACCCAGTCATGTCTATAGGGGACAGTCTACTTCTCTGCCCCCATGGGGGTCTCATG
                                                  Xt7.1-CHK-1008246864                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCCCTACCTCGACCAGACAGATGGTACATATTCCTATGAACTGAGTGCAGTTCTCATACATCGAGGGGTGAGTGCATACTCGGGCCATTATATTGCTCATGTCAAGGACCCACAGACAGGCGAGTGGTACAAATTTAACGACGAGGACATAGAAAAGATGGAAGGGAAGAAGCTGCAGCTTGGAATTGAGGAAGATCTAGAACAATCCAAAACGGCGCCCCGCAAACCCAAATGTGGCAAAGGAATCCACTGTTCTCGCAATGCCTACATGTTAGTCTATAGGCTAAAGACGGTTGAAAAACAAGATGTTACTTTCGAAGTTCCAGCTTTCCTACAGAAGCTGGTGGAACTGGATAACTGCAAGTTTGAGGAGTGGTGCGTGGAGATGGTGGACATGCGTAGAGAAAGCGTAGxxAxAAGCGTGTTGTTCCTGCATAGCTACATCTTCTCTCTCTGTCATTCTCTGCTTCTTCCAGACAGTGCCTACGAGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGAGAATCCCCAAAGGCCTGCGAGGAGGGGATAGATGAGGAAAAGAAGGAAGCGGATTCTGAGCTTGGGTTTAACGAAGATATTATTTGTCAGCACGGGGGTCTGAGCATTTCGGAGAGTGAGAGGAGGCTGATCTCTGAAGCAGCCTGGTACAAGCTGAAGGAGTATTTTCCTACGGCGCCTGAGTTCCGGCACAGCCAGGAGTCCTGCTCCCAGTGCAAGGTTCTGGAACAGGAAGGGGAGAGGCACGAAGCTCTGCATAAGATGATGGCAAATGACCAGAAGACGGCACTTCCCAACCTGTTTCAAGACAAGAACAGACCATTACTGGGGAGCTGGCCTCAGGATACGGCCGAGTTCTTCGTTGTGTCTCAGTTCTTTGTGGAAGAATGGAGAAAGTTCATTAGGCGACCCACAAAAAGCAACCCAGTCATGTCTATAGGGGACAGTCTACTTCTCTGCCCCCATGGGGGT
  5   1   2       bld Gas7      in                         XZG15219.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATATGGATCCCTACCTCGACCAGACAGATGGTACATATTCCTATGAACTGAGTGCAGTTCTCATACATCGAGGGGTGAGTGCATACTCGGGCCATTATATTGCTCATGTCAAGGACCCACAGACAGGCGAGTGGTACAAATTTAACGACGAGGACATAGAAAAGATGGAAGGGAAGAAGCTGCAGCTTGGAATTGAGGAAGATCTAGAACAATCCAAAACGGCGCCCCGCAAACCCAAATGTGGCAAAGGAATCCACTGTTCTCGCAATGCCTACATGTTAGTCTATAGGCTAAAGACGGTTGAAAAACAAGATGTTACTTTCGAAGTTCCAGCTTTCCTACAGAAGCTGGTGGAACTGGATAACTGCAAGTTTGAGGAGTGGTGCGTGGAGATGGTGGACATGCGTAGAGAAAGCGTAGACAAAGGCAAAGCCAAACACGAGGAGGTGAAGGAGCTGTACCAGAGGTTACCAGCTGGAGCTGACAGTGCCTACGAGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAAAAAGATGCAGGGTTCTGCGCTTGA
  5   1   2       bld Tad5                                 XZT30750.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTAAAACCTGTGACATTTGCTGTAATGAATTAAATAAAACATTTTAATTAAAGGTATACTGTCATCGAATTCTAAGGGAGGGATATATTTCTGGTATTAAAAAAAAAATTTGACAGCGTTTACAGAGCTGCTGTCTGGAGATGCTTGTGATTTACCAAGTGAGAGAGGATGATAGAATAATAAATATATATTACATTGTTTAGAGAAAACAGCACTACTGATGTTAAAATGAAATGATTTATTATATTTATATTTATATTATTATTCAGTGTGATGATAGTATCCCTTTAAATGTGCCTACTAATAGGTGTGTAACCTGCGTTTGTTAGAAGCGTGTTGTTCCTGCATAGCTACATCTTCTCTCTCTGTCATTCTCTGCTTCTTCCAGACAGTGCCTACGAGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGA
  5   1   2      seed Gas8      in                          st43j18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGTTTGTGCCCCTCGAGTGGCTCCAGAAATGGCTGGATGAGTCCACTCCAACCAAACCCATTGACAACTCCAAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGAGAATCCCCAAAGGCCTGCGAGGAGGGGATAGATGAGGAAAAGAAGGAAGCGGATTCTGAGCTTGGGTTTAACGAAGATATTATTTGTCAGCACGGGGGTCTGAGCATTTCGGAGAGTGAGAGGAGGCTGATCTCTGAAGCAGCCTGGTACAAGCTGAAGGAGTATTTTCCTACGGCGCCTGAGTTCCGGCACAGCCAGGAGTCCTGCTCCCAGTGCAAGGTTCTGGAACAGGAAGGGGAGAGGCACGAAGCTCTGCATAAGATGATGGCAAATGACCAGA
  5   1   2       bld Te3       in                        CAAM16214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAGTGTCTGTGTTCCCATGGGAAGCTGCACCCCGATAAGATCTCCCTCATGAAGAGAATTTCTCAGCACGCAGCAGATATCTTCTACAAGCGGTATGGGGGCAGCCCTCGCCTGACTGATGATGCTCTCTGCAAGGACTGTGTGGTAGAAAGATGCAGGGTTCTGCGCTTGAAGAACCAACTGAATGAAGATTACAAATCGTTAACTAATATGGTTAAGCTTCCAGTGGAGAGCAATGAAGGCTTCTGGATTGGAAAAAGCTCACTGCGCCGCTGGCGTCAGTTGGCAACCGAGCAGCTTGACCAGCAGGAAGAGGACTTAGCCCAGGGCGATTGGAAAGTAAATGGAGAATCCCCAAAGGCCTGCGAGGAGGGGATAGATGAGGAAAAGAAGGAAGCGGATTCTGAGCTTGGGTTTAACGAAGATATTATTTGTCAGCACGGGGGTCTGAGCATTTCGGAGAGTGAGAGGAGGCTGATCTCTGAAGCAGCCTGGTACAAGCTGAAGGAGTATTTTCCTACGGCGCCTGAGTTCCGGCACAGCCAGGAGTCCTGCTCCCAGTGCAAGGTTCTGGAACAGGAAGGGGAGAGGCACGAAGCTCTGCATAAGATGATGGCAAATGACCAGAAGACGGCACTTCCCAACCTGTTTCAAGACAAGAACAGACCATTACTGGGGAGCTGGCCTCAGGATACGGCCGAGTTCTTCGTTGTGTCTCAGTTCTTTGTGGAAGAATGGAGAAAGTTCATTAGGCGACCCACAAAAAGCAACCCAGTCATGTCTATAGGGGACAGTCTACTTCTCTGCCCCCATGGGGGTCTCATGATC
  5   1   2      ests                                Xt7.1-CAAM16214.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACTTCTCTGCCCCCATGGGGGTCTCATGATCTCCTTTACCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTT
                                                  Xt7.1-CHK-1008228136                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTGCCCCCATGGGGGTCTCATGATCTCCTTTACCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGG
  5   1   2       bld Gas7      in                         XZG36360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGACCCACAAAAAGCAACCCAGTCATGTCTATAGGGAACAGTCTACTTCTCTGCCCCCATGGGGGTCTCATGATCTCCTTTACCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATG
  5   1   2       bld Gas7 PIPE in                          XZG7158.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCAGTCATGTCTTAGGGAAAGCCTACTTCTCTGCCCCCATGGGGGTCTCATGATCTCCTTTACCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAATGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAAGAAGGATTTAAAGGAAACCGGTCTTCTGGGGCATTAATCC
  3   1   2       bld Gas7      out                        XZG36934.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAACATGACTAAGGAGGACGCCAAACTTATAGCTCCCATATGGCCTGCAGAATGGGACGCTATCCAGAAACTCTTTATTGTCGACCACACAATCAAAATCAGCCGAACGGTTGTAACCAGGGAGGACAGGACATTTACTGTCGACTATGAATCAGACCCCAAGCTGTGCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAATGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTTTTATTTTTAAGAAAAAATAAAATAAAAAAAAACATAGAAAAAAACACTATGAG
  5   1   2       bld Tbd1      in                        CBXT13037.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCCAGACTGTAGGGAAGGATTGCTGTGCCAGCAGCAGAGGGATCTGCGGGAATACGCTCAGGCCACAATCTACATTCACAAAGTTGTGGATCGGAAGAAGGTAATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCA
  5   1   2       bld Gas8      in                          st64h13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGAAGGAGGTGGCGCCGGAGCTGAACGTCAGCAGTTCTGACCTGGAGGATGAGAAAGATGAACCCAGAGCAGATGGGGAGACTGACCCTGACTTTAATCAGGTGAATGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAAT
  5   1   2       bld Te4       in                         CAAN3928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTGACTTTAATCAGGTGAACGGAACGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAG
  5   1   2      seed Gas7      in                         XZG64415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGGCTAAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGAAAAAAAATAAAAAAAAAAAAAAAANAA
  5   1   2       bld Tad5                                  XZT8595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACGGCTAAAGACAGAAGTTGTCCGGCCAAGGGCACGTATCTACCCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGG
  3   1   2       bld Te3       in                        CAAM16214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGAAGCAGGGGGTCCGGCGAAGCACTCGGCATAGAAAAGTGCGGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTAT
  3   1   2       bld Gas7      in                         XZG64415.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGGGGGTCCGGCGAAGCACTCGGCATAGGAAAGTGCGGGGGGAGAGGGCGTTTCTGGTTTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTTTTTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATTTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTTTTTTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATTTTGGTTTTTCCCCAAGGCGGGGATCCTGTCGGGGTGAGCAGTTTTTTTTCCACTCACATTTCCCACCCCGAATGCCTTACACCCCCCGGAGCGGGTTGCACCGAGGGAGCGCCGCCGCCCCCGGGCCACTTTTTTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGGGCTTTTTATCATTTGGGGAAAAAAAATAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       chi Gas7      in                         XZG27237.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGGGAGAGGGCGTTGCTGGTTTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTAAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn3 5g3  out                        CAAK2478.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGGGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTC
  5   1   2       chi Gas7      in                         XZG27237.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAGAGGGCGTTGCTGGTCTCAGCCAATCAGACCCTGAAGGAACTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTATAAAAAAAAAAAAAAAGG
  5   1   2       bld Tbd1      in                        CBXT16180.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCTGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGCCCTCAGAACTGGGGCACGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT16180.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAAAATACAGATTATGCACGCTTTCTCTGTGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCTGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTTTTTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGCCCTCAGAACTGGGGCACGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCAAAAAAAAAAAAAAA
  3   1   2       bld Neu       out                   TNeu099b09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCCATTAAAACTGATGATAATACTTGTACCGGCAGAGGAATATGTGAGAATTCTAAGAAGGCAGAGGAACAACATGTAATTTAATATTTATTTTGATTGTTTGGGGGGTTGTTAAATTTGTAAAGGTGTAATTCATTGATAATAATTTTGTAAATTGTATTTTTATTGTAAATGACATTAAAAAAAATTAATTAAAAAAAAAAAAAAAAAAAGCCCCGGGGAATCCCCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTTCCCATTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTATAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       in                         CAAN3928.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTTTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGTTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGTTTTTTTTCCACTCACATTTCCCACCCGGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTTTATGTAAATACCGGGGGGCCGGAGAGTTTTTCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTTTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTAT
  3   1   2       bld Gas7      in                         XZG36360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGCGCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCTTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTTTTTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCAAC
  3   1   2       bld Te3  5g3  out                        CAAM2804.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGTTTGATCAGAACCTGTCGATAGAAGGCAAAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTTTTTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTC
  5   1   2       bld Gas8      out                         st30b08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAATCCTGAGCGATGATGCAGCCACTCTGGGGAATCTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATACGGGGGGGGGGGG
  3   1   2       bld Brn2      out                       CAAJ14653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCCCTTTGGGGGAATTTAGGAATTGTTCCGGAATCGGTTTTTTTTTTAAAGGCTGACGAGCCGATGGCAGATTATGCAGCTATGGATGCCGTGATGCAAGTTTTTTTCCCGGAGGAAGGATTTAAAGGAACCGGTTTTTTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGCCCCGAGGCCGGTGAGCAGAAAGGGGTTTTTGGTTTTTCCCCAAGGGGGGGATCCTGTGGGGGTGAGCAGTTTTTTTTCCATTCACTTTTCCCACCCGGAATGCTTTACCCCCCCCGGAGCGGGTTGCCCCGAGGGAGGGCCGCCCCCCCCGGGCCATTTTTTTTTGTAAATCCGGGGGGGCCGGAGAGTTTTTCCGCGGGGGAGCCCATCCCATAGAACTTGTTTACATACAGATATAAGGGATTTTTTTCCCCAGGTCAGGGCTTTTTTTCATTTGGGGGGGGGGGGGCCCTCGGAATTGGGGGGGGGGCCCCGGCATTGGGTTTTTTTTGTGTAGCCCCAATAAGCTATGTAAGAGGGGTCGTTCATTCGGATATTAAACTATTCAGGGGTTTGCCTC
  3   1   2       bld Gas7 PIPE in                          XZG7158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGCCACTCTGGGGAATTTAGGAATTGTTCCGGAATCGGTTATTTTACTAAAGGCTGACGAGCCGATGCCAGATTATGCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTTTTTTGGGGCATTAATCCCCAGGGGGGCCCCGGGGCAATGACACGACGCCGGTGAGCAGAAAGGGGATTTTGGTTTTTCCCCAAGGCGGGGATCCTGTCGGGTTGAGCAGTTTTTTTTCCATTCACATTTCCCACCCCGAATGCCTTACCCCCCCCGGAGCGGGTTGCACCGAGGGAGGGCCGCCCCCCCCGGGCCATTTTTTTTTGTAAATACCGGGGGGCCGGGGAGTTTTTCCGCCGGGGAGCCCATCCCATAGAACTTGTTTACATACAGATATAAGGGATTTTTCTCCCCACGTCAGTGCTTTTTATCATATCGGGGGGGGGGCCCTCGGAACTGGGGCGGGGGCCCCGGCATTGCGTTTTTTTTGTGTAGCCCCAATAAGCTATGTAAGAGGGGTCGTTCATTCTGATATTAAACTATTCAGGGGTTTGCCTCATCCCAGGGGTCCTTTTTTTANNNN
  3   1   2       bld Tbd1      in                        CBXT13037.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATTGTTCCGGAATCGGTTATTTTATTAAAGGCTGACGAGCCGATGGCAGATTATGCAGTTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGTTTTTTTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACAGGAGGACGGTGAGCAGAAAGCGGATTTTGGTTTTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGTTTTTTTTCCACTCACATTTCCCACCCCGAATCCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCATTTTTTTATGTAAATACCGGGGGGGCCGGAGAGTTTTTCCGCCGAGGAGCCCATCCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTTTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                          st68a05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAGCTATGGATGACGTGATGCAAGTTTGTATGCCGGAGGAAGGATTTAAAGGAACCGGTCTTCTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGG
  3   1   2       bld Gas7      in                         XZG15219.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGTATGCCGGAGGAAGGGTTTAAAGGAACCGTTCTTTTGGGGCATTAATCCGCAGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGGTGAGCAGCTTTTTTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTTTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATCCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATCGCGTTTCTCTTGTGTAGCACCAATAAGCTACGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTGGCCTC
  5   1   2       bld Tbd1      in                         CBXT8411.b3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGAATCCCGCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGCTCTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTCTCTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTCTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGCCCTCAGAACTGGGGCACGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTATAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT8411.g3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATCCGCGGGGGGGCCCCGGGGCAATGACACGACGACGGTGAGCAGAAAGCGGATCTTGGTTTTTCCACAAGGCGGGGATCCTGTCGGGCTGAGCAGCTTTTTTTCCACTCACATCTCCCACCCCGAATGCCTTACACCCCCCGGAGCGCGTTGCACCGAGGGAGCGCCGCCGCCACCGGGCCACTTTTTTATGTAAATACCGGGGGGCCGGAGAGTTTATCCGCCGAGGAGCCCATGCCATAGAACTTGTTTACATACAGATATAAGGGACTTTTCTCCCCACGTCAGTGCTTTCTATCATATCGGGGGGGGGGCCCTCAGAACTGGGGCACGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATATTAAACTATTCATGGGTTTGCCTCATCCCATGGGTCCTTTTTATAAAAAAAAAAAAAAA
  3   1   2       add Gas8      in                          st64h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AANTTGTTTACATACAGANATAAGGGANTTTTTTCCCCNCGTCANTGCTTTTTATCANATNGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGT
  3   1   0       add Gas8      in                          st43j18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGNNTTTTTTCCCCNNGTCANNGCTTTTTATCANATNGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTACGCACCAATAAGCTATGTAAGATGT
  3   1   0       add Gas8      in                          st68a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGNNTTTTTTNCCCNCGTCANNGCTTTTTATNANATNGGGGGGGGGGGGCCCTCGGAACTGGGGCGCGGGCCCCGGCATTGCGTTTCTCTTGTGTAGCACCAATAAGCTATGTAAGATGTGTCGTTCATTCTGATAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)