Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Sep 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 67%

 1012154649 Xt7.1-XZT12269.5.5 - 36 ESTs
                                                                       .....-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-XZT12269.5.5                                                                            CTCCACCTGGGCTACTGATTGTTTCCCTAGTGCTGCTGTGGGAGATAGGGTGCTGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCATGACTTATGAGCTGCTGTTGGCATCAATATTCCTGTACGTCTGATGAAGCATGGATGGAAAATACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008265163                                                                                  CTGGGCTACTGATTGTTTCCCTAGTGCTGCTGTGGGAGATAGGGTGCTGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCATGACTTATGAGCTGCTGTTGGCATCAATATTCCTGTACGxxxGxTGAAGCAxxxxxxxxxAxxACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAAAAA
                                                      consensus depths                                                                                 3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     6     3     6     4     7     4     6     6     8     6     8     8    12     9    12     9    12     9    12     9    12    12    13    11    13    12    13    11    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    12    12    12    12    12    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     8    11    10    10    10    11    10    11     8     9     8     9     7     8     7     8     7     8     7     7     7     7     7     7     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     8     6     7     7     7     7     7    10    10    11    11     8    11     8    11    10    10     9    10    10    13    12    15     9    15    11    16    11    15     9    15    10    16    12    16    13    16    13    16    12    16    13    16    13    16    13    16    12    16    13    16    13    16    13    16    13    15    12    15    13    15    12    15    12    16    13    16    12    16    13    16    12    16    13    16    15    16    14    16    15    16    15    16    14    16    15    16    14    16    14    15    15    15    13    15    12    15    14    15    16    16    14    16    15    16    15    16    16    16    16    16    16    16    16    16    16    16    15    16    16    16    16    16    16    16    16    16    15    16    15    15    15    15    14    15    14    15    12    15     4     6     4     4
  5   1   2      en>5                                 Xt7.1-XZT12269.5                                                                            CTCCACCTGGGCTACTGATTGTTTCCCTAGTGCTGCTGTGGGAGATAGGGTGCTGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCATGACTTATGAGCTGCTGTTGGCATCAATATTCCTGTACGTCTGATGAAGCATGGATGGAAAATACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCA
  5   1   2      en>5                                 Xt7.1-CABE6302.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTCACTTTGGATTATCAAGAAGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                GCCCGTCTGAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTATCAACAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    G----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------AA----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----T-------
                                               BLH ATG     327      24                                                                            
                                               BLH MIN     324       6                                                                            
                                               BLH MPR     156       6                                                                            
                                               BLH OVR     315     210                                                                            
                                               CDS MIN     315       6                                                                            
                                               EST CLI     186       1                                                                            
                                                                                                                                                                                                                                                                                                              PREDICTED - Gg ---- 2e-011     XP_417373.1 PREDICTED: similar to cAMP-dependent protein kinase inhibitor gamma [Gallus gallus] -----------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 3e-015     NP_035236.1 cAMP-dependent protein kinase inhibitor gamma [Mus musculus] ============================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 2e-015     NP_008997.1 cAMP-dependent protein kinase inhibitor gamma; PKI-gamma [Homo sapiens] =================================================================================================================
                                                    Xt7.1-XZT12269.5.5                                                                                           TGA---------TAG---------------TAG---------------TGA---------------TAG---------------TAA---------------------------TGA---ATG---------------------------------------------ATG------------------ATG------------------------------------------------------------------------TAG------------------------TGA------ATG---------ATGATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TGA---------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------TAG---------------------------------------------------------------------------------------------TAA------------------------------TGA------------------------------------------ATG---------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TAA------------------------------------------------------------ATG------TAG------ATG---------------------------------------------------------------------------------------------------------TAA------------------------TAA---------------------------------TGA------------------------------ATG------TAG------ATG------------TAG------------------------------------------------------TGA------------------------TAA------------------------------------------------------------TAG---ATG------TAG------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------TGA------------------------------TAA------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------TGAATG------------------------------------------------------------TGA---------TGA------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                           ]
  0   1   1           Egg  FL                     TEgg075e12.FL-Sanger                                                                  TGTCAGACACCTCCACCTGGGCTACTGATTGTCTCCCTAGTGCTGCTGTGGAAGATAGGGTGCCGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCACGACTTATGAGCCGCTGTTGGCATCAATATTCCTGTACGAAAGGTCGAGTGTGGATGGAAAATCAATACAGCACTGTGAGAAGTTCTTCCAGCAGAGAGCGGAGGCAGCACACCCAGAGCTTAATAGCAGGTGGCCAGGAGACATTCCTATCTACTTACTGACACCAAAGATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATGGCTGTAAAATCATAGAGAAGAGAAAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAAAAAAAAAAA
  5   1   2      en>5                                 Xt7.1-XZT12269.5                                                                            CTCCACCTGGGCTACTGATTGTTTCCCTAGTGCTGCTGTGGGAGATAGGGTGCTGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCATGACTTATGAGCTGCTGTTGGCATCAATATTCCTGTACGTCTGATGAAGCATGGATGGAAAATACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCA
                                                  Xt7.1-CHK-1008230554                                                                                  CTGGGCTACTGATTGTTTCCCTAGTGCTGCTGTGGGAGATAGGGTGCTGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCATGACTTATGAGCTGCTGTTGGCATCAATATTCCTGTACGxxxGxTGAAGCAxxxxxxxxxAxxACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGC
  5   1   2       bld Egg  5g                        TEgg106o08.p1kSP6 GATGGGAAACACATTTTCCGATAATAGTGAGTATTTGGTGGATAACCAAACTGCAGTAACAGGTGTGTCAGACACCTCCACCTGGGCTACTGATTGTTTCCCTAGTGCTGCTGTGGGAGATAGGGTGCTGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCATGACTTATGAGCTGCTGTTGGCATCAATATTCCTGTACGAAAGGTCTAGTGTGGATGGAAAATCAATACAGCACTGTGAGAAGTTCTTCCAGCAGAGAGCGGAGGCAGCACACCCAGAGCTTAATAGCAGGTGGCCAGGAGACATTCCTATCTACTTACTGACACCGAAGATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTG
  5   1   1       add Egg                            TEgg106k08.p1kSP6    CCGGGTGAGAGAGCGGCGCGGTTCGGTGTGTGAGGAGCGGTGTGTGGGGGAGAGAACGAGGTGTGTAGACACCTCCACCTGGGATACTGATTGTTTCCCTAGTGCTGCTGTGGGAGATAGGGTGCTGGAGAGGCCTGACCTGCCTGGGTTACTTACTTTGCTGCATTCTACTAACCCCCATCCCATAGTCTCTCCTCAGCATGACTTATGAGCTGCTGCTGGCATCCATATTCCTGTACGAAAGGTCCAGCGTGGATGGAAAATCCATACAGCACTGTGAGAAG
  5   1   2       bld Egg  FL   in                   TEgg075e12.p1kSP6                                                                  TGTCAGACACCTCCACCTGGGCTACTGATTGTCTCCCTAGTGCTGCTGTGGAAGATAGGGTGCCGGAGAGGCCTGACCTGCATGGGTTACTTAGTTTGCTGCATTCTACTAACCCCCATCCAATAGTCTCTCTTCAGCACGACTTATGAGCCGCTGTTGGCATCAATATTCCTGTACGAAAGGTCGAGTGTGGATGGAAAATCAATACAGCACTGTGAGAAGTTCTTCCAGCAGAGAGCGGAGGCAGCACACCCAGAGCTTAATAGCAGGTGGCCAGGAGACATTCCTATCTACTTACTGACACCAAAGATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGG
  5   1   2       bld BrSp 5g3  in                     EC2BBA32AG10.g1                                                                                                                                                                                                                                               GGGAGTCTGATGAAGCAGCCCGTCTGAGCACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAA
  5   1   2       bld TbA  5g3  in                   TTbA069f09.p1kSP6                                                                                                                                                                                                                                                    TCTGATGAAGCAGCCCGTCTGAGCACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGANACCATGGNGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAAC
  5   1   2       bld TbA  5g3  in                   TTbA069f14.p1kSP6                                                                                                                                                                                                                                                    TCTGATGAAGCAGCCCGTCTGAGCACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGANACCATGNGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAAC
  5   1   2       bld HdA  5g3  in                  THdA009i03.p1kaSP6                                                                                                                                                                                                                                                                      CTGAGCACAGCACCCGAAATGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTTTTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAACCATGGNGGTGGAAATGGAAATGGAACTGATGTTGCTTGACCAGGAACTTNGGCAGGGGAGGCCACTGCACTCACAGTGATTTCATCATAGATCTCTATAACTATGAG
  5   1   2   14  bld Te5  5g3  in                         CAAO5950.5p ........................................................................................................................................................................................................................................................................................TGACCACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGA
  5   1   2   10  bld Spl2 5g3  in                        CBSS3334.fwd ............................................................................................................................................................................................................................................................................................CACGTCCTTCCTTAACCATGACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGG
  5   1   2       bld HdA  5g                        THdA027n24.p1kSP6                                                                                                                                                                                                                                                                                                                 ACAGGGCACCCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGAT
  5   1   2   30  bld Fat1 5g                             CABC11122.5p ................................................................................................................................................................................................................................................................................................................TCAATTCGGCACGAGGGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGNGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCCACAATAGATTTCCCTGGCTGTAA
  5   1   2       bld HdA  5g                       THdA027o03.p1kaSP6                                                                                                                                                                                                                                                                                                                   ACGGGCACCCAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGANTATGAATTTGGAATGATGGATGTCGAGTCT
  5   1   2       bld TbA  5g3  in                   TTbA080c11.p1kSP6                                                                                                                                                                                                                                                                                                                         CCAAGCTGGACTTTTATCTGGATATTGCCTTTGGGAATCTGTAGAACCCACCAAGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCTAGATCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAATGAATGCCGTCCCGGACATCTAAGACAAAGATGAAACAGGCCAAGTAGGGGAGCTGTCGGACAACATGGGGGAGCTGGCCATTCATGGGGCAACACACAAAGAACGGGCAACGTCTTCCGACAGTGGGCAAGTACAAACTCCAGAACCACAATATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACATAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACATTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAACATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTTTTTTCCTGAAAGTACTTTTTTGCCCCCTTTATCTT
  5   1   2      seed Tad5      in                         XZT12269.5p                                                                                                                                                                                                                                                                                                                                                                               AGCTCACTATCGAATTGATTTGATATGAAATTGGAAATGATGGATGTCGAGTCTGCATACTCTGAATTCATATCCTGCGATCGAACTGGCAGAAGGAATGCCGTCCCGGACATCAAAGACAAAGATGAAACAAGCCAAGTAGGGGAGCTGTCGGAGAACATGGGGGAGCTGGCCATTCAGGGGGCAGAAAACAAAGAAGGGGCAACGTCTTCCGACAGTGGGCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAG
  5   1   2       bld Tad5      in                         XZT36745.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGGTACAGACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGA
  5   1   2       bld Tad5      in                         XZT71645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GACTCCAGAAGCACAAGATGGAAGCTCACCATCATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATANAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGC
  5   1   2       bld Ova1      in                         CABE5100.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAACCATAGA
  5   1   2       bld Ski1      in                         CABJ1622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGAACTCAATATGTCTCGCCAACCTCTACATGAACTATTTTTATACAGAAAGAAACCATTGTATGCAAAGGGCAACCTGCCTGCTGGGAACTTCAGGACTATGGATATGGAAAATTCCATTTACACAGTAGCCTGCGGAGTGACAAATGTCGAGGAACTCTGGTGAACAACATATAAAATGCATCTCTTGAAGATCCACTTGACCCAAACTTGCCTTAGCATTATTTTTCCTTTAGTGAAAAAGAAACAATATGCAATTATACTGATTATTTTCCTGAAGGTACTTTTTTGCCCCCTTTATCTTGTAAATGTTAAAAAAATTATTTATTCAGCATTTTTAGCAAGTGACATCATGGTTACATAATCATTTGTTCCTTGGAGACATTTACTATGAAACCATGGGGTGGAAATGGAATGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATNCAGAAGCCACTTTATCAACAATAATGCAACAATAGAT
  5   1   2       bld Egg       in                   TEgg021j07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAACTGATGTTGCTTGACCAGGAACTTGGCAGGGGAGGCCACTGCACTCACAGTGATTTCACAATAGATCTCTATAACTATGAGACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATATATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAG
  3   1   2       bld BrSp 5g3  in                     EC2BBA32AG10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGATTATCAAGAAGCCACTTCACCTACAAGTAATGCAACAATAGATTTCCATGGCTGTAAAATCAGAGGACAGGATGGAACTCACTTGGGATTATCAAGAAGCCACTTCACAAACAGTTAATGCAACAATAGATTTCCATGGCTATAAAACCACAGAGGATAAAGCTAAACCATAAAGATGAGATCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCCGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTTATCAACAATTAATGCAACAATAGATTTCCATTCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAG
  5   1   2      en>5                                 Xt7.1-CABE6302.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACTCACTTTGGATTATCAAGAAGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008231993                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg021j07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTTCCATGGCTGTAAAATCATAGAGAAGAGAAAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATCGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTAATGCAACCGTAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGCTTATTAGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAA
  5   1   2       bld Ova1      in                         CABE6302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAAAAAAAAAAA
  3   1   2      seed Ova1      in                         CABE6302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAG
  3   1   2       bld Ski1      in                         CABJ1622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAG
  3   1   2       bld Tad5      in                         XZT36745.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAG
  3   1   2       bld Ova1      in                         CABE5100.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGAT
  3   1   2       bld TbA  5g3  in                    TTbA069f09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTAATGCAACAATAGATTTTTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAACCCCTAGAAGGGACAAGATGGAACTCCCTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGGTGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCCCAGAAGATAAAGTTAAACCATAAAGATGAAACCATAGGGAAGGGATGGGATGGAACTCCCATTGGATTATTGGGAACTTGGCAGATAGATTTTTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATTTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATTTGAGGGGACCAAACACTACCAAGTACCCAAGCCCCGCACAAATATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTTTACATATATAGATATTTAATTACTTGCAAAGGAAAGAATGGGGTTTTTTTTTTTTAATACTTTTTTTTTCATCGATAAGAAAGTAGTCGTTTTTTTTGTGTGAACAAATCATTGAATAAAGCCCCCTTGGGGTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld HdA  5g3  in                    THdA009i03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATAGAACTCACTTTGGATTATCAAGAGGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCTATCCCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTAATGCAACCGTAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGCTTATTAGGAACTTGGCAGATAGATTTTTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATTTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTTTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATGAGATAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Spl2 5g3  in                        CBSS3334.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGAT
  3   1   2       bld Tad5      in                         XZT71645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCCTTTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAANCCATGGAAGAGACAAGATAGAACTCNCTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCCCCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATTTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCCCCATTGGGGT
  3   1   2       bld TbA  5g3  in                    TTbA069f14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTGAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCCTGGAAGGGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCCCAGAAGATAAAGTTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCCCATTGGATTTTTGGGAACTTGGCAGATAGATTTTTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATTTGTAAGACAGAATCCATCATTGAAAGCCCCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATTTGAGGGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCCCAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTTTACATATATAGATATTTAATTACTTGCAAAGGAAAGAATGGGGTTTTTTTTTTTTAATACTTTTTTTTTCATCGATAAGAAAGTAGTCGTTTTTTTTGTGTGAACAAATCATTGAATAAAGCCCCCTT
  3   1   2       bld Te5  5g3  in                         CAAO5950.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAATTATCAAGAAGCCACTTCAGCTACAGGTAATGCAACCATAGATTTCCATGGCTATAAAACCATAGAAGAGACAAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCACAGAAGATAAAGCTAAACCATAAAGATGAAACCATAGAGAAGAGATGGGATGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACACGTCCCCAGCCGTGTTTAAGCACTGCCTAATTGGATCTGAGCGGACCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGAT
  5  -1   2       bld Abd0                               IMAGE:7017715                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGTAATGCACCCATAGTTTTCCTGGCTTTAAAACCCTAGAAGGGACCAGATAGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTACAGTTGATGCAACCGTAGATTTCCATGGCTGTAAAACCATAGAGAAAAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCACCTATAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCCCCGAAGATAAAGCTAAACCCTAAAGATGAAACCCTAGAGAAGAGATGGGATGGAACTCCCATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCCCCACACACACGTCCCCAGCCGTGTTTAAGCCCTGCCTAATTGGATTTGAGCGGACCAAACACTACCAAGTACCCAAGCCCCGCCCAACTATCAACCCCAAACTGCCGACCCCATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGGCCCCCTTGGGATAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  5g3  in                    TTbA080c11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATAGAGAAGAGACAGGATGGAACTCACTTTGAATTATCAAGAAGCCACTTCAGTTACAGTTAATGCAACAATAGATTTCCATGGCTGTAAAACCATAGAGAAGAGACAGGATGGAACTCACTTTGGATTATCAAGAAGCCACTTCATCTACAGTTAATGCAACCGTTGATTTCTATGGCTGTAAAACCACAGAAGATAAAGTTTATCCCTAATGATGAATCCATAGAGAAGTGATGGGATGGAACTCACATTGGGTTTTTAGGAAATTGGCAGATAGATTTTTATGGTTAGTTGCAGGGAAAGATCTCAAACTTGGATGTGTAAGACAGAATCCATCATTTAAAGCATCACACACAGGTGCCCAGCCGTGTTTAAGCAATGCTTAATTGGTTTTGAGCGGACCAAACATTAGCAAGTATCCAAGCACCGCACAAATATCAAACACAAACTGCGGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTAATATTTTTATGTAGAACCAAGCATATATTATACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATATTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGGAACAAATCATGAATAAGCACCATTAGATAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT12269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGATAAATCTAACCCATAAAGATGAAACCATAGAGAAGAGATGGGAAGGAACTCACATTGGATTATTGGGAACTTGGCAGATAGATTTCTATGGTTACTTGCAGGGAAAGATCCCAAACTTGGATCTGTAAGACAGAATCCATCATTGAAAGCACCACACACGCGTCCCCAGCCGTGTTTAAGCGCTGCCTAATTGGATCTGAGCGGACCAAACGCTTCCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTCCTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTC
  3   1   2       bld Egg  FL   in                    TEgg075e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAACACTACCAAGTACCCAAGCACCGCACAACTATCAACCACAAACTGCCGACCACATTTGTTTTGTTTTTTTAATCCAAAGTTTTAAGTACTATTTTTATGTAGAACCAAGCATATATTCTACATATATAGATATTTAATTACTTGCAAAGGAATGAATGGTGTTTTTTTTTTTTAATACTTTTTTCTTCATCGATAAGAAAGTAGTCGTTTTCTCTGTGTGAACAAATCATTGAATAAAGCACCATTGAGATAAAAAAAAGAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)