Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC6713.5                            6 END     4          14       66                MGC84516 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012154713 Xt7.1-CAAM15742.3.5 - 27 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAM15742.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATCCAAACCATTCAAGGCATTCAAACCATCCAAGCTATCCAGCCAATTCAAACCATACAGACTCTCCAGCCTATCCAAACCATTCAGCCTCTGCAGACAATTCAGACTCTCCAAGGAAACAGGATTGTGACTTCTATTCAACAAATCCATATAATACAGGCGGAAAATGTTCCGGCAGAGACCACCTACAAGGCCCCCAAAGAAAAGCTTTTCTACCTCCCTCATGTGTGCAACTATACTTGCCTGTCGCGCATTCGCCCCGTCTCCCACCGTGGCAAGAACCCCCTCTTGGTTCCATTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCTTTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCCCAGACATCACATATGGCAAGGAAGATGTTCCACTTTCCTGTGTCAATGAAATAGACAGGACCCCACCTCCACAAGTGGCCTACAGCAAGGAGCGCATCCCTGGGAAAGGTGTCTTTATTAATACCGGCGCCGAGTACCTTGTGGGATGTGACTGCACAGATGGCTGTAGGGACAAATCCAAATGTGCCTGTCACCAGCTGACAATCCAAGCCACAGGCTGCACTCCAGGGGCACAGCTGAACCCCATGGCCGGATATCAGCACAAGCGCTTGGAAGAATGCCTTCCCACTGGTGTGTACGAGTGCAACAAGCGGTGCAAATGCAGTGCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATTCACCGGACTACCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTCTGGAAT
                                                  Xt7.1-CHK-1008266542                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAACCATTCAAGGCATTCAAACCATCCAAGCTATCCAGCCAATTCAAACCATACAGACTCTCCAGCCTATCCAAACCATTCAGCCTCTGCAGACAATTCAGACTCTCCAAGGAAACAGGATTGTGACTTCTATTCAACAAATCCATATAATACAGGCGGAAAATGTTCCGGCAGAGACCACCTACAAGGCCCCCAAAGAAAAGCTTTTCTACCTCCCTCATGTGTGCAACTATACTTGCCTGTCGCGCATTCGCCCCGTCTCCCACCGTGGCAAGAACCCCCTCTTGGTTCCATTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCTTTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCCCAGACATCACATATGGCAAGGAAGATGTTCCACTTTCCTGTGTCAATGAAATAGACAGGACCCCACCTCCACAAGTGGCCTACAGCAAGGAGCGCATCCCTGGGAAAGGTGTCTTTATTAATACCGGCGCCGAGTACCTTGTGGGATGTGACTGCACAGATGGCTGTAGGGACAAATCCAAATGTGCCTGTCACCAGCTGACAATCCAAGCCACAGGCTGCACTCCAGGGGCACAGCTGAACCCCATGGCCGGATATCAGCACAAGCGCTTGGAAGAATGCCTTCCCACTGGTGTGTACGAGTGCAACAAGCGGTGCAAATGCAGTGCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATxxxCxGGACTACCxTxxxTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACxxxTxCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     1     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     6     7     6     7     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     7     7     6     6     6     6     6     6     5     6     4     6     5     7     6     8     7     9     8    10     8    10    10    12    10    12    10    12    10    12    13    14    12    13    15    16    15    16    14    16    15    16    15    16    16    17    16    17    16    17    17    18    17    17    17    17    17    17    18    19    19    19    18    18    16    18    17    18    18    18    16    17    17    17    16    17    17    17    17    17    17    17    17    17    17    17    16    16    15    16    15    16    15    16    15    16    15    16    16    16    15    16    13    15    13    15    13    15    11    15    12    14     8    14     7    14     8    14    14    14     6    13     7    13     7    13     7    13     7    13     6    13     6    13     6    13     6    12     5    12     5    11     4     9     3     5
  5   1   2      ests                             Xt7.1-NISC_ng22h04.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGAATCAGTGCCGCCGCCACCACCACCACCACCTCCACCTCCTGCTGTTCAGCGTCCTTTCCAGTCCAACCAATCTGTACAGCCTGTCCAGTCTATACAGTCCATTCAGAATATACAGACCATCCAAACCATTCAAGGCATTCAAACCATCCAAGCTATCCAGCCAATTCAAACCATACAGACTCTCCAGCCTATCCAAACCATTCAGCCTCTGCAGACAATTCAGACTCTCCAAGGAAACAGGATTGTGACTTCTATTCAACAAATCCATATAATACAGGCGGAAAATGTTCCGGCAGAGACCACCTACAAGGCCCCCAAAGAAAAGCTTTTCTACCTCCCTCATGTGTGCAACTATACTTGCCTGTCGCGCATTCGCCCCGTCTCCCACCGTGGCAAGAACCCCCTCTTGGTTCCATTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCTTTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCCCAGACATCACATATGGCAAGGAAGATGTTCCACTTTCCTGTGTCAATGAAATAGACAGGACCCCACCTCCACAAGTGGCCTACAGCAAGGAGCGCATCCCTGGGAAAGGTGTCTTTATTAATACCGGCGCCGAGTACCTTGTGGGATGTGACTGCACAGATGGCTGTAGGGACAAATCCAAATGTGCCTGTCACCAGCTGACAATCCAAGCCACAGGCTGCACTCCAGGGGCACAGCTGAACCCCATGGCCGGATATCAGCACAAGCGCTTGGAAGAATGCCTTCCCACTGGTGTGTACGAGTGCAACAAG
  5   1   2      ests                                Xt7.1-CAAM15742.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCAGTGCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGAACTACCCTTCTGCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTCT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T-T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C---A
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ci ---- 6e-010     BAE06306.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================
                                                                                                                             PROTEIN --- Sc ---- 1e-010     NP_011987.1 Gene has a 'SET' or 'TROMO' domain at its carboxyterminus like the trithoraxgene family from human and Drosophila with postulated function inchromatin-mediated gene regulation.; Set1p [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 2e-044     NP_498848.1 Methyl-CpG binding and nuclear protein SET (3J469) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---- 2e-057     AAI35303.1 Unknown (protein for MGC:121304) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Sp ==== 6e-059     XP_001188572.1 PREDICTED: similar to MGC84516 protein [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PROTEIN --- Dm ---- 6e-073     NP_726483.1 CG30426-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 1e-160     NP_001070745.1 hypothetical protein LOC768131 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_423391.2 PREDICTED: similar to SET domain, bifurcated 1 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_061365.2 SET domain, bifurcated 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_036564.2 SET domain, bifurcated 1; SET domain, bifurcated, 1; ERG-associated protein witha SET domain, ESET [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH72374.1 MGC84516 protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          NP_001085076.1 hypothetical protein LOC432147 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAM15742.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------ATG------------------------------------------------ATG---------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------TAA------------------------TAG------------------------------------------------TAA---------TGA---ATG------------------------------------------------------ATGATG------------------------------ATGTAG---TAG------ATG---------------------------ATGTAATAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2      ests                             Xt7.1-NISC_ng22h04.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGAATCAGTGCCGCCGCCACCACCACCACCACCTCCACCTCCTGCTGTTCAGCGTCCTTTCCAGTCCAACCAATCTGTACAGCCTGTCCAGTCTATACAGTCCATTCAGAATATACAGACCATCCAAACCATTCAAGGCATTCAAACCATCCAAGCTATCCAGCCAATTCAAACCATACAGACTCTCCAGCCTATCCAAACCATTCAGCCTCTGCAGACAATTCAGACTCTCCAAGGAAACAGGATTGTGACTTCTATTCAACAAATCCATATAATACAGGCGGAAAATGTTCCGGCAGAGACCACCTACAAGGCCCCCAAAGAAAAGCTTTTCTACCTCCCTCATGTGTGCAACTATACTTGCCTGTCGCGCATTCGCCCCGTCTCCCACCGTGGCAAGAACCCCCTCTTGGTTCCATTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCTTTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCCCAGACATCACATATGGCAAGGAAGATGTTCCACTTTCCTGTGTCAATGAAATAGACAGGACCCCACCTCCACAAGTGGCCTACAGCAAGGAGCGCATCCCTGGGAAAGGTGTCTTTATTAATACCGGCGCCGAGTACCTTGTGGGATGTGACTGCACAGATGGCTGTAGGGACAAATCCAAATGTGCCTGTCACCAGCTGACAATCCAAGCCACAGGCTGCACTCCAGGGGCACAGCTGAACCCCATGGCCGGATATCAGCACAAGCGCTTGGAAGAATGCCTTCCCACTGGTGTGTACGAGTGCAACAAG
                                                  Xt7.1-CHK-1008250795                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCAGTGCCGCCGCCACCACCACCACCACCTCCACCTCCTGCTGTTCAGCGTCCTTTCCAGTCCAACCAATCTGTACAGCCTGTCCAGTCTATACAGTCCATTCAGAATATACAGACCATCCAAACCATTCAAGGCATTCAAACCATCCAAGCTATCCAGCCAATTCAAACCATACAGACTCTCCAGCCTATCCAAACCATTCAGCCTCTGCAGACAATTCAGACTCTCCAAGGAAACAGGATTGTGACTTCTATTCAACAAATCCATATAATACAGGCGGAAAATGTTCCGGCAGAGACCACCTACAAGGCCCCCAAAGAAAAGCTTTTCTACCTCCCTCATGTGTGCAACTATACTTGCCTGTCGCGCATTCGCCCCGTCTCCCACCGTGGCAAGAACCCCCTCTTGGTTCCATTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCTTTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCCCAGACATCACATATGGCAAGGAAGATGTTCCACTTTCCTGTGTCAATGAAATAGACAGGACCCCACCTCCACAAGTGGCCTACAGCAAGGAGCGCATCCCTGGGAAAGGTGTCTTTATTAATACCGGCGCCGAGTACCTTGTGGGATGTGACTGCACAGATGGCTGTAGGGACAAATCCAAATGTGCCTGTCACCAGCTGACAATCCAAGCCACAGGCTGCACTCCAGGGGCACAGCTGAACCCCATGGCCGGATATCAGCACAAGCGCTTGGAAGAATGCCTTCCCACTGGTGTGTACGAGTGCAACAAGCGGTGC
  5   1   2       bld HeRe                             EC2CAA32CC03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCGAATCAGTGCCGCCGCCACCACCACCACCACCTCCACCTCCTGCTGTTCAGCGTCCTTTCCAGTCCAACCAATCTGTACAGCCTGTCCAGTCTATACAGTCCATTCAGAATATACAGACCATCCAAACCATTCAAGGCATTCAAACCATCCAAGCTATCCAGCCAATTCAAACCATACAGACTCTCCAGCCTATCCAAACCATTCAGCCTCTGCAGACAATTCAGACTCTCCAAGGAAACAGGATTGTGACTTCTATTCAACAAATCCATATAATACAGGCGGAAAATGTTCCGGCAGAGACCACCTACAAGGCCCCCAAAGAAAAGCTTTTCTACCTCCCTCATGTGTGCAACTATACTTGCCTGTCGCGCATTCGCCCCGTCTCCCACCGTGGCAAGAACCCCCTCTTGGTTCCATTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCCTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCC
  5   1   2      seed Neu0      in                     NISC_ng22h04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCATCCAAACCATTCAAGGCATTCAAACCATCCAAGCTATCCAGCCAATTCAAACCATACAGACTCTCCAGCCTATCCAAACCATTCAGCCTCTGCAGACAATTCAGACTCTCCAAGGAAACAGGATTGTGACTTCTATTCAACAAATCCATATAATACAGGCGGAAAATGTTCCGGCAGAGACCACCTACAAGGCCCCCAAAGAAAAGCTTTTCTACCTCCCTCATGTGTGCAACTATACTTGCCTGTCGCGCATTCGCCCCGTCTCCCACCGTGGCAAGAACCCCCTCTTGGTTCCATTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCTTTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCCCAGACATCACATATGGCAAGGAAGATGTTCCACTTTCCTGTGTCAATGAAATAGACAGGACCCCACCTCCACAAGTGGCCTACAGCAAGGAGCGCATCCCTGG
  5   1   2       bld Egg       in                   TEgg002k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATTTACTTTATGACTTCCGGCGAATGACCGCCCGGCGGCGGGTGAACCGCAAAATGGGTTTCCACGTCATCTACAAGACTCCCTGCGGCCTGAGCTTGCGCACAATGCCGGAAATTGAGCGGTACCTTTTTGAGGTGGAATGCAGAATGCTCTTCCTGGAAATGTTTTGTTTGGACCCTTACGTTTTGGTGGATCGGAAATTTCAGCCTCAGAAACCCTTTTACTACATCCCAGACATCACATATGGCAAGGAAGATGTTCCACTTTCCTGTGTCAATGAAATAGACAGGACCCCACCTCCACAAGTGGCCTACAGCAAGGAGCGCATCCCTGGGAAAGGTGTCTTTATTAATACCGGCGCCGAGTACCTTGTGGGATGTGACTGCACAGATGGCTGTAGGGACAAATCCAAATGTGCCTGTCACCAGCTGACAATCCAAGCCACAGGCTGCACTCCAGGGGCACAGCTGAACCCCATGGCCGGATATCAGCACAAGCGCTTGGAAGAATGCCTTCCCACTGGTGTGTACGAGTGCAACAAGCGGTGCAAA
  5   1   2      ests                                Xt7.1-CAAM15742.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCAGTGCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGAACTACCCTTCTGCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTCT
                                                  Xt7.1-CHK-1008229350                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCxxCxGxACTACCxTxxxxCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTxxTxCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTCTGGAATT
  5   1   2       bld In62                            IMAGE:8954190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGCACACGCTTGAACCCCATGGCCGGATACCAGCACAAGCGCTTGGAAGAATGCCTTCCCACTGGTGTGTACGAGTGCAACAAGCGGTGCAAATGCAGTGCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGAGATGAACATCAGAGACTGCTTCAAGGACTCGGCTCTGGCAGCAGACAGTCAGATGAACACGATGCAACTGCCGAGAACTCAGACAGTGCTCTGTAGTCAAACATGCGATCTCTATGATCGCGAGCTCCAAGTGGAACCTCAAACGTACAAGATCGCAGCAGCATACAGGTCGAAGACGTGACGTACACCCGCCGCAAAACGTGGACGCTGTACAACGGTGCCAAAGGCGCACTGCAGCATGTGATCGCTTCCACCGAGGGGGAGGACAGGCAACCCTAGCGAGCGAACCATA
  5   1   2       bld Ovi1      in                         CABI7392.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCGATTCGCAATGCAGTGCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAAACAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAG
  5   1   2       bld Egg                            TEgg138f03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGAATATGTGCAACAACCGCCTTGTACAACATGGGCTCCAGGTGCGCCTCCAACTCTTCAAAACCCAGAACAAGGGCTGGGGCATCCGGTGTTTGGATGATATAGCGAAAGGCTCCTTTGTTTGCATCTATGCAGGTAAGATCCTCACAGACGACTTTGCGGACAAAGAGGGCCTGGAGATGGGGGACGAGTACTTTGCTAACTTGGACCACATTGAAAGTGTCGAGAACTATAAGGAAGGCTATGAGAGTGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAG
  5   1   2       bld In62                            IMAGE:8957039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAAGGGGGTATTGAGAGGGACGCCAAGTCTTCCTCCGATAGCAGTGGCGTAGACCTTAAAGACGACGATGAGGAAAACACTGGCAGCGAAGACCAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGTGGGAAGTGGGACCAACGGGACCAAAAACCCGCCGCTCAGGCACAGCGAATGACAGCGATGACATCCAGACATCTCATCTGGGTCTGACGAGGAGAGAGAGAGACGTAGCTACTACTGGCGGGCCTGTCAAAGACAGTGCCTGTAAATCCACCCGAGGATTCGCCTTTAATCCACCACGTATCCCTGTGAATCAACATGCGTCGGTGAGTGTACGAACGGCGACCACGAAGGTCTTGATGGGAAGAGAATCCTGTTACTTATATTGACCTTAAC
  5   1   2       bld Tbd1      in                         CBXT7871.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGACGAGTCCAATGACAGTTCAGATGACAATTTCGGCAAGAACGAGGACATCACGACCAGCTCAGTGTGGCGCAGTTACGCCACCCGCAGACAGACACGGGGCCAGAAGGAGAATGGAACATCAGAGACTGCTTCCAAGGACTCGGCTCTGGCCAGGCAGACCAGTCAGGATGAAACCACGGATTGCAAACTGCCGGAGGAGACCTCCAAGAACAAGGTGGCTTCCTGGTTAAGTTCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAA
  5   1   2      seed Te5                                 CAAO12387.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCCGCAAACACCATGGCGGACTCTCTTATGGACTCTGACAGCAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATC
  5   1   2       bld Egg                            TEgg052a13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGTCTTCTCTAAAGATGGGAGACGCATCAGAGACCGATAAACCAAAGGAATCAGACGAGGCCAGCAAATACCCAGGGTTCGGAGAAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGTGCCGATACTTGAATCATAGCTGCAGCCTCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCT
  5   1   2       bld Brn4                                CAAL20074.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGAAACAGGATGTACGGTTACAACCCCGCCCCGGCCAAAAAAGACGGTGTGCGACGGCCTGTTAGCAAAACCGCGTTGCACCAGAACAAGCGCCAGTCAAACTCTGCACAGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGACCAAAAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCA
  5   1   2       bld HeRe      in                     EC2CAA19DC03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCCACTGATGAAGTCCTGACTTTATCCAGCAGCTCGGAGAGTGAGGTGGGAAGTGGGACCAACGGGAGCAAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGG
  5   1   2       bld Gas7      in                         XZG46164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAAACCCGCCGCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTC
  3   1   2       bld Gas7 PIPE out                        XZG33859.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTCAGGCCACAGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGATTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGGTGGCATCCCCTACTGTCTGGAAT
  3   1   2       bld Te3  5g3  out                       CAAM15742.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCGAATGACAGCGATGACATCCAGACAATCTCATCTGGGTCTGNCGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGT
  5   1   2       bld Brn4      in                        CAAL23384.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCGATGACATCCAGACAATCTCATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGT
  3   1   2       bld Ovi1      in                         CABI7392.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCTGGGTCTGACGAGGAAGAGGAGAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGNGGTGGCATCCC
  5   1   2       bld HeRe                             EC2CAA17DD11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGTCTGACGAGGAAGAGGACAAGAAGAACGTAGCTACTACTGCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGA
  3   1   2       bld Brn4      in                        CAAL23384.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCGGGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGGTGGCATCCCCTACTGTCTGGAATT
  3   1   2       bld Egg       out                   TEgg037k01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCCTGTCAAAAGACAAGTGGCTGTAAAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCATCTGTTCTGGAATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te4       out                        CAAN7883.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAATCCCCCCGGGGGTTTGCCTTTAAATCCCCCCCCGGGTTCCCTGTGAAAACCAACATGGGGTTGGGTGAGGGGGGTTCCGGACGGGGGGACCCCCGACAGTTTTTTTATGGGGGGGGGTCCTGTTTCATTTTTGGCGCTAAACTTGAAGGCAACTTGGGGCGATACTTGAATTATAGGTGCAGCCCCCACCTTTTTTTACAAAAAGGGTTTGGGGATACCCCTGATTTTCGGTTTCCTTGGGGGGCCTTTTTTTCCACCAAGAGGATACGCGCCGGCCCGGAGCTCCCCTGGGGTTTCAATTTCGAGGGGGGAAGTGTAGAAGGAAAAAAAATTCTTTGGTGCTGGGGATCCCCGGAAATTTGGGGCCGTTTTTTTTAAACCCCCCCTAAAGATGGCGGGTAAAGTTTTCGGCCCTTCTTCCGGGGTTAGGGGGCTTTCCTTTTAACCAAACATTTTTCATTTTTTTTTTTTTTTTTGGAAAAATATGGGGGGCAAAAGAAAAGTCCCCCCCCTAAATCCCCGGGCTACCCTTTTGTTTTGTATAGAAACTTTTTGATGTTTGGCACAGAAATTTTTCCCCCCCCTTTATGTAGATTTAGGGGGTTTTGTTTGATATTTTTCCCG
  3   1   2       bld Egg       in                    TEgg002k11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAGGGGTGGCATCCCCTACTGTCTGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                         CBXT7871.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCACCCGAGGATTCGCCTTAAAATCCACACACGGTATCACTGTGAAAACCAACATGGCGTCGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAAATTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACCGAATGTGTTTGTGGATACCCATGATTTACGGTTCCCTTGGGTGGCCTTTTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCCCCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTTTTTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTTTCCTTTTAACCATACATTTTTCATCTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG46164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGGGTGAGGGTGGTACCGGACGGCGGAACACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATTTACGGTTCCCTTGGGTGGCCTTTTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCCCCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGGGGATCCACGGAATGTCGTGGCCGTTTTTTATAAACCCCCCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGGGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTCGGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTCTGGAATTAGTACTCGC
  5   1   2       bld Gas7                                  XZG7729.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACACGACAGTTCTTTGATGGGGAGGAGTCCTGTTACATTATTGACGCTAAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCTTTTTTTTTTTTTTCTGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTCTGTCTTGTATAGAAACTTTATGATGTTTGGCACAGAACTCTTCCCCCCGCTCTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTGGCATCCCCTACTGTCTGG
  3   1   2       bld Neu0      in                     NISC_ng22h04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTTTTTGTACAGAATGTGTTTGTGGATACCCATGATTTACGGTTCCCTTGGGTGGCCTTTTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCCCCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTTTTTTATAAACCCCCCATAAAGATGGCAGCTAAAGTTTACGCCCCTTCATCCGTGGTTAGAGGCCTTTCCTTTTAACCAAACATTTCTCATCTTTTTTTTTTTTTTCGGTAAAATTATGGCTGACAAATGAAATGTCCCCCCCCTAAATCACCGGACTACCCTTTTGTTTTGTATAGAAACTTTATGATGTTTGGCACAGAACTTTTCCCCCCCGCTTTATGTAGATTTAGGTGTTTATGTTTGATATTTTTCCATGTATAAATAAAATGTAATAAAAGGGTaaaaaaaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld HeRe      in                     EC2CAA19DC03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGAAGGCAACTTGGGCCGATACTTGAATCATAGCTGCAGCCCCAACCTCTTTGTACAGAATGTGTTTGTGGATACCCATGATCTACGGTTCCCTTGGGTGGCCTTCTTTGCCAGCAAGAGGATACGCGCCGGCACGGAGCTCACCTGGGATTACAATTACGAGGTGGGAAGTGTAGAAGGAAAGAAACTGCTGTGCTGCTGCGGATCCACGGAATGTCGTGGCCGTCTCTTATAAACCCACCATAAAGATGGCAGCTAAAGTTTACGACACTTCATCCGTGGTTAGAGGCCTCTCCTTTTAACCATACATTTCTCATCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)