Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ6318.5                            3 END     1           3       50                Clock [Xenopus laevis]
     2   2.0    0Xt7.1-CAAK2058.3                            2 END     2           6      100                circadian rhythmicity protein CLOCK [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012154720 Xt7.1-CABI10276.3.5 - 31 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABI10276.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCTGCTCAAGCGCAATTAGCCCAGCAGCCACAGCAGTTTTTGCAGACCTCTAGGTTGGTCCATGGAAACCAGTCCACACAGCTCATCCTTTCCCCTTTCCCTGTGCAACAGAACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTGATAGGATACATTAGCTGGGCCTGTGCCACTGATAGATACAATAGCTTCTATATCACTATTCCTAGCAGGCCTGAATACTGATCAGATTTTACATTAAGTGGAGTATGTATTAACATTGGAGGCAAACATCACTGGTGATATTGCCCATAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTATGGGCAGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACTCGTGAAGTTACTAATGAATACAGCAGACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTTAGCAAATCAGCCCACGTTTGATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGAGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGAAGGGCTGGAAATTGGCCGATGTGCTAATAAGTCTTACTGTTACCATCTCAGGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCAGATTATTAGGCCACTTGCTGGTAAGTTTTCATTGGCCAGTTATACTGACTGACTTCAGGTTCACATTAGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTGCCCGGAGCTAATGATAGGCAAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATAGGTCTCTAACTCAGGCCCAATCATCCCTTCCATGGCCCTGCCGTGTCCTTCCTCTAAGCATTGGGTTCTACCATTTAATAACTGTGTTTTCCCATCGCTGTGTCAATGTATTTCTGCCTACTGACCATGCCTGTCGGCCATTTTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTGTGTTTGGTTCAGAAATGAGACAGAATTTCACTATTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAATAAATAAATCTCTGCACCCAAATTGTAGTGGATGTTAAATAAATCTCT
                                                  Xt7.1-CHK-1008266544                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCAAGCGCAATTAGCCCAGCAGCCACAGCAGTTTTTGCAGACCTCTAGGTTGGTCCATGGAAACCAGTCCACACAGCTCATCCTTTCCCCTTTCCCTGTGCAACAGAACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTGATAGGATACATTAGCTGGGCCTGTGCCACTGATAGATACAATAGCTTCTATATCACTATTCCTAGCAGGCCTGAATACTGATCAGATTTTACATTAAGTGGAGTATGTATTAACATTGGAGGCAAACATCACTGGTGATATTGCCCATAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTATGGGCAGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACTCGTGAAGTTACTAATGAATACAGCAGACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTTAGCAAATCAGCCCACGTTTGATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGAGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGAAGGGCTGGAAATTGGCCGATGTGCTAATAAGTCTTACTGTTACCATCTCAGGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCAGATTATTAGGCCACTTGCTGGTAAGTTTTCATTGGCCAGTTATACTGACxGAxTxCAGGTTxxxxxxAGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTxxxxxxxxxxxxTGATAGGCAAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATAGGTCTCTAACTCAGGCCCAATCATCCCTTCCATGGCCCTGCCGTGTCCTTCCTCTAAGCATTGGGTTCTACCATTTAATAACTGTGTTTTCCCATCGCTGTGTCAATGTATTTCTGCCTACTGACCATGCCTGTCGGCCATTTTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAxxTGxxxxxxxTxxxxTxxxxAAxTGAGACAGAATTTCACTATTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAxxxxxxAxxxxxTGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     3     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     2     1     2     1     2     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     3     1     1     1     1     1     1     1     1     1     1     1     2     1     4     1     4     1     4     1     4     1     4     1     4     2     7     3     7     3     8     5    10     5    10     6    11     6    11     6    11     6    12     6    14     6    14     6    15     7    16     7    16     7    16     7    16     7    16     7    16     7    16     7    16    11    16     6    16     6    16     6    17     6    16     6    18     6    18     6    18     6    18     6    18     6    18     8    20     9    20     9    20     9    20     9    20     9    20     9    20     9    20    11    21    11    21    11    21    11    21    10    21     9    21     9    21     9    21     9    21     9    21     8    21     8    21     8    21     8    21     8    21     8    21     8    21     8    21     9    22     9    22     9    21     9    20     9    20     8    19     7    18     7    18     7    18     6    18     7    18     7    18     5    14     4     7     3     5     3     4
  5   1   2  SIG                                      Xt7.1-CAAK9340.3                                                                                                                                                                                                                                                                                                                   CCAACGGCAACAGGAGGAGCTGCGTAAGATTCAAGAGCAGCTGCATATGGTCCATGGGCAGGGAATCCAGATGTTCTTACAACAACCAGGACCAGGGCTAAATTTTGGGCCGGTGCAAGTCTCTTCTGCAAACAGTGCAAGCATTCAGCAGTTACCACAGCTCACCATGCAAGGCCAGGTGGTCCAAACTAATCAACTTCAAGCTGGCATGAACACTGGGCATGTGGGAGCTCAGCACATAATGCAGCAGCAACAGTTACAGACTACAAGCCAGCAAGGCCAGCAGAATATTCATGGAGGGCACAGCCAGCAGACTTCTCTGTCTAGCCAGACGTCTGGAACACTCACTAGTCCTTTGTACAACACTATGGTGATCTCCCAGCCACCTTCTGGTAGTATGGTACAGATGCCTTCCAACATACAGCAGAGCAACCAGGGAGCCTCTGTCACTACATTTCCTCAGGACAGGCAGATTAGGTTTTCTCAAGCTCAACAAATTGTTACTAAGCTGGTGACCACTCCTGTGGCTTGTGGGACAGTTATGGTCCCAAGCACAATGTTTATGGGCCCAGTGGTTACTGCCTACCCTACATTTGCTACACAGCAACAGCAGCAGCAGCAGCAACCCCAGACCTTATCAATAACCCAGCACCAACCAAATCAGCAAGACCAGCAGTCAATGCCTACAGTACAGCAGCCTGCTCAAGCGCAATTAGCCCAGCAGCCACAGCAGTTTTTGCAGACCTCTAGGTTGGTCCATGGAAACCAGTCCACACAGCTCATCCTTTCCCCTTTCCCTGTGCAACAGAACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATGTCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATGATATAACACTATTTGAGGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAACAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCC
  5   1   2  SIG                                     Xt7.1-CABI10276.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTGATAGGATACATTAGCTGGGCCTGTGCCACTGATAGATACAATAGCTTCTATATCACTATTCCTAGCAGGCCTGAATACTGATCAGATTTTACATTAAGTGGAGTATGTATTAACATTGGAGGCAAACATCACTGGTGATATTGCCCATAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTATGGGCAGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACTCGTGAAGTTACTAATGAATACAGCAGACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTTAGCAAATCAGCCCACGTTTGATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGAGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGAAGGGCTGGAAATTGGCCGATGTGCTAATAAGTCTTACTGTTACCATCTCAGGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCAGATTATTAGGCCACTTGCTGGTAAGTTTTCATTGGCCAGTTATACTGACTCTGACTTGGGAAGACCCAGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTAGAATTTTTAGGTGATAGGCAAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATAGGTCTCTAACTCAGGCCCAATCATCCCTTCCATGGCCCTGCCGTGTCCTTCCTCTAAGCATTGGGTTCTACCATTTAATAACTGTGTTTTCCCATCGCTGTGTCAATGTATTTCTGCCTACTGACCATGCCTGTCGGCCATTTTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTATTAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABJ6318.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGGTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACGTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAGCGGCCGC
  5   1   2  SIG                                      Xt7.1-XZT16244.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGCAGATTGTGGGACTTTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAACAAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATC------------AAAAAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTTTCTATAAAGCCCCCCGGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTCTCAAAGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -C----T-----
                                                                       ...PROTEIN --- Dr ---- 2e-008     NP_840080.1 clock homolog 3 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-019     NP_004889.1 clock [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-019     NP_989505.2 clock [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-020     NP_031741.1 circadian locomoter output cycles kaput [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-030     AAF34772.1 Clock [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================
                                                   Xt7.1-CABI10276.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------TAG---------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------ATG------------------------------TGA---------TAA------------------------------------------------------------------------------------TGATGA---------------------------TGA------TAA---------------------------------TAA---TAG---------TAG---TAG---------TAA---------TAA---------------------------------------TGA------------TAA------------------------------------ATGTGA------------------------------TAA------TGA---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------TGA------------------------------------------------------TGA---------TAA---------------------------------------------------TGA------------------------------------------ATG---------------------------TGA------------------------------------------TGA------------------------------------------ATG------TGA------------------------------------TGA------------------------------------------------------------------------------------------------------------TGA------------------ATG---TAATAA---------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------ATG------------------------------------------TAATGATAG---------------------------------------------TAA---------------------------------------------TAA------------------TAATAA------------------------ATG------------------ATG------------------------------------------------------------------------TGA---------------------TAATGA------------------ATG---------------------------------TAA---------TAA---------------------TAA---------------------ATGATG---------------TAA---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------ATG---TAA---------------------------------------------------------------------------------------------------------------------TGA---------------------------------ATG---------TAA---------------------TAA---------------------------------------------------------------------------------------------------------TAATGA---------------------------------------------------------------TAATAA------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                ]
  5   1   2  SIG                                      Xt7.1-CAAK9340.3                                                                                                                                                                                                                                                                                                                   CCAACGGCAACAGGAGGAGCTGCGTAAGATTCAAGAGCAGCTGCATATGGTCCATGGGCAGGGAATCCAGATGTTCTTACAACAACCAGGACCAGGGCTAAATTTTGGGCCGGTGCAAGTCTCTTCTGCAAACAGTGCAAGCATTCAGCAGTTACCACAGCTCACCATGCAAGGCCAGGTGGTCCAAACTAATCAACTTCAAGCTGGCATGAACACTGGGCATGTGGGAGCTCAGCACATAATGCAGCAGCAACAGTTACAGACTACAAGCCAGCAAGGCCAGCAGAATATTCATGGAGGGCACAGCCAGCAGACTTCTCTGTCTAGCCAGACGTCTGGAACACTCACTAGTCCTTTGTACAACACTATGGTGATCTCCCAGCCACCTTCTGGTAGTATGGTACAGATGCCTTCCAACATACAGCAGAGCAACCAGGGAGCCTCTGTCACTACATTTCCTCAGGACAGGCAGATTAGGTTTTCTCAAGCTCAACAAATTGTTACTAAGCTGGTGACCACTCCTGTGGCTTGTGGGACAGTTATGGTCCCAAGCACAATGTTTATGGGCCCAGTGGTTACTGCCTACCCTACATTTGCTACACAGCAACAGCAGCAGCAGCAGCAACCCCAGACCTTATCAATAACCCAGCACCAACCAAATCAGCAAGACCAGCAGTCAATGCCTACAGTACAGCAGCCTGCTCAAGCGCAATTAGCCCAGCAGCCACAGCAGTTTTTGCAGACCTCTAGGTTGGTCCATGGAAACCAGTCCACACAGCTCATCCTTTCCCCTTTCCCTGTGCAACAGAACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATGTCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAATGATATAACACTATTTGAGGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAACAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCC
                                                  Xt7.1-CHK-1008293520                                                                                                                                                                                                                                                                                                                         GCAACAGGAGGAGCTGCGTAAGATTCAAGAGCAGCTGCATATGGTCCATGGGCAGGGAATCCAGATGTTCTTACAACAACCAGGACCAGGGCTAAATTTTGGGCCGGTGCAAGTCTCTTCTGCAAACAGTGCAAGCATTCAGCAGTTACCACAGCTCACCATGCAAGGCCAGGTGGTCCAAACTAATCAACTTCAAGCTGGCATGAACACTGGGCATGTGGGAGCTCAGCACATAATGCAGCAGCAACAGTTACAGACTACAAGCCAGCAAGGCCAGCAGAATATTCATGGAGGGCACAGCCAGCAGACTTCTCTGTCTAGCCAGACGTCTGGAACACTCACTAGTCCTTTGTACAACACTATGGTGATCTCCCAGCCACCTTCTGGTAGTATGGTACAGATGCCTTCCAACATACAGCAGAGCAACCAGGGAGCCTCTGTCACTACATTTCCTCAGGACAGGCAGATTAGGTTTTCTCAAGCTCAACAAATTGTTACTAAGCTGGTGACCACTCCTGTGGCTTGTGGGACAGTTATGGTCCCAAGCACAATGTTTATGGGCCCAGTGGTTACTGCCTACCCTACATTTGCTACACAGCAACAGCAGCAGCAGCAGCAACCCCAGACCTTATCAATAACCCAGCACCAACCAAATCAGCAAGACCAGCAGTCAATGCCTACAGTACAGCAGCCTGCTCAAGCGCAATTAGCCCAGCAGCCACAGCAGTTTTTGCAGACCTCTAGGTTGGTCCATGGAAACCAGTCCACACAGCTCATCCTTTCCCCTTTCCCTGTGCAACAGAACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATGTCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTTTTTTAATGATATAACACTATTTGAGGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAACAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAC
  5   1   4      seed Brn3      in                         CAAK9340.5p                                                                                                                                                                                                                                                                                                                   CCAACGGCAACAGGAGGAGCTGCGTAAGATTCAAGAGCAGCTGCATATGGTCCATGGGCAGGGAATCCAGATGTTCTTACAACAACCAGGACCAGGGCTAAATTTTGGGCCGGTGCAAGTCTCTTCTGCAAACAGTGCAAGCATTCAGCAGTTACCACAGCTCACCATGCAAGGCCAGGTGGTCCAAACTAATCAACTTCAAGCTGGCATGAACACTGGGCATGTGGGAGCTCAGCACATAATGCAGCAGCAACAGTTACAGACTACAAGCCAGCAAGGCCAGCAGAATATTCATGGAGGGCACAGCCAGCAGACTTCTCTGTCTAGCCAGACGTCTGGAACACTCACTAGTCCTTTGTACAACACTATGGTGATCTCCCAGCCACCTTCTGGTAGTATGGTACAGATGCCTTCCAACATACAGCAGAGCAACCAGGGAGCCTCTGTCACTACATTTCCTCAGGACAGGCAGATTAGGTTTTCTCAAGCTCAACAAATTGTTACTAAGCTGGTGACCACTCCTGTGGCTTGTGGGACAGTTATGGTCCCAAGCACAATGTTTATGGGCCCAGTGGTTACTGCCTACCCTACATTTGCTACACAGCAACAGCAGCAGCAGCAGCAACCCCAGACCTTATCAATAACCCAGCACCAACCAAATCAGCAAGACCAGCAGTCAATGCCTACAGTACAGCAGCCTGCTCAAGCGCAATTAGCCCAGCAGCCACAGCAGTTTTTGCAGACCTCTAGGTTGGTCCATGGAAACCAGTCCACACAGCTCATCCTTTCCCCTTTCCCTGTGCAACAGAACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGA
  5   1   2       ext Brn3      in                         CAAK4548.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCCTGCTCAAGCGCAATTAGCCCAGCAGCCACAGCAGTTTTTGCAGACCTCTAGGTTGGTCCATGGAAACCAGTCCACACAGCTCATCCTTTCCCCTTTCCCTGTGCAACAGAACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATGTCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTG
  3   1   2       ext Brn3      in                         CAAK4548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTATTTTTTTTAATGATATAACACTATTTGAGGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAACAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAACTG
  3   1   4      seed Brn3      in                         CAAK9340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAACAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCCC
  5   1   2  SIG                                     Xt7.1-CABI10276.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTGATAGGATACATTAGCTGGGCCTGTGCCACTGATAGATACAATAGCTTCTATATCACTATTCCTAGCAGGCCTGAATACTGATCAGATTTTACATTAAGTGGAGTATGTATTAACATTGGAGGCAAACATCACTGGTGATATTGCCCATAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTATGGGCAGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACTCGTGAAGTTACTAATGAATACAGCAGACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTTAGCAAATCAGCCCACGTTTGATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGAGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGAAGGGCTGGAAATTGGCCGATGTGCTAATAAGTCTTACTGTTACCATCTCAGGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCAGATTATTAGGCCACTTGCTGGTAAGTTTTCATTGGCCAGTTATACTGACTCTGACTTGGGAAGACCCAGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTAGAATTTTTAGGTGATAGGCAAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATAGGTCTCTAACTCAGGCCCAATCATCCCTTCCATGGCCCTGCCGTGTCCTTCCTCTAAGCATTGGGTTCTACCATTTAATAACTGTGTTTTCCCATCGCTGTGTCAATGTATTTCTGCCTACTGACCATGCCTGTCGGCCATTTTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTATTAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008293526                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTGATAGGATACATTAGCTGGGCCTGTGCCACTGATAGATACAATAGCTTCTATATCACTATTCCTAGCAGGCCTGAATACTGATCAGATTTTACATTAAGTGGAGTATGTATTAACATTGGAGGCAAACATCACTGGTGATATTGCCCATAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTATGGGCAGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACTCGTGAAGTTACTAATGAATACAGCAGACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTTAGCAAATCAGCCCACGTTTGATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGAGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGAAGGGCTGGAAATTGGCCGATGTGCTAATAAGTCTTACTGTTACCATCTCAGGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCAGATTATTAGGCCACTTGCTGGTAAGTTTTCATTGGCCAGTTATACTGACTxxxxxxTGGGAAxxxxCxGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTAxAxxTTTTAGGTGATAGGCAAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATAGGTCTCTAACTCAGGCCCAATCATCCCTTCCATGGCCCTGCCGTGTCCTTCCTCTAAGCATTGGGTTCTACCATTTAATAACTGTGTTTTCCCATCGCTGTGTCAATGTATTTCTGCCTACTGACCATGCCTGTCGGCCATTTTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTATTAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg       in                   TEgg007d02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACTTTTGCCCCATCACACCAGCAGCAGTTATCCCATCATAGGACTGACAGTATGAGTGATCCTTCCAAGGTGCAGCAACAGTAGTACCACTATGAGTCACGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGA
  5   1   2       ext Ovi1      in                        CABI10276.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCTATGAGTCCGTTACACTGCTGCCTGGAAAGGAGACAATAGGATCTGGTGGCAGTTTGGCATTTATAATCACTACGGATACAGCGCAATGAATGTTTGGTACGAGGCAGCGGAGCTCATTGAGATCATGCACGGATTGAAACTTGGCATGTACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTGATAGGATACATTAGCTGGGCCTGTGCCACTGATAGATACAATAGCTTCTATATCACTATTCCTAGCAGGCCTGAATACTGATCAGATTTTACATTAAGTGGAGTATGTATTAACATTGGAGGCAAACATCACTGGTGATATTGCCCATAAGTCGAAAGCAAAGGCAAAGATCTAATTTGGTGCTATGGGCAGCATCGCCAGTGATGCTTGTCCCCCAGTGTAATAAATACACT
  5   1   4      seed Te1       in                         CBWN5778.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACAATGCTCTGCTGCTCTATGGACTTGTTTGATGCAGAAGATAATTGGACGTGCAATGTTCTACACCAGTCTGGTACTGGAGATGCCTTCACAAACCACTAGGACAGCCTGGGAAATGCTCAAATGTTTGATGAACACAGGTTATATCTTTGCCCCTTTGCTGAGGATCATAATGCTGCCCCTACTTGCCACAGGATTTCAGATTTTAATTATAGGATATCAAGTAGTTTTAGGCATTAATATAAATAATTTCATAACAGAACTATTTTAGTACATTTACACAGAATAACAAAAAATGACTATTTAACAGTTAAAGTTACATCCTACAGTACTTAATACAATATATTTTAATGTGAAGCAGTGCAGTTTTCAGGACAGCCCCTAAATAAGATTCTTGAGGTGTCCTAGTTTGTGTTATCAGAACCAAGAGAGCCAGTGGGCTCAGCACAGCAAATGTATGCATGCCTGCTGGGCCTGTGCCACTGATAGGATACATTAGCTGGGCCTGTGCCACTGATAGATACAATAGCTTCTATATCACTATTCCTAGCAGGCCTGAATACTGATCAGATTTTACATTAAGTGGAGTATGTATTAACATTGGAGGCAAACATCACTGGTGATATTGCCCATAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTATGGGCGGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACTCGTGAAGTTACTAATGAATACAGCAGACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTT
  5   1   2       ext HdA       in                   THdA045l06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACATCACTGGTGATATTGCCNCATAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTATGGGCAGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACTCGTGAAGTTACTAATGAATACAGCAGACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTTAGCAAATCAGCCCACGTTTGATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGAGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGAAGGGCTGGAAATTGGCCGATGTGCTAATAAGTCTTACTGTTACCATCTCAGGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCAGATTATTAGGCCACTTGCTGGTAAGTTTTCATTGGCCAGTTATACTGACTGACTTGNGAACTGACCCAGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTAGAATTTTANGTGATANNGCAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATANGTCTCTAACTCAGGCCCAATCATCCCTTCCATGGCCCCTGCATGT
  5   1   2       add Limb                                CBSU1797.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTCACTGGTCTCCTACAAGTCGAAAGCAAAGGCAAAGATCTAATTGGTTGCTGTGGGCAGCATCGCCAGTGATGCTTGTCCCCAGTGTTAATAAATACACCCGTGAAGTTACTAATGAATACAGCAAACTCCCATTGTGAAACCTGATCTTCATCCTTACACACTGCGCTTAGCAAATCAGCCCACGTTTTATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGTGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGTTACCATCTCATGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCACATTATTACGCCACTTGCTGGTAAGTTTTCATTGGCCAGTTATACTGACTGACTTGGGAACTGACCCAGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTCGATTTTAGGTGATACGCAAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATAGGTCTCTAACTCAGGCCCAATCATCCCTTCCATTGCCCTGCCGTGTCCTTCATCTAAGCATTGGGTTCTACCATTTCATAACTGTGTT
  3  -1   3        nb Ovi1      in                         CABI5236.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGCTTAGCAAATCANGCCCACGTTTGATATGAAAAGTCACTTCTGAAGTTTTTGCTTGCGGCCTGGGCTATGTTTAGCTGAGGCAGAGTGCAGCAGAACAGGTTTTTCCAGTCCCCATGATTAAACAAAAGCAGGGCTGCACACCCTTTAGCACTTTGTTCATGTCCCAGTGCTCCCCCCCCATCAGCTTCAACCAGTGGAGGATTCCGGGAGTTGTACTTCAACAACTGAAGGGCTGGAAATTGGCCGATGTGCTAATAAGTCTTACTGTTACCATCTCAGGCTACTATATCTGCCCCCTACCTACAGCCACACAGTGCCCCCTATTTGCAACCCCTACAGACAGCCCTGCCTGTGCCCTGTCAGAT
  3   1   2       ext Egg       in                    TEgg007d02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTCATTGGCCAGTTATACTGACTGACTTGGGAACTGACCCAGCCAGATACAAATGCTTCGGCTGGATTCCAGGTTCACATTCCATGTTAGATTTTAGGTGATAGGCAAGAGATGACTTGTGCTATTACTGCCCGGAGCTAATAGGTCTCTAACTCAGGCCCAATCATCCCTTCCATGGCCCTGCCGTGTCCTTCCTCTAAGCATTGGGTTCTACCATTTAATAACTGTGTTTTCCCATCGCTGTGTCAATGTATTTCTGCCTACTGACCATGCCTGTCGGCCATTTTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTATTAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTAAAAAAAAAAAAAAAAAA
  3   1   2       ext Ovi1      in                        CABI10276.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAACCTCTCGCCCTAT
  3   1   4      seed Te1       in                         CBWN5778.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAA
  3   1   2       ext HdA       in                    THdA045l06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCGGCCCCCACACATTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTTTTTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTTTGAATCCCTTCAGCGTGTCAGAGGTGTTGTTGCCCACCCATCCATGTTTATTAGAGCCCCATTTTTTCCCCATGGTTTTATATGGAAGCATTTGCATTTTTTTGCAGATGGTTTAACAGAAAAAATTTTTACCTTTCAAAGCTTTGTTTATTTATTTCAAAAATGTTAAGTTAAAAAAAACCCTTAAGAAATTATTTATTGGAAGTTCCGTTTTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTCCCATATGTATGTGTTGTAAAGGAAAGTGATTTATTTTCATTAAGTTTTTCTTTTGCAGTGCATCTTCACACATGTTTTATTGGTTTTTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGTTGGGTGTGCTTACACCTCAGTGTTAATGAAGTGTTTATTGGAGAGGAACTGTCATTGTTTTCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATTTTTTCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5  -1   3        nb Ovi1      in                         CABI5236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATGGAAGCATTTGCACTTTTCTGCAGATGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTCCTCG
  5   1   2  SIG                                      Xt7.1-CABJ6318.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGGTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACGTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAGCGGCCGC
                                                  Xt7.1-CHK-1008293522                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACGTATTCTTTTTCTGTGGGACTTGTGTGTxTxxxxTxxxAxAxxxGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAGCGGCCGCACGCCT
  5   1   2       ext Ovi1      in                         CABI1154.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGAGGTGTTTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACGTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTGTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTAC
  5   1   4      seed Fat1      in                         CABC4849.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCAGAGCGTTGCAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGTGGGACTTGTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCT
  5   1   2       add Gas7                                 XZG25236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGACTTGTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCCTG
  3   1   3        nb Ski1 PIPE out                        CABJ6318.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGACTTGTGGTGTTTGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCAC
  3   1   2       ext Ovi1      in                         CABI1154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGTGTGTGTTTGTTTCAGAAAATGAGACAGAATTTCACTATTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATGCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATCCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAACTG
  3   1   4      seed Fat1      in                         CABC4849.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAATGAGACAGAATTTCACTATTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAGCGGCCGCACGCCTCTCG
  5  -1   3        nb Abd0                               IMAGE:7018095                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAATACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCACAAAAAAAAAAAAAAAAAAAA
  5   1   3        nb Bone      in                        CBTC3200.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCAC
  3   1   3        nb Bone      in                        CBTC3200.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCAC
  3   1   3        nb Eye                                  CCAX6310.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACCCCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCCCCCAAATTGTAGTGGATGTTAAATAAATTTTTTCCCC
  5   1   2  SIG                                      Xt7.1-XZT16244.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGCAGATTGTGGGACTTTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAACAAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATC------------AAAAAAAAAAAA
                                                  Xt7.1-CHK-1008293524                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGCAGATTGTGGGACTTTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAACAAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCC------------AAAAAAAAAAAA
  5   1   4      seed Tad5      in                         XZT16244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGGCATCTCCGGAACCAGATGAAGTAAATATCAGGTAAACCTATTCTTTTTCTGCAGATTGTGGGACTTTGTGTGTTTGGTTTCAGAAATGAGACAGAATTTCACTATTTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAACAAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCC
  3   1   4      seed Tad5      in                         XZT16244.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTAATGATATAACACTATTTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATACTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAACAAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCAC
  5  -1   3        nb Brn3      out                        CAAK2058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGAGGATGTTGGAAATCAGAGTCTATATTGTACAGCCGGTGTAAAATATTCTGTAAATCCTGACATATATATATGGATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAAACAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCCC
  3   1   3        nb Te3       out                        CAAM2227.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAATATAAGGAAGCAGAATTTTATATGATGCATGGCTGTAGGAGTTAATGTTTCTATAAAGCCCCCCGGTTTCTGAAACACATCTCCCCCCGCCCCCACACACTTTTTAAAAAAAAACAAAAACTTTGTTTACAGTTTTGTTGCTGTTTCTGCGTGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCCC
  3   1   2       ext Te4       in                         CAAN7004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCCC
  5   1   2       ext Te4       in                         CAAN7004.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTCTCTTATTGGTCGATCGTATCATGTTGTGGGGAGCTATTGGTTCATTTCTGAATGCCTTCAGCGTGTCAGAGGTGTTGCTGCCCAGCCATCCATGCTTATTAGAGCCCCATTTTATCCCCATGGTTTTATATGGAAGCATTTGCACTTTTCTGCAGATGGTTTAACAGAAAAAAACTCTTACCTCTCAAAGCTTTGTCTATTTATGTCAAAAATGTTAAGCTAAAAAAAAACCTTAAGAAACTACTTATTGGAAGTTCCGTTCTAGGAGTGTTTTTTACAAAATGATATACAAATATATATATATACAGTGTATTTTTACCATATGTATGTGTTGTAAAGGAAAGTGATTTACTCTCACTAAGTGTCTCCTTTGCAGTGCATCCTCACACATGCTTTACTGGTGTCTGGCGCTGCCGCTGGGGTGCCCCCTGTTATTGGGGTGCTCGGTGTGCCTACACCTCAGTGCTAATGAAGTGCTTATTGGAGAGGAACTGTCATTGCTATCAAATGCACCCAAATTGTAGTGGATGTTAAATAAATCTCTTCCNCNNAAAAAAAAAAAAAAAAAAAAAAAANNAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)