Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN11765.5                          11 END     6          33       60                HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012154745 Xt7.1-TEgg040h18.3.5 - 18 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TEgg040h18.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTT
                                                  Xt7.1-CHK-1008266550                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     3     5     3     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     6     7     6     7     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     9     9     9    10     9    10    10    11    10    11    10    11     9    10     9    10     9    10     9    10    10    10    11    11    11    12    11    12    11    12    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     8    10     8    10     8    10     8    10     7     9
  5   1   2       e50                                 Xt7.1-CAAO6069.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTCTTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATG
  5   1   2       e50                               Xt7.1-TEgg040h18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTT
                                                                       ...PROTEIN --- Ci ---- 1e-029     FAA00228.1 TPA: zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 6e-079     XP_001195336.1 PREDICTED: similar to LD10565p [Strongylocentrotus purpuratus] -----------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-080     NP_573059.1 CG8184-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 5e-082     NP_010745.1 Temperature dependent Organization in Mitotic nucleus; hect-domain-containing protein, containing kinase motifs; similar to Rsp5 [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-082     NP_500284.2 UBA TS-N domain HECT-domain family member [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 4e-083     XP_417330.2 PREDICTED: similar to Itchy E3 ubiquitin protein ligase [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 2e-083     XP_690824.1 PREDICTED: similar to HECT, UBA and WWE domain containing 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_766061.1 cDNA sequence BC025474 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_065822.2 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH77993.1 Hace1-prov protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001087077.1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          CAJ83645.1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg040h18.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---TAATGA------TAA---------------TGA------------------------------------------------------------------------------TGA---------------TAA---------------------------------ATG---ATG------------------TAA---------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------TGA------TAG------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------ATG---------------------TAATAA------------------------------------ATG------------------------------------------------------------------------------------------TGA------------------------------------------------TAAATG---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       e50                                 Xt7.1-CAAO6069.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTCTTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATG
                                                  Xt7.1-CHK-1008248476                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATT
  5   1   2      seed Te5       in                         CAAO6069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTCTTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCA
  5   1   2       bld Gas                            TGas079e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGGTTTATGCATATTATAAAAGCACAGCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACCTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAGCCTG
  5   1   2       bld Egg       in                   TEgg060a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTTAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATT
  5   1   2       e50                               Xt7.1-TEgg040h18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTT
                                                  Xt7.1-CHK-1008232539                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTT
  5   1   2       bld Ski1      in                         CABJ6113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAATGGTGCTGAGCCAGTGTAAATTTGTCCCCTACACACCCGCTAACTGCCTTTTGCTGTTTGTGCAATGCAGGGACTGGAACAGCTGCAAACACATAGGTTGTTGGTGCAATGCAGGGACTGGAACAGCTGCAAACACATAGGTTGTTGGTTCTTTCATCTAATTAAAAAAAACAAAAAAAAAACTGGCTTGTACATCAAACTGTTTATTTACAGACAAGCTTCTACAGTACTCTGGCTAATGTATTCAGAGTGCCTTTCATCAGCAGATAATATGTGAGTGTTTTGCTCCTTGCTTTTCTGCAGGTACTCTGAGCAGCGATTCTTCATCCCTATAACCCCATTTCCATATAAAAGTCCTGCATACTGGCTTAACATTTGGGTAGCCTCTGAGACATCTGCTGCCCTTTGATACTTGTGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGNGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTG
  5   1   2       bld Liv1      in                        CAAR12341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGCTCAAACCTCCCGGCCTGGGGCGAGAGACTGTGCAGCTTTCTCAGCTCTCCCCCTCCCTCCTCCCCTCCCTGCTGTAATCTGAGCCCAGAGCTACGAGCCAGCCAGAGACACAAGGGTGCAGGAGAAGGAAgtgacgtcacaccaagctattatggcagctgctttctttaaaacagagagcttctagggctgtttactcagTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCAC
  3   1   2       bld Te4       out                        CAAN4413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGAGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATC
  5   1   2       bld Egg       in                   TEgg015a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATG
  5  -1   2       bld Int1      out                       CAAP12089.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAAT
  3   1   2       bld Ski1      in                         CABJ6113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAAGCACATGCATCAACATGCTAAAATTGCNTGAGTACCCAAGTAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGCAAAAAAAGCCCTCTCGCCCTATA
  3   1   2      seed Egg  FL   out                   TEgg040h18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg060a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      out                        CAAP6608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATAC
  3   1   2       bld Liv1      in                        CAAR12341.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Te5       in                         CAAO6069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGACCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Te3  5g3  out                        CAAM5419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Te4       out                        CAAN9132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGGGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Egg       in                    TEgg015a15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGAATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  ?                     TEgg006n23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGAATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTTTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGCAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)