Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN11765.5                          11 END     6          33       60                HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012154745 Xt7.1-TEgg040h18.3.5 - 18 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     3     5     3     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     6     7     6     7     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     9     9     9    10     9    10    10    11    10    11    10    11     9    10     9    10     9    10     9    10    10    10    11    11    11    12    11    12    11    12    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     9    11     8    10     8    10     8    10     8    10     7     9
  5   1   2       e50                                 Xt7.1-CAAO6069.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTCTTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATG
  5   1   2       e50                               Xt7.1-TEgg040h18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTT
                                                                       ...PROTEIN --- Ci ---- 1e-029     FAA00228.1 TPA: zinc finger protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Sp ---- 6e-079     XP_001195336.1 PREDICTED: similar to LD10565p [Strongylocentrotus purpuratus] -----------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-080     NP_573059.1 CG8184-PB [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 5e-082     NP_010745.1 Temperature dependent Organization in Mitotic nucleus; hect-domain-containing protein, containing kinase motifs; similar to Rsp5 [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-082     NP_500284.2 UBA TS-N domain HECT-domain family member [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 4e-083     XP_417330.2 PREDICTED: similar to Itchy E3 ubiquitin protein ligase [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 2e-083     XP_690824.1 PREDICTED: similar to HECT, UBA and WWE domain containing 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_766061.1 cDNA sequence BC025474 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_065822.2 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH77993.1 Hace1-prov protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001087077.1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          CAJ83645.1 HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TEgg040h18.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---TAATGA------TAA---------------TGA------------------------------------------------------------------------------TGA---------------TAA---------------------------------ATG---ATG------------------TAA---------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------TGA------TAG------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------ATG---------------------TAATAA------------------------------------ATG------------------------------------------------------------------------------------------TGA------------------------------------------------TAAATG---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       e50                                 Xt7.1-CAAO6069.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTCTTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATG
                                                  Xt7.1-CHK-1008248476                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATT
  5   1   2      seed Te5       in                         CAAO6069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTCTTTTGGAATGCCCTGAATTGATGTCTCGGTTTATGCATATCATAAAAGCACAGCCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCA
  5   1   2       bld Gas                            TGas079e12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCGGTTTATGCATATTATAAAAGCACAGCCTTTTAAAGAACGGTGCGAATGGTTTTACGAACACTTACTTGCTGGACAACCTGATTCCGATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACCTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAGCCTG
  5   1   2       bld Egg       in                   TEgg060a07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATATGGTTCATAGACCTGTAAATGAGAATGATATACTGCTGGTTCATAGAGATTCTATTTTTAGGAGTAGCTGTGAAGTAGTGTTCAAATCCAACTGTGAAAAACTAAAGCAAGGGATTGCTGTGCGTTTTCACGGAGAAGAAGGCATGGGACAAGGCGTTGTGAGGGAGTGGTTTGATATATTATCTTCCGAAATTATCAATCCTGACTATGCTCTCTTCACACAGTCAGCAGACGGAACAACCTTCCAGCCAAACAGCAACTCTTCTGTAAATCCAGACCATCTCAACTACTTTAGATTTGCGGGGGAAATCCTGGGCTTGGCTCTCTATCATAGACAACTGGTCAACATTTATTTCACCAGGTCATTTTACAAGCACATCCTTGGTATTCCAGTAAATTATCAAGACGTAGCCTCCATTGACCCAGAATACGCAAAGAACCTGCAGTGGATATTAGATAATGATATTAGTGACTTAGGACTGGAACTCACTTTCTCAGTTGAGACAGATGTGTTTGGAGCTATGGAGGAAGTCCCCTTAAAGCCTGGAGGAGCAAGCATCCTTGTTACTTAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATT
  5   1   2       e50                               Xt7.1-TEgg040h18.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTT
                                                  Xt7.1-CHK-1008232539                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTT
  5   1   2       bld Ski1      in                         CABJ6113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAATGGTGCTGAGCCAGTGTAAATTTGTCCCCTACACACCCGCTAACTGCCTTTTGCTGTTTGTGCAATGCAGGGACTGGAACAGCTGCAAACACATAGGTTGTTGGTGCAATGCAGGGACTGGAACAGCTGCAAACACATAGGTTGTTGGTTCTTTCATCTAATTAAAAAAAACAAAAAAAAAACTGGCTTGTACATCAAACTGTTTATTTACAGACAAGCTTCTACAGTACTCTGGCTAATGTATTCAGAGTGCCTTTCATCAGCAGATAATATGTGAGTGTTTTGCTCCTTGCTTTTCTGCAGGTACTCTGAGCAGCGATTCTTCATCCCTATAACCCCATTTCCATATAAAAGTCCTGCATACTGGCTTAACATTTGGGTAGCCTCTGAGACATCTGCTGCCCTTTGATACTTGTGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGNGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTG
  5   1   2       bld Liv1      in                        CAAR12341.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGCTCAAACCTCCCGGCCTGGGGCGAGAGACTGTGCAGCTTTCTCAGCTCTCCCCCTCCCTCCTCCCCTCCCTGCTGTAATCTGAGCCCAGAGCTACGAGCCAGCCAGAGACACAAGGGTGCAGGAGAAGGAAgtgacgtcacaccaagctattatggcagctgctttctttaaaacagagagcttctagggctgtttactcagTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCAC
  3   1   2       bld Te4       out                        CAAN4413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAGCAAGCATCCTTGTTACTCAAGAGAACAAGGCAGAATATGTTCAGCTTGTTACTGAGCTTCGTATGACAAGAGCAATTCAGCCTCAGATCAATGGATTTTTGCAGGGCTTTCATATGTTTATTCCACCTTCTCTAATACAACTGTTTGATGAATATGAGCTGGAGCTGCTTCTGTCCGGCATGCCAGAAATTGATGTGAATGACTGGATGAAAAATACAGAATATACTAGTGGCTATGAAAGGGATGACCAAGTAATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGAGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATC
  5   1   2       bld Egg       in                   TEgg015a15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCAGTGGTTCTGGGAAGTTGTGCAGGAGCTAACACAAGAGGAGAGAGTTCTGCTTTTACAGTTTGTAACGGGCAGTTCCCGTGTACCTCATGGTGGCTTTGCATATATCATGGGTGGAAGTGGGCTACAAAATTTCACCATAGCAGCAGTAGCATATACACCAAATCTGTTGCCAACGTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATG
  5  -1   2       bld Int1      out                       CAAP12089.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAAT
  3   1   2       bld Ski1      in                         CABJ6113.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCAAGCACATGCATCAACATGCTAAAATTGCNTGAGTACCCAAGTAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGCAAAAAAAGCCCTCTCGCCCTATA
  3   1   2      seed Egg  FL   out                   TEgg040h18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCACATGCATCAACATGCTAAAATTGCCTGAGTACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg       in                    TEgg060a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACCCAAGTAAAGAAATCCTTAAAGACAGGCTTCTGGTGGCATTGCACTGTGGAAGCTACGGTTACACAATGGCATAATGAAGAAAGTAAAACTCATCTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Int1      out                        CAAP6608.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATAC
  3   1   2       bld Liv1      in                        CAAR12341.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Te5       in                         CAAO6069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTACTGATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGACCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Te3  5g3  out                        CAAM5419.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCGCAATTCAGACTGGCAGAACCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Te4       out                        CAAN9132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAATTTAGAAAACTGTCAAGAGAAAAACAAGCTAGATATTGCCCACAGGCAGGGCTGACTTTCAAAAGATGTGTAAAGTATCTTTTTTTCCCTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGGGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGC
  3   1   2       bld Egg       in                    TEgg015a15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAGATTATCTGTTGCTTATGGGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGAATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTCTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  ?                     TEgg006n23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATGTGTAATTCTGTTTTTATTTAAATACTGGCAAAATCAATGAGTTATCAGTGGTTTCTTTTTTTTAAATGAGAGATCTAATTTCCAAATTGCCTTGTTTTCAAATTGTTTTAAATTTGATTTGTGGTTTCTTTTATATGCCAAAATGAACACTTGTGTATTTTTATTTTTATTATGAAGATGTTAGCGGTATGATTGTGGTGCGGGCAATGTAAGTGTTGTGGAAAAAGACGGCATATTACTTTGCCTGTCCTTATATTTTTGCAATTTTAATGGAGTTGTGTTGAAAAATGAATACAGTATATTCTAATCTGGCCACAAAGCTGACTACAATATACCCTGTATTTTAGTTTGCACACTTTGTATTGTTCTATATCTGACAATGGTTTTGTTTTTGTGCCTTTTTTAATAATTTTGTTGTATAGTTGGCCATGAATAATGAGGCAGTTATGTTAATATATATTTTATCCTTGCAAAATGTCCTTTTTATTCTGTATATTTATGTTTATTTTGTGAAACTGACCTTTCTTGTGCAAGAAATCTGAAATGTATTTTTGTACAAGGACGTTTGCAGAAATGTATACAACATTTTATAAATGGTTTTTAATACATTGACACAATAAATACAAATCTTTTTTGCTTTGCAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (